Links to Exploration step
Le document en format XML
<record><TEI><teiHeader><fileDesc><titleStmt><title xml:lang="en">Emergence of a Globally Dominant IncHI1 Plasmid Type Associated with Multiple Drug Resistant Typhoid</title>
<author><name sortKey="Holt, Kathryn E" sort="Holt, Kathryn E" uniqKey="Holt K" first="Kathryn E." last="Holt">Kathryn E. Holt</name>
<affiliation><nlm:aff id="aff1"><addr-line>Wellcome Trust Sanger Institute, Hinxton, Cambridge, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2"><addr-line>Department of Microbiology and Immunology, University of Melbourne, Melbourne, Australia</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Phan, Minh Duy" sort="Phan, Minh Duy" uniqKey="Phan M" first="Minh Duy" last="Phan">Minh Duy Phan</name>
<affiliation><nlm:aff id="aff1"><addr-line>Wellcome Trust Sanger Institute, Hinxton, Cambridge, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff3"><addr-line>School of Chemistry and Molecular Biosciences, Australian Infectious Diseases Research Centre, University of Queensland, Brisbane, Queensland, Australia</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Baker, Stephen" sort="Baker, Stephen" uniqKey="Baker S" first="Stephen" last="Baker">Stephen Baker</name>
<affiliation><nlm:aff id="aff4"><addr-line>Oxford University Clinical Research Unit, Wellcome Trust Major Overseas Programme, The Hospital for Tropical Diseases, Ho Chi Minh City, Vietnam</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Duy, Pham Thanh" sort="Duy, Pham Thanh" uniqKey="Duy P" first="Pham Thanh" last="Duy">Pham Thanh Duy</name>
<affiliation><nlm:aff id="aff4"><addr-line>Oxford University Clinical Research Unit, Wellcome Trust Major Overseas Programme, The Hospital for Tropical Diseases, Ho Chi Minh City, Vietnam</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Nga, Tran Vu Thieu" sort="Nga, Tran Vu Thieu" uniqKey="Nga T" first="Tran Vu Thieu" last="Nga">Tran Vu Thieu Nga</name>
<affiliation><nlm:aff id="aff4"><addr-line>Oxford University Clinical Research Unit, Wellcome Trust Major Overseas Programme, The Hospital for Tropical Diseases, Ho Chi Minh City, Vietnam</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Nair, Satheesh" sort="Nair, Satheesh" uniqKey="Nair S" first="Satheesh" last="Nair">Satheesh Nair</name>
<affiliation><nlm:aff id="aff5"><addr-line>Laboratory of Enteric Pathogens, Health Protection Agency, Colindale, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Turner, A Keith" sort="Turner, A Keith" uniqKey="Turner A" first="A. Keith" last="Turner">A. Keith Turner</name>
<affiliation><nlm:aff id="aff1"><addr-line>Wellcome Trust Sanger Institute, Hinxton, Cambridge, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Walsh, Ciara" sort="Walsh, Ciara" uniqKey="Walsh C" first="Ciara" last="Walsh">Ciara Walsh</name>
<affiliation><nlm:aff id="aff6"><addr-line>Food Safety Authority of Ireland, Dublin, Ireland</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Fanning, Seamus" sort="Fanning, Seamus" uniqKey="Fanning S" first="Séamus" last="Fanning">Séamus Fanning</name>
<affiliation><nlm:aff id="aff7"><addr-line>School of Public Health, Physiotherapy and Population Science, UCD Centre for Food Safety, Veterinary Sciences Centre, University College Dublin, Belfield, Dublin, Ireland</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Farrell Ward, Sinead" sort="Farrell Ward, Sinead" uniqKey="Farrell Ward S" first="Sinéad" last="Farrell-Ward">Sinéad Farrell-Ward</name>
<affiliation><nlm:aff id="aff7"><addr-line>School of Public Health, Physiotherapy and Population Science, UCD Centre for Food Safety, Veterinary Sciences Centre, University College Dublin, Belfield, Dublin, Ireland</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Dutta, Shanta" sort="Dutta, Shanta" uniqKey="Dutta S" first="Shanta" last="Dutta">Shanta Dutta</name>
<affiliation><nlm:aff id="aff8"><addr-line>National Institute of Cholera and Enteric Diseases, Kolkata, India</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Kariuki, Sam" sort="Kariuki, Sam" uniqKey="Kariuki S" first="Sam" last="Kariuki">Sam Kariuki</name>
<affiliation><nlm:aff id="aff9"><addr-line>Kenya Medical Research Institute, Nairobi, Kenya</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Weill, Francois Xavier" sort="Weill, Francois Xavier" uniqKey="Weill F" first="François-Xavier" last="Weill">François-Xavier Weill</name>
<affiliation><nlm:aff id="aff10"><addr-line>Institut Pasteur, Unité des Bactéries Pathogènes Entériques, Paris, France</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Parkhill, Julian" sort="Parkhill, Julian" uniqKey="Parkhill J" first="Julian" last="Parkhill">Julian Parkhill</name>
<affiliation><nlm:aff id="aff1"><addr-line>Wellcome Trust Sanger Institute, Hinxton, Cambridge, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Dougan, Gordon" sort="Dougan, Gordon" uniqKey="Dougan G" first="Gordon" last="Dougan">Gordon Dougan</name>
<affiliation><nlm:aff id="aff1"><addr-line>Wellcome Trust Sanger Institute, Hinxton, Cambridge, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Wain, John" sort="Wain, John" uniqKey="Wain J" first="John" last="Wain">John Wain</name>
<affiliation><nlm:aff id="aff5"><addr-line>Laboratory of Enteric Pathogens, Health Protection Agency, Colindale, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt><idno type="wicri:source">PMC</idno>
<idno type="pmid">21811646</idno>
<idno type="pmc">3139670</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3139670</idno>
<idno type="RBID">PMC:3139670</idno>
<idno type="doi">10.1371/journal.pntd.0001245</idno>
<date when="2011">2011</date>
<idno type="wicri:Area/Pmc/Corpus">002928</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">002928</idno>
</publicationStmt>
<sourceDesc><biblStruct><analytic><title xml:lang="en" level="a" type="main">Emergence of a Globally Dominant IncHI1 Plasmid Type Associated with Multiple Drug Resistant Typhoid</title>
<author><name sortKey="Holt, Kathryn E" sort="Holt, Kathryn E" uniqKey="Holt K" first="Kathryn E." last="Holt">Kathryn E. Holt</name>
<affiliation><nlm:aff id="aff1"><addr-line>Wellcome Trust Sanger Institute, Hinxton, Cambridge, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2"><addr-line>Department of Microbiology and Immunology, University of Melbourne, Melbourne, Australia</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Phan, Minh Duy" sort="Phan, Minh Duy" uniqKey="Phan M" first="Minh Duy" last="Phan">Minh Duy Phan</name>
<affiliation><nlm:aff id="aff1"><addr-line>Wellcome Trust Sanger Institute, Hinxton, Cambridge, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff3"><addr-line>School of Chemistry and Molecular Biosciences, Australian Infectious Diseases Research Centre, University of Queensland, Brisbane, Queensland, Australia</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Baker, Stephen" sort="Baker, Stephen" uniqKey="Baker S" first="Stephen" last="Baker">Stephen Baker</name>
<affiliation><nlm:aff id="aff4"><addr-line>Oxford University Clinical Research Unit, Wellcome Trust Major Overseas Programme, The Hospital for Tropical Diseases, Ho Chi Minh City, Vietnam</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Duy, Pham Thanh" sort="Duy, Pham Thanh" uniqKey="Duy P" first="Pham Thanh" last="Duy">Pham Thanh Duy</name>
<affiliation><nlm:aff id="aff4"><addr-line>Oxford University Clinical Research Unit, Wellcome Trust Major Overseas Programme, The Hospital for Tropical Diseases, Ho Chi Minh City, Vietnam</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Nga, Tran Vu Thieu" sort="Nga, Tran Vu Thieu" uniqKey="Nga T" first="Tran Vu Thieu" last="Nga">Tran Vu Thieu Nga</name>
<affiliation><nlm:aff id="aff4"><addr-line>Oxford University Clinical Research Unit, Wellcome Trust Major Overseas Programme, The Hospital for Tropical Diseases, Ho Chi Minh City, Vietnam</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Nair, Satheesh" sort="Nair, Satheesh" uniqKey="Nair S" first="Satheesh" last="Nair">Satheesh Nair</name>
<affiliation><nlm:aff id="aff5"><addr-line>Laboratory of Enteric Pathogens, Health Protection Agency, Colindale, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Turner, A Keith" sort="Turner, A Keith" uniqKey="Turner A" first="A. Keith" last="Turner">A. Keith Turner</name>
<affiliation><nlm:aff id="aff1"><addr-line>Wellcome Trust Sanger Institute, Hinxton, Cambridge, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Walsh, Ciara" sort="Walsh, Ciara" uniqKey="Walsh C" first="Ciara" last="Walsh">Ciara Walsh</name>
<affiliation><nlm:aff id="aff6"><addr-line>Food Safety Authority of Ireland, Dublin, Ireland</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Fanning, Seamus" sort="Fanning, Seamus" uniqKey="Fanning S" first="Séamus" last="Fanning">Séamus Fanning</name>
<affiliation><nlm:aff id="aff7"><addr-line>School of Public Health, Physiotherapy and Population Science, UCD Centre for Food Safety, Veterinary Sciences Centre, University College Dublin, Belfield, Dublin, Ireland</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Farrell Ward, Sinead" sort="Farrell Ward, Sinead" uniqKey="Farrell Ward S" first="Sinéad" last="Farrell-Ward">Sinéad Farrell-Ward</name>
<affiliation><nlm:aff id="aff7"><addr-line>School of Public Health, Physiotherapy and Population Science, UCD Centre for Food Safety, Veterinary Sciences Centre, University College Dublin, Belfield, Dublin, Ireland</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Dutta, Shanta" sort="Dutta, Shanta" uniqKey="Dutta S" first="Shanta" last="Dutta">Shanta Dutta</name>
<affiliation><nlm:aff id="aff8"><addr-line>National Institute of Cholera and Enteric Diseases, Kolkata, India</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Kariuki, Sam" sort="Kariuki, Sam" uniqKey="Kariuki S" first="Sam" last="Kariuki">Sam Kariuki</name>
<affiliation><nlm:aff id="aff9"><addr-line>Kenya Medical Research Institute, Nairobi, Kenya</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Weill, Francois Xavier" sort="Weill, Francois Xavier" uniqKey="Weill F" first="François-Xavier" last="Weill">François-Xavier Weill</name>
<affiliation><nlm:aff id="aff10"><addr-line>Institut Pasteur, Unité des Bactéries Pathogènes Entériques, Paris, France</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Parkhill, Julian" sort="Parkhill, Julian" uniqKey="Parkhill J" first="Julian" last="Parkhill">Julian Parkhill</name>
<affiliation><nlm:aff id="aff1"><addr-line>Wellcome Trust Sanger Institute, Hinxton, Cambridge, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Dougan, Gordon" sort="Dougan, Gordon" uniqKey="Dougan G" first="Gordon" last="Dougan">Gordon Dougan</name>
<affiliation><nlm:aff id="aff1"><addr-line>Wellcome Trust Sanger Institute, Hinxton, Cambridge, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Wain, John" sort="Wain, John" uniqKey="Wain J" first="John" last="Wain">John Wain</name>
<affiliation><nlm:aff id="aff5"><addr-line>Laboratory of Enteric Pathogens, Health Protection Agency, Colindale, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
</author>
</analytic>
<series><title level="j">PLoS Neglected Tropical Diseases</title>
<idno type="ISSN">1935-2727</idno>
<idno type="eISSN">1935-2735</idno>
<imprint><date when="2011">2011</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc><textClass></textClass>
</profileDesc>
</teiHeader>
<front><div type="abstract" xml:lang="en"><p>Typhoid fever, caused by <italic>Salmonella enterica</italic>
serovar Typhi (<italic>S</italic>
. Typhi), remains a serious global health concern. Since their emergence in the mid-1970s multi-drug resistant (MDR) <italic>S</italic>
. Typhi now dominate drug sensitive equivalents in many regions. MDR in <italic>S</italic>
. Typhi is almost exclusively conferred by self-transmissible IncHI1 plasmids carrying a suite of antimicrobial resistance genes. We identified over 300 single nucleotide polymorphisms (SNPs) within conserved regions of the IncHI1 plasmid, and genotyped both plasmid and chromosomal SNPs in over 450 <italic>S</italic>
. Typhi dating back to 1958. Prior to 1995, a variety of IncHI1 plasmid types were detected in distinct <italic>S</italic>
. Typhi haplotypes. Highly similar plasmids were detected in co-circulating <italic>S</italic>
. Typhi haplotypes, indicative of plasmid transfer. In contrast, from 1995 onwards, 98% of MDR <italic>S</italic>
. Typhi were plasmid sequence type 6 (PST6) and <italic>S</italic>
. Typhi haplotype H58, indicating recent global spread of a dominant MDR clone. To investigate whether PST6 conferred a selective advantage compared to other IncHI1 plasmids, we used a phenotyping array to compare the impact of IncHI1 PST6 and PST1 plasmids in a common <italic>S</italic>
. Typhi host. The PST6 plasmid conferred the ability to grow in high salt medium (4.7% NaCl), which we demonstrate is due to the presence in PST6 of the Tn<italic>6062</italic>
transposon encoding BetU.</p>
</div>
</front>
<back><div1 type="bibliography"><listBibl><biblStruct><analytic><author><name sortKey="Kothari, A" uniqKey="Kothari A">A Kothari</name>
</author>
<author><name sortKey="Pruthi, A" uniqKey="Pruthi A">A Pruthi</name>
</author>
<author><name sortKey="Chugh, Td" uniqKey="Chugh T">TD Chugh</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Crump, Ja" uniqKey="Crump J">JA Crump</name>
</author>
<author><name sortKey="Luby, Sp" uniqKey="Luby S">SP Luby</name>
</author>
<author><name sortKey="Mintz, Ed" uniqKey="Mintz E">ED Mintz</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Whitaker, Ja" uniqKey="Whitaker J">JA Whitaker</name>
</author>
<author><name sortKey="Franco Paredes, C" uniqKey="Franco Paredes C">C Franco-Paredes</name>
</author>
<author><name sortKey="Del Rio, C" uniqKey="Del Rio C">C del Rio</name>
</author>
<author><name sortKey="Edupuganti, S" uniqKey="Edupuganti S">S Edupuganti</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ochiai, Rl" uniqKey="Ochiai R">RL Ochiai</name>
</author>
<author><name sortKey="Acosta, Cj" uniqKey="Acosta C">CJ Acosta</name>
</author>
<author><name sortKey="Agtini, M" uniqKey="Agtini M">M Agtini</name>
</author>
<author><name sortKey="Bhattacharya, Sk" uniqKey="Bhattacharya S">SK Bhattacharya</name>
</author>
<author><name sortKey="Bhutta, Za" uniqKey="Bhutta Z">ZA Bhutta</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Colquhoun, J" uniqKey="Colquhoun J">J Colquhoun</name>
</author>
<author><name sortKey="Weetch, Rs" uniqKey="Weetch R">RS Weetch</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Olarte, J" uniqKey="Olarte J">J Olarte</name>
</author>
<author><name sortKey="Galindo, E" uniqKey="Galindo E">E Galindo</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Anderson, Es" uniqKey="Anderson E">ES Anderson</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Chau, Tt" uniqKey="Chau T">TT Chau</name>
</author>
<author><name sortKey="Campbell, Ji" uniqKey="Campbell J">JI Campbell</name>
</author>
<author><name sortKey="Galindo, Cm" uniqKey="Galindo C">CM Galindo</name>
</author>
<author><name sortKey="Van Minh Hoang, N" uniqKey="Van Minh Hoang N">N Van Minh Hoang</name>
</author>
<author><name sortKey="Diep, Ts" uniqKey="Diep T">TS Diep</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ochiai, Rl" uniqKey="Ochiai R">RL Ochiai</name>
</author>
<author><name sortKey="Acosta, Cj" uniqKey="Acosta C">CJ Acosta</name>
</author>
<author><name sortKey="Danovaro Holliday, Mc" uniqKey="Danovaro Holliday M">MC Danovaro-Holliday</name>
</author>
<author><name sortKey="Baiqing, D" uniqKey="Baiqing D">D Baiqing</name>
</author>
<author><name sortKey="Bhattacharya, Sk" uniqKey="Bhattacharya S">SK Bhattacharya</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Hermans, Pw" uniqKey="Hermans P">PW Hermans</name>
</author>
<author><name sortKey="Saha, Sk" uniqKey="Saha S">SK Saha</name>
</author>
<author><name sortKey="Van Leeuwen, Wj" uniqKey="Van Leeuwen W">WJ van Leeuwen</name>
</author>
<author><name sortKey="Verbrugh, Ha" uniqKey="Verbrugh H">HA Verbrugh</name>
</author>
<author><name sortKey="Van Belkum, A" uniqKey="Van Belkum A">A van Belkum</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Connerton, P" uniqKey="Connerton P">P Connerton</name>
</author>
<author><name sortKey="Wain, J" uniqKey="Wain J">J Wain</name>
</author>
<author><name sortKey="Hien, Tt" uniqKey="Hien T">TT Hien</name>
</author>
<author><name sortKey="Ali, T" uniqKey="Ali T">T Ali</name>
</author>
<author><name sortKey="Parry, C" uniqKey="Parry C">C Parry</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Rowe, B" uniqKey="Rowe B">B Rowe</name>
</author>
<author><name sortKey="Ward, Lr" uniqKey="Ward L">LR Ward</name>
</author>
<author><name sortKey="Threlfall, Ej" uniqKey="Threlfall E">EJ Threlfall</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Nagshetty, K" uniqKey="Nagshetty K">K Nagshetty</name>
</author>
<author><name sortKey="Channappa, St" uniqKey="Channappa S">ST Channappa</name>
</author>
<author><name sortKey="Gaddad, Sm" uniqKey="Gaddad S">SM Gaddad</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kasper, Mr" uniqKey="Kasper M">MR Kasper</name>
</author>
<author><name sortKey="Sokhal, B" uniqKey="Sokhal B">B Sokhal</name>
</author>
<author><name sortKey="Blair, Pj" uniqKey="Blair P">PJ Blair</name>
</author>
<author><name sortKey="Wierzba, Tf" uniqKey="Wierzba T">TF Wierzba</name>
</author>
<author><name sortKey="Putnam, Sd" uniqKey="Putnam S">SD Putnam</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Holt, K" uniqKey="Holt K">K Holt</name>
</author>
<author><name sortKey="Dolecek, C" uniqKey="Dolecek C">C Dolecek</name>
</author>
<author><name sortKey="Chau, T" uniqKey="Chau T">T Chau</name>
</author>
<author><name sortKey="Duy, P" uniqKey="Duy P">P Duy</name>
</author>
<author><name sortKey="La, Ttp" uniqKey="La T">TTP La</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Mengo, Dm" uniqKey="Mengo D">DM Mengo</name>
</author>
<author><name sortKey="Kariuki, S" uniqKey="Kariuki S">S Kariuki</name>
</author>
<author><name sortKey="Muigai, A" uniqKey="Muigai A">A Muigai</name>
</author>
<author><name sortKey="Revathi, G" uniqKey="Revathi G">G Revathi</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Al Sanouri, Tm" uniqKey="Al Sanouri T">TM Al-Sanouri</name>
</author>
<author><name sortKey="Paglietti, B" uniqKey="Paglietti B">B Paglietti</name>
</author>
<author><name sortKey="Haddadin, A" uniqKey="Haddadin A">A Haddadin</name>
</author>
<author><name sortKey="Murgia, M" uniqKey="Murgia M">M Murgia</name>
</author>
<author><name sortKey="Bacciu, D" uniqKey="Bacciu D">D Bacciu</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Patel, Ta" uniqKey="Patel T">TA Patel</name>
</author>
<author><name sortKey="Armstrong, M" uniqKey="Armstrong M">M Armstrong</name>
</author>
<author><name sortKey="Morris Jones, Sd" uniqKey="Morris Jones S">SD Morris-Jones</name>
</author>
<author><name sortKey="Wright, Sg" uniqKey="Wright S">SG Wright</name>
</author>
<author><name sortKey="Doherty, T" uniqKey="Doherty T">T Doherty</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lynch, Mf" uniqKey="Lynch M">MF Lynch</name>
</author>
<author><name sortKey="Blanton, Em" uniqKey="Blanton E">EM Blanton</name>
</author>
<author><name sortKey="Bulens, S" uniqKey="Bulens S">S Bulens</name>
</author>
<author><name sortKey="Polyak, C" uniqKey="Polyak C">C Polyak</name>
</author>
<author><name sortKey="Vojdani, J" uniqKey="Vojdani J">J Vojdani</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Demczuk, Wh" uniqKey="Demczuk W">WH Demczuk</name>
</author>
<author><name sortKey="Finley, R" uniqKey="Finley R">R Finley</name>
</author>
<author><name sortKey="Nadon, C" uniqKey="Nadon C">C Nadon</name>
</author>
<author><name sortKey="Spencer, A" uniqKey="Spencer A">A Spencer</name>
</author>
<author><name sortKey="Gilmour, M" uniqKey="Gilmour M">M Gilmour</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kariuki, S" uniqKey="Kariuki S">S Kariuki</name>
</author>
<author><name sortKey="Revathi, G" uniqKey="Revathi G">G Revathi</name>
</author>
<author><name sortKey="Kiiru, J" uniqKey="Kiiru J">J Kiiru</name>
</author>
<author><name sortKey="Mengo, Dm" uniqKey="Mengo D">DM Mengo</name>
</author>
<author><name sortKey="Mwituria, J" uniqKey="Mwituria J">J Mwituria</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Parry, Cm" uniqKey="Parry C">CM Parry</name>
</author>
<author><name sortKey="Ho, Va" uniqKey="Ho V">VA Ho</name>
</author>
<author><name sortKey="Phuong Le, T" uniqKey="Phuong Le T">T Phuong le</name>
</author>
<author><name sortKey="Bay, Pv" uniqKey="Bay P">PV Bay</name>
</author>
<author><name sortKey="Lanh, Mn" uniqKey="Lanh M">MN Lanh</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Meltzer, E" uniqKey="Meltzer E">E Meltzer</name>
</author>
<author><name sortKey="Schwartz, E" uniqKey="Schwartz E">E Schwartz</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Taylor, De" uniqKey="Taylor D">DE Taylor</name>
</author>
<author><name sortKey="Chumpitaz, Jc" uniqKey="Chumpitaz J">JC Chumpitaz</name>
</author>
<author><name sortKey="Goldstein, F" uniqKey="Goldstein F">F Goldstein</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Fica, A" uniqKey="Fica A">A Fica</name>
</author>
<author><name sortKey="Fernandez Beros, Me" uniqKey="Fernandez Beros M">ME Fernandez-Beros</name>
</author>
<author><name sortKey="Aron Hott, L" uniqKey="Aron Hott L">L Aron-Hott</name>
</author>
<author><name sortKey="Rivas, A" uniqKey="Rivas A">A Rivas</name>
</author>
<author><name sortKey="D Ottone, K" uniqKey="D Ottone K">K D'Ottone</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Shanahan, Pm" uniqKey="Shanahan P">PM Shanahan</name>
</author>
<author><name sortKey="Jesudason, Mv" uniqKey="Jesudason M">MV Jesudason</name>
</author>
<author><name sortKey="Thomson, Cj" uniqKey="Thomson C">CJ Thomson</name>
</author>
<author><name sortKey="Amyes, Sg" uniqKey="Amyes S">SG Amyes</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Shanahan, Pm" uniqKey="Shanahan P">PM Shanahan</name>
</author>
<author><name sortKey="Karamat, Ka" uniqKey="Karamat K">KA Karamat</name>
</author>
<author><name sortKey="Thomson, Cj" uniqKey="Thomson C">CJ Thomson</name>
</author>
<author><name sortKey="Amyes, Sg" uniqKey="Amyes S">SG Amyes</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wain, J" uniqKey="Wain J">J Wain</name>
</author>
<author><name sortKey="Diem Nga, Lt" uniqKey="Diem Nga L">LT Diem Nga</name>
</author>
<author><name sortKey="Kidgell, C" uniqKey="Kidgell C">C Kidgell</name>
</author>
<author><name sortKey="James, K" uniqKey="James K">K James</name>
</author>
<author><name sortKey="Fortune, S" uniqKey="Fortune S">S Fortune</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kariuki, S" uniqKey="Kariuki S">S Kariuki</name>
</author>
<author><name sortKey="Revathi, G" uniqKey="Revathi G">G Revathi</name>
</author>
<author><name sortKey="Muyodi, J" uniqKey="Muyodi J">J Muyodi</name>
</author>
<author><name sortKey="Mwituria, J" uniqKey="Mwituria J">J Mwituria</name>
</author>
<author><name sortKey="Munyalo, A" uniqKey="Munyalo A">A Munyalo</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Mirza, S" uniqKey="Mirza S">S Mirza</name>
</author>
<author><name sortKey="Kariuki, S" uniqKey="Kariuki S">S Kariuki</name>
</author>
<author><name sortKey="Mamun, Kz" uniqKey="Mamun K">KZ Mamun</name>
</author>
<author><name sortKey="Beeching, Nj" uniqKey="Beeching N">NJ Beeching</name>
</author>
<author><name sortKey="Hart, Ca" uniqKey="Hart C">CA Hart</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Maher, D" uniqKey="Maher D">D Maher</name>
</author>
<author><name sortKey="Taylor, De" uniqKey="Taylor D">DE Taylor</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Holt, Ke" uniqKey="Holt K">KE Holt</name>
</author>
<author><name sortKey="Thomson, Nr" uniqKey="Thomson N">NR Thomson</name>
</author>
<author><name sortKey="Wain, J" uniqKey="Wain J">J Wain</name>
</author>
<author><name sortKey="Phan, Md" uniqKey="Phan M">MD Phan</name>
</author>
<author><name sortKey="Nair, S" uniqKey="Nair S">S Nair</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Leopold, Sr" uniqKey="Leopold S">SR Leopold</name>
</author>
<author><name sortKey="Magrini, V" uniqKey="Magrini V">V Magrini</name>
</author>
<author><name sortKey="Holt, Nj" uniqKey="Holt N">NJ Holt</name>
</author>
<author><name sortKey="Shaikh, N" uniqKey="Shaikh N">N Shaikh</name>
</author>
<author><name sortKey="Mardis, Er" uniqKey="Mardis E">ER Mardis</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Johnson, Tj" uniqKey="Johnson T">TJ Johnson</name>
</author>
<author><name sortKey="Wannemuehler, Ym" uniqKey="Wannemuehler Y">YM Wannemuehler</name>
</author>
<author><name sortKey="Johnson, Sj" uniqKey="Johnson S">SJ Johnson</name>
</author>
<author><name sortKey="Logue, Cm" uniqKey="Logue C">CM Logue</name>
</author>
<author><name sortKey="White, Dg" uniqKey="White D">DG White</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Johnson, Tj" uniqKey="Johnson T">TJ Johnson</name>
</author>
<author><name sortKey="Wannemuehler, Y" uniqKey="Wannemuehler Y">Y Wannemuehler</name>
</author>
<author><name sortKey="Johnson, Sj" uniqKey="Johnson S">SJ Johnson</name>
</author>
<author><name sortKey="Stell, Al" uniqKey="Stell A">AL Stell</name>
</author>
<author><name sortKey="Doetkott, C" uniqKey="Doetkott C">C Doetkott</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Phan, Md" uniqKey="Phan M">MD Phan</name>
</author>
<author><name sortKey="Kidgell, C" uniqKey="Kidgell C">C Kidgell</name>
</author>
<author><name sortKey="Nair, S" uniqKey="Nair S">S Nair</name>
</author>
<author><name sortKey="Holt, Ke" uniqKey="Holt K">KE Holt</name>
</author>
<author><name sortKey="Turner, Ak" uniqKey="Turner A">AK Turner</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Baker, S" uniqKey="Baker S">S Baker</name>
</author>
<author><name sortKey="Holt, K" uniqKey="Holt K">K Holt</name>
</author>
<author><name sortKey="Van De Vosse, E" uniqKey="Van De Vosse E">E van de Vosse</name>
</author>
<author><name sortKey="Roumagnac, P" uniqKey="Roumagnac P">P Roumagnac</name>
</author>
<author><name sortKey="Whitehead, S" uniqKey="Whitehead S">S Whitehead</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Holt, Ke" uniqKey="Holt K">KE Holt</name>
</author>
<author><name sortKey="Baker, S" uniqKey="Baker S">S Baker</name>
</author>
<author><name sortKey="Dongol, S" uniqKey="Dongol S">S Dongol</name>
</author>
<author><name sortKey="Basnyat, B" uniqKey="Basnyat B">B Basnyat</name>
</author>
<author><name sortKey="Adhikari, N" uniqKey="Adhikari N">N Adhikari</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Octavia, S" uniqKey="Octavia S">S Octavia</name>
</author>
<author><name sortKey="Lan, R" uniqKey="Lan R">R Lan</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Roumagnac, P" uniqKey="Roumagnac P">P Roumagnac</name>
</author>
<author><name sortKey="Weill, Fx" uniqKey="Weill F">FX Weill</name>
</author>
<author><name sortKey="Dolecek, C" uniqKey="Dolecek C">C Dolecek</name>
</author>
<author><name sortKey="Baker, S" uniqKey="Baker S">S Baker</name>
</author>
<author><name sortKey="Brisse, S" uniqKey="Brisse S">S Brisse</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Tacket, Co" uniqKey="Tacket C">CO Tacket</name>
</author>
<author><name sortKey="Sztein, Mb" uniqKey="Sztein M">MB Sztein</name>
</author>
<author><name sortKey="Losonsky, Ga" uniqKey="Losonsky G">GA Losonsky</name>
</author>
<author><name sortKey="Wasserman, Ss" uniqKey="Wasserman S">SS Wasserman</name>
</author>
<author><name sortKey="Nataro, Jp" uniqKey="Nataro J">JP Nataro</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kurtz, S" uniqKey="Kurtz S">S Kurtz</name>
</author>
<author><name sortKey="Phillippy, A" uniqKey="Phillippy A">A Phillippy</name>
</author>
<author><name sortKey="Delcher, Al" uniqKey="Delcher A">AL Delcher</name>
</author>
<author><name sortKey="Smoot, M" uniqKey="Smoot M">M Smoot</name>
</author>
<author><name sortKey="Shumway, M" uniqKey="Shumway M">M Shumway</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Li, H" uniqKey="Li H">H Li</name>
</author>
<author><name sortKey="Ruan, J" uniqKey="Ruan J">J Ruan</name>
</author>
<author><name sortKey="Durbin, R" uniqKey="Durbin R">R Durbin</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Holt, Ke" uniqKey="Holt K">KE Holt</name>
</author>
<author><name sortKey="Parkhill, J" uniqKey="Parkhill J">J Parkhill</name>
</author>
<author><name sortKey="Mazzoni, Cj" uniqKey="Mazzoni C">CJ Mazzoni</name>
</author>
<author><name sortKey="Roumagnac, P" uniqKey="Roumagnac P">P Roumagnac</name>
</author>
<author><name sortKey="Weill, Fx" uniqKey="Weill F">FX Weill</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Drummond, Aj" uniqKey="Drummond A">AJ Drummond</name>
</author>
<author><name sortKey="Rambaut, A" uniqKey="Rambaut A">A Rambaut</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Drummond, Aj" uniqKey="Drummond A">AJ Drummond</name>
</author>
<author><name sortKey="Rambaut, A" uniqKey="Rambaut A">A Rambaut</name>
</author>
<author><name sortKey="Shapiro, B" uniqKey="Shapiro B">B Shapiro</name>
</author>
<author><name sortKey="Pybus, Og" uniqKey="Pybus O">OG Pybus</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Teo, Yy" uniqKey="Teo Y">YY Teo</name>
</author>
<author><name sortKey="Inouye, M" uniqKey="Inouye M">M Inouye</name>
</author>
<author><name sortKey="Small, Ks" uniqKey="Small K">KS Small</name>
</author>
<author><name sortKey="Gwilliam, R" uniqKey="Gwilliam R">R Gwilliam</name>
</author>
<author><name sortKey="Deloukas, P" uniqKey="Deloukas P">P Deloukas</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Stamatakis, A" uniqKey="Stamatakis A">A Stamatakis</name>
</author>
<author><name sortKey="Ludwig, T" uniqKey="Ludwig T">T Ludwig</name>
</author>
<author><name sortKey="Meier, H" uniqKey="Meier H">H Meier</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Rozen, S" uniqKey="Rozen S">S Rozen</name>
</author>
<author><name sortKey="Skaletsky, H" uniqKey="Skaletsky H">H Skaletsky</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Bochner, Br" uniqKey="Bochner B">BR Bochner</name>
</author>
<author><name sortKey="Gadzinski, P" uniqKey="Gadzinski P">P Gadzinski</name>
</author>
<author><name sortKey="Panomitros, E" uniqKey="Panomitros E">E Panomitros</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Taylor, De" uniqKey="Taylor D">DE Taylor</name>
</author>
<author><name sortKey="Newnham, Pj" uniqKey="Newnham P">PJ Newnham</name>
</author>
<author><name sortKey="Sherburne, C" uniqKey="Sherburne C">C Sherburne</name>
</author>
<author><name sortKey="Lawley, Td" uniqKey="Lawley T">TD Lawley</name>
</author>
<author><name sortKey="Rooker, Mm" uniqKey="Rooker M">MM Rooker</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Drummond, Aj" uniqKey="Drummond A">AJ Drummond</name>
</author>
<author><name sortKey="Ho, Sy" uniqKey="Ho S">SY Ho</name>
</author>
<author><name sortKey="Phillips, Mj" uniqKey="Phillips M">MJ Phillips</name>
</author>
<author><name sortKey="Rambaut, A" uniqKey="Rambaut A">A Rambaut</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Parkhill, J" uniqKey="Parkhill J">J Parkhill</name>
</author>
<author><name sortKey="Dougan, G" uniqKey="Dougan G">G Dougan</name>
</author>
<author><name sortKey="James, Kd" uniqKey="James K">KD James</name>
</author>
<author><name sortKey="Thomson, Nr" uniqKey="Thomson N">NR Thomson</name>
</author>
<author><name sortKey="Pickard, D" uniqKey="Pickard D">D Pickard</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Goldstein, Fw" uniqKey="Goldstein F">FW Goldstein</name>
</author>
<author><name sortKey="Chumpitaz, Jc" uniqKey="Chumpitaz J">JC Chumpitaz</name>
</author>
<author><name sortKey="Guevara, Jm" uniqKey="Guevara J">JM Guevara</name>
</author>
<author><name sortKey="Papadopoulou, B" uniqKey="Papadopoulou B">B Papadopoulou</name>
</author>
<author><name sortKey="Acar, Jf" uniqKey="Acar J">JF Acar</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Edsall, G" uniqKey="Edsall G">G Edsall</name>
</author>
<author><name sortKey="Gaines, S" uniqKey="Gaines S">S Gaines</name>
</author>
<author><name sortKey="Landy, M" uniqKey="Landy M">M Landy</name>
</author>
<author><name sortKey="Tigertt, Wd" uniqKey="Tigertt W">WD Tigertt</name>
</author>
<author><name sortKey="Sprinz, H" uniqKey="Sprinz H">H Sprinz</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Khatri, Ns" uniqKey="Khatri N">NS Khatri</name>
</author>
<author><name sortKey="Maskey, P" uniqKey="Maskey P">P Maskey</name>
</author>
<author><name sortKey="Poudel, S" uniqKey="Poudel S">S Poudel</name>
</author>
<author><name sortKey="Jaiswal, Vk" uniqKey="Jaiswal V">VK Jaiswal</name>
</author>
<author><name sortKey="Karkey, A" uniqKey="Karkey A">A Karkey</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Levine, Mm" uniqKey="Levine M">MM Levine</name>
</author>
<author><name sortKey="Black, Re" uniqKey="Black R">RE Black</name>
</author>
<author><name sortKey="Lanata, C" uniqKey="Lanata C">C Lanata</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lanata, Cf" uniqKey="Lanata C">CF Lanata</name>
</author>
<author><name sortKey="Levine, Mm" uniqKey="Levine M">MM Levine</name>
</author>
<author><name sortKey="Ristori, C" uniqKey="Ristori C">C Ristori</name>
</author>
<author><name sortKey="Black, Re" uniqKey="Black R">RE Black</name>
</author>
<author><name sortKey="Jimenez, L" uniqKey="Jimenez L">L Jimenez</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ferreccio, C" uniqKey="Ferreccio C">C Ferreccio</name>
</author>
<author><name sortKey="Levine, M" uniqKey="Levine M">M Levine</name>
</author>
<author><name sortKey="Astroza, L" uniqKey="Astroza L">L Astroza</name>
</author>
<author><name sortKey="Berrios, G" uniqKey="Berrios G">G Berrios</name>
</author>
<author><name sortKey="Solari, V" uniqKey="Solari V">V Solari</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Culham, De" uniqKey="Culham D">DE Culham</name>
</author>
<author><name sortKey="Lu, A" uniqKey="Lu A">A Lu</name>
</author>
<author><name sortKey="Jishage, M" uniqKey="Jishage M">M Jishage</name>
</author>
<author><name sortKey="Krogfelt, Ka" uniqKey="Krogfelt K">KA Krogfelt</name>
</author>
<author><name sortKey="Ishihama, A" uniqKey="Ishihama A">A Ishihama</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ly, A" uniqKey="Ly A">A Ly</name>
</author>
<author><name sortKey="Henderson, J" uniqKey="Henderson J">J Henderson</name>
</author>
<author><name sortKey="Lu, A" uniqKey="Lu A">A Lu</name>
</author>
<author><name sortKey="Culham, De" uniqKey="Culham D">DE Culham</name>
</author>
<author><name sortKey="Wood, Jm" uniqKey="Wood J">JM Wood</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Weill, Fx" uniqKey="Weill F">FX Weill</name>
</author>
<author><name sortKey="Tran, Hh" uniqKey="Tran H">HH Tran</name>
</author>
<author><name sortKey="Roumagnac, P" uniqKey="Roumagnac P">P Roumagnac</name>
</author>
<author><name sortKey="Fabre, L" uniqKey="Fabre L">L Fabre</name>
</author>
<author><name sortKey="Minh, Nb" uniqKey="Minh N">NB Minh</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Le, Ta" uniqKey="Le T">TA Le</name>
</author>
<author><name sortKey="Fabre, L" uniqKey="Fabre L">L Fabre</name>
</author>
<author><name sortKey="Roumagnac, P" uniqKey="Roumagnac P">P Roumagnac</name>
</author>
<author><name sortKey="Grimont, Pa" uniqKey="Grimont P">PA Grimont</name>
</author>
<author><name sortKey="Scavizzi, Mr" uniqKey="Scavizzi M">MR Scavizzi</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Taylor, De" uniqKey="Taylor D">DE Taylor</name>
</author>
<author><name sortKey="Brose, Ec" uniqKey="Brose E">EC Brose</name>
</author>
<author><name sortKey="Kwan, S" uniqKey="Kwan S">S Kwan</name>
</author>
<author><name sortKey="Yan, W" uniqKey="Yan W">W Yan</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ogura, Y" uniqKey="Ogura Y">Y Ogura</name>
</author>
<author><name sortKey="Ooka, T" uniqKey="Ooka T">T Ooka</name>
</author>
<author><name sortKey="Iguchi, A" uniqKey="Iguchi A">A Iguchi</name>
</author>
<author><name sortKey="Toh, H" uniqKey="Toh H">H Toh</name>
</author>
<author><name sortKey="Asadulghani, M" uniqKey="Asadulghani M">M Asadulghani</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article"><pmc-dir>properties open_access</pmc-dir>
<front><journal-meta><journal-id journal-id-type="nlm-ta">PLoS Negl Trop Dis</journal-id>
<journal-id journal-id-type="iso-abbrev">PLoS Negl Trop Dis</journal-id>
<journal-id journal-id-type="publisher-id">plos</journal-id>
<journal-id journal-id-type="pmc">plosntds</journal-id>
<journal-title-group><journal-title>PLoS Neglected Tropical Diseases</journal-title>
</journal-title-group>
<issn pub-type="ppub">1935-2727</issn>
<issn pub-type="epub">1935-2735</issn>
<publisher><publisher-name>Public Library of Science</publisher-name>
<publisher-loc>San Francisco, USA</publisher-loc>
</publisher>
</journal-meta>
<article-meta><article-id pub-id-type="pmid">21811646</article-id>
<article-id pub-id-type="pmc">3139670</article-id>
<article-id pub-id-type="publisher-id">PNTD-D-11-00365</article-id>
<article-id pub-id-type="doi">10.1371/journal.pntd.0001245</article-id>
<article-categories><subj-group subj-group-type="heading"><subject>Research Article</subject>
</subj-group>
<subj-group subj-group-type="Discipline-v2"><subject>Biology</subject>
<subj-group><subject>Evolutionary Biology</subject>
<subj-group><subject>Population Genetics</subject>
</subj-group>
</subj-group>
</subj-group>
<subj-group subj-group-type="Discipline-v2"><subject>Medicine</subject>
<subj-group><subject>Gastroenterology and Hepatology</subject>
<subj-group><subject>Bacterial and Foodborne Illness</subject>
</subj-group>
</subj-group>
<subj-group><subject>Infectious Diseases</subject>
<subj-group><subject>Bacterial Diseases</subject>
</subj-group>
</subj-group>
</subj-group>
</article-categories>
<title-group><article-title>Emergence of a Globally Dominant IncHI1 Plasmid Type Associated with Multiple Drug Resistant Typhoid</article-title>
<alt-title alt-title-type="running-head">Emergence of a Globally Dominant MDR Typhoid Clone</alt-title>
</title-group>
<contrib-group><contrib contrib-type="author" equal-contrib="yes"><name><surname>Holt</surname>
<given-names>Kathryn E.</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup>
</xref>
<xref ref-type="corresp" rid="cor1"><sup>*</sup>
</xref>
</contrib>
<contrib contrib-type="author" equal-contrib="yes"><name><surname>Phan</surname>
<given-names>Minh Duy</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff3"><sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Baker</surname>
<given-names>Stephen</given-names>
</name>
<xref ref-type="aff" rid="aff4"><sup>4</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Duy</surname>
<given-names>Pham Thanh</given-names>
</name>
<xref ref-type="aff" rid="aff4"><sup>4</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Nga</surname>
<given-names>Tran Vu Thieu</given-names>
</name>
<xref ref-type="aff" rid="aff4"><sup>4</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Nair</surname>
<given-names>Satheesh</given-names>
</name>
<xref ref-type="aff" rid="aff5"><sup>5</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Turner</surname>
<given-names>A. Keith</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Walsh</surname>
<given-names>Ciara</given-names>
</name>
<xref ref-type="aff" rid="aff6"><sup>6</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Fanning</surname>
<given-names>Séamus</given-names>
</name>
<xref ref-type="aff" rid="aff7"><sup>7</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Farrell-Ward</surname>
<given-names>Sinéad</given-names>
</name>
<xref ref-type="aff" rid="aff7"><sup>7</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Dutta</surname>
<given-names>Shanta</given-names>
</name>
<xref ref-type="aff" rid="aff8"><sup>8</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Kariuki</surname>
<given-names>Sam</given-names>
</name>
<xref ref-type="aff" rid="aff9"><sup>9</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Weill</surname>
<given-names>François-Xavier</given-names>
</name>
<xref ref-type="aff" rid="aff10"><sup>10</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Parkhill</surname>
<given-names>Julian</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Dougan</surname>
<given-names>Gordon</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Wain</surname>
<given-names>John</given-names>
</name>
<xref ref-type="aff" rid="aff5"><sup>5</sup>
</xref>
</contrib>
</contrib-group>
<aff id="aff1"><label>1</label>
<addr-line>Wellcome Trust Sanger Institute, Hinxton, Cambridge, United Kingdom</addr-line>
</aff>
<aff id="aff2"><label>2</label>
<addr-line>Department of Microbiology and Immunology, University of Melbourne, Melbourne, Australia</addr-line>
</aff>
<aff id="aff3"><label>3</label>
<addr-line>School of Chemistry and Molecular Biosciences, Australian Infectious Diseases Research Centre, University of Queensland, Brisbane, Queensland, Australia</addr-line>
</aff>
<aff id="aff4"><label>4</label>
<addr-line>Oxford University Clinical Research Unit, Wellcome Trust Major Overseas Programme, The Hospital for Tropical Diseases, Ho Chi Minh City, Vietnam</addr-line>
</aff>
<aff id="aff5"><label>5</label>
<addr-line>Laboratory of Enteric Pathogens, Health Protection Agency, Colindale, United Kingdom</addr-line>
</aff>
<aff id="aff6"><label>6</label>
<addr-line>Food Safety Authority of Ireland, Dublin, Ireland</addr-line>
</aff>
<aff id="aff7"><label>7</label>
<addr-line>School of Public Health, Physiotherapy and Population Science, UCD Centre for Food Safety, Veterinary Sciences Centre, University College Dublin, Belfield, Dublin, Ireland</addr-line>
</aff>
<aff id="aff8"><label>8</label>
<addr-line>National Institute of Cholera and Enteric Diseases, Kolkata, India</addr-line>
</aff>
<aff id="aff9"><label>9</label>
<addr-line>Kenya Medical Research Institute, Nairobi, Kenya</addr-line>
</aff>
<aff id="aff10"><label>10</label>
<addr-line>Institut Pasteur, Unité des Bactéries Pathogènes Entériques, Paris, France</addr-line>
</aff>
<contrib-group><contrib contrib-type="editor"><name><surname>Ryan</surname>
<given-names>Edward T.</given-names>
</name>
<role>Editor</role>
<xref ref-type="aff" rid="edit1"></xref>
</contrib>
</contrib-group>
<aff id="edit1">Massachusetts General Hospital, United States of America</aff>
<author-notes><corresp id="cor1">* E-mail: <email>kholt@unimelb.edu.au</email>
</corresp>
<fn fn-type="con"><p>Conceived and designed the experiments: KEH MDP JP GD JW. Performed the experiments: MDP SB PTD TVTN SN AKT CW SF SFW SD SK FXW. Analyzed the data: KEH MDP SB. Contributed reagents/materials/analysis tools: CW SF SFW SD SK FXW. Wrote the paper: KEH MDP GD JW.</p>
</fn>
</author-notes>
<pub-date pub-type="collection"><month>7</month>
<year>2011</year>
</pub-date>
<pub-date pub-type="epub"><day>19</day>
<month>7</month>
<year>2011</year>
</pub-date>
<volume>5</volume>
<issue>7</issue>
<elocation-id>e1245</elocation-id>
<history><date date-type="received"><day>21</day>
<month>4</month>
<year>2011</year>
</date>
<date date-type="accepted"><day>3</day>
<month>6</month>
<year>2011</year>
</date>
</history>
<permissions><copyright-statement>Holt et al.</copyright-statement>
<copyright-year>2011</copyright-year>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/"><license-p>This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are properly credited.</license-p>
</license>
</permissions>
<abstract><p>Typhoid fever, caused by <italic>Salmonella enterica</italic>
serovar Typhi (<italic>S</italic>
. Typhi), remains a serious global health concern. Since their emergence in the mid-1970s multi-drug resistant (MDR) <italic>S</italic>
. Typhi now dominate drug sensitive equivalents in many regions. MDR in <italic>S</italic>
. Typhi is almost exclusively conferred by self-transmissible IncHI1 plasmids carrying a suite of antimicrobial resistance genes. We identified over 300 single nucleotide polymorphisms (SNPs) within conserved regions of the IncHI1 plasmid, and genotyped both plasmid and chromosomal SNPs in over 450 <italic>S</italic>
. Typhi dating back to 1958. Prior to 1995, a variety of IncHI1 plasmid types were detected in distinct <italic>S</italic>
. Typhi haplotypes. Highly similar plasmids were detected in co-circulating <italic>S</italic>
. Typhi haplotypes, indicative of plasmid transfer. In contrast, from 1995 onwards, 98% of MDR <italic>S</italic>
. Typhi were plasmid sequence type 6 (PST6) and <italic>S</italic>
. Typhi haplotype H58, indicating recent global spread of a dominant MDR clone. To investigate whether PST6 conferred a selective advantage compared to other IncHI1 plasmids, we used a phenotyping array to compare the impact of IncHI1 PST6 and PST1 plasmids in a common <italic>S</italic>
. Typhi host. The PST6 plasmid conferred the ability to grow in high salt medium (4.7% NaCl), which we demonstrate is due to the presence in PST6 of the Tn<italic>6062</italic>
transposon encoding BetU.</p>
</abstract>
<abstract abstract-type="summary"><title>Author Summary</title>
<p>Typhoid fever is caused by the bacterium <italic>Salmonella enterica</italic>
serovar Typhi (<italic>S</italic>
. Typhi). Treatment relies on antimicrobial drugs, however many <italic>S</italic>
. Typhi are multi-drug resistant (MDR), severely compromising treatment options. MDR typhoid is associated with multiple drug resistance genes, which can be transferred between <italic>S</italic>
. Typhi and other bacteria via self-transmissible plasmids. We used sequence analysis to identify single nucleotide polymorphisms (SNPs) within these plasmids, and used high-resolution SNP typing to trace the subtypes (termed haplotypes) of both the <italic>S</italic>
. Typhi bacteria and their MDR plasmids isolated from more than 450 typhoid patients since 1958. Among isolates collected before 1995, a variety of plasmid haplotypes and <italic>S</italic>
. Typhi haplotypes were detected, indicating that MDR typhoid was caused by a diverse range of <italic>S</italic>
. Typhi and MDR plasmids. In contrast, 98% of MDR <italic>S</italic>
. Typhi samples isolated from 1995 were of the same <italic>S</italic>
. Typhi haplotype and plasmid haplotype, indicating that the recent increase in rates of MDR typhoid is due to the global spread of a dominant <italic>S</italic>
. Typhi-plasmid combination. We demonstrate this particular plasmid type contains a transposon encoding two transporter genes, enabling its <italic>S</italic>
. Typhi host to grow in the presence of high salt concentrations.</p>
</abstract>
<counts><page-count count="13"></page-count>
</counts>
</article-meta>
</front>
<body><sec id="s1"><title>Introduction</title>
<p>Typhoid fever remains a serious public health problem in many developing countries, with highest incidence in parts of Asia (274 per 100,000 person-years) and Africa (50 per 100,000 person-years) <xref rid="pntd.0001245-Kothari1" ref-type="bibr">[1]</xref>
, <xref rid="pntd.0001245-Crump1" ref-type="bibr">[2]</xref>
. The causative agent is the bacterium <italic>Salmonella enterica</italic>
serovar Typhi (<italic>S</italic>
. Typhi). While vaccines against <italic>S</italic>
. Typhi exist, it is mainly restricted groups such as travellers <xref rid="pntd.0001245-World1" ref-type="bibr">[3]</xref>
, <xref rid="pntd.0001245-Whitaker1" ref-type="bibr">[4]</xref>
and individuals enrolled in large vaccine trials <xref rid="pntd.0001245-Ochiai1" ref-type="bibr">[5]</xref>
who are immunized, and antimicrobial treatment remains central to the control of typhoid fever <xref rid="pntd.0001245-World1" ref-type="bibr">[3]</xref>
. However antimicrobial resistant typhoid has been observed for over half a century and is now common in many areas. Chloramphenicol resistant <italic>S</italic>
. Typhi was first reported in 1950, shortly after the drug was introduced for treatment of typhoid <xref rid="pntd.0001245-Colquhoun1" ref-type="bibr">[6]</xref>
. By the early 1970s, <italic>S</italic>
. Typhi resistant to both chloramphenicol and ampicillin had been observed <xref rid="pntd.0001245-Olarte1" ref-type="bibr">[7]</xref>
and multidrug resistant (MDR) <italic>S</italic>
. Typhi (defined here as resistance to chloramphenicol, ampicillin and trimethoprim-sulfamethoxazole) emerged soon after <xref rid="pntd.0001245-Anderson1" ref-type="bibr">[8]</xref>
. The rate of MDR among <italic>S</italic>
. Typhi can fluctuate over time and geographical space, as can the precise combination of drug resistance genes and phenotypes <xref rid="pntd.0001245-Chau1" ref-type="bibr">[9]</xref>
, <xref rid="pntd.0001245-Ochiai2" ref-type="bibr">[10]</xref>
. However in many typhoid endemic areas, an increasing prevalence of MDR <italic>S</italic>
. Typhi was observed in the late 1990s <xref rid="pntd.0001245-Hermans1" ref-type="bibr">[11]</xref>
, <xref rid="pntd.0001245-Connerton1" ref-type="bibr">[12]</xref>
, <xref rid="pntd.0001245-Rowe1" ref-type="bibr">[13]</xref>
, and MDR typhoid now predominates in many areas <xref rid="pntd.0001245-Chau1" ref-type="bibr">[9]</xref>
, <xref rid="pntd.0001245-Nagshetty1" ref-type="bibr">[14]</xref>
including parts of Asia <xref rid="pntd.0001245-Kasper1" ref-type="bibr">[15]</xref>
, <xref rid="pntd.0001245-Holt1" ref-type="bibr">[16]</xref>
, Africa <xref rid="pntd.0001245-Mengo1" ref-type="bibr">[17]</xref>
and the Middle East <xref rid="pntd.0001245-AlSanouri1" ref-type="bibr">[18]</xref>
, <xref rid="pntd.0001245-Patel1" ref-type="bibr">[19]</xref>
, <xref rid="pntd.0001245-Lynch1" ref-type="bibr">[20]</xref>
, <xref rid="pntd.0001245-Demczuk1" ref-type="bibr">[21]</xref>
. MDR <italic>S</italic>
. Typhi with reduced susceptibility to fluoroquinolones are increasingly common <xref rid="pntd.0001245-Chau1" ref-type="bibr">[9]</xref>
, <xref rid="pntd.0001245-Kasper1" ref-type="bibr">[15]</xref>
, <xref rid="pntd.0001245-Holt1" ref-type="bibr">[16]</xref>
, <xref rid="pntd.0001245-Kariuki1" ref-type="bibr">[22]</xref>
, leaving macrolides or third generation cephalosporins as the only options for therapy <xref rid="pntd.0001245-Parry1" ref-type="bibr">[23]</xref>
, <xref rid="pntd.0001245-Meltzer1" ref-type="bibr">[24]</xref>
.</p>
<p>In <italic>S</italic>
. Typhi the MDR phenotype is almost exclusively conferred by self-transmissible plasmids of the HI1 incompatibility type (IncHI1) <xref rid="pntd.0001245-Anderson1" ref-type="bibr">[8]</xref>
, <xref rid="pntd.0001245-Hermans1" ref-type="bibr">[11]</xref>
, <xref rid="pntd.0001245-Taylor1" ref-type="bibr">[25]</xref>
, <xref rid="pntd.0001245-Fica1" ref-type="bibr">[26]</xref>
, <xref rid="pntd.0001245-Shanahan1" ref-type="bibr">[27]</xref>
, <xref rid="pntd.0001245-Shanahan2" ref-type="bibr">[28]</xref>
, <xref rid="pntd.0001245-Wain1" ref-type="bibr">[29]</xref>
, <xref rid="pntd.0001245-Kariuki2" ref-type="bibr">[30]</xref>
, although other plasmids are occasionally reported <xref rid="pntd.0001245-Mirza1" ref-type="bibr">[31]</xref>
. In the laboratory, IncHI1 plasmids can transfer between <italic>Enterobacteriaceae</italic>
and other Gram-negative bacteria <xref rid="pntd.0001245-Maher1" ref-type="bibr">[32]</xref>
and in nature, IncHI1 plasmids have been detected in pathogenic isolates of <italic>Salmonella enterica</italic>
and <italic>Escherichia coli</italic>
<xref rid="pntd.0001245-Holt2" ref-type="bibr">[33]</xref>
, <xref rid="pntd.0001245-Leopold1" ref-type="bibr">[34]</xref>
, <xref rid="pntd.0001245-Johnson1" ref-type="bibr">[35]</xref>
, <xref rid="pntd.0001245-Johnson2" ref-type="bibr">[36]</xref>
. However it remains unclear whether the increase in MDR typhoid is due to the exchange of resistance genes among co-circulating <italic>S</italic>
. Typhi or to the expansion of MDR <italic>S</italic>
. Typhi clones. Efforts have been made to investigate variability within IncHI1 plasmids <xref rid="pntd.0001245-Wain1" ref-type="bibr">[29]</xref>
, <xref rid="pntd.0001245-Holt2" ref-type="bibr">[33]</xref>
, <xref rid="pntd.0001245-Phan1" ref-type="bibr">[37]</xref>
or their <italic>S</italic>
. Typhi hosts <xref rid="pntd.0001245-Kariuki1" ref-type="bibr">[22]</xref>
, <xref rid="pntd.0001245-Baker1" ref-type="bibr">[38]</xref>
, <xref rid="pntd.0001245-Holt3" ref-type="bibr">[39]</xref>
, <xref rid="pntd.0001245-Octavia1" ref-type="bibr">[40]</xref>
, <xref rid="pntd.0001245-Roumagnac1" ref-type="bibr">[41]</xref>
but little progress has been made in linking the two together to answer fundamental questions of how MDR typhoid spreads. We recently developed a plasmid multi-locus sequence typing (PMLST) scheme for IncHI1 plasmids, which identified eight distinct IncHI1 plasmid sequence types (PSTs) among <italic>S</italic>
. Typhi and <italic>S</italic>
. Paratyphi A isolates, including five PSTs found in <italic>S</italic>
. Typhi <xref rid="pntd.0001245-Phan1" ref-type="bibr">[37]</xref>
. This pattern was not consistent with a single acquisition of an IncHI1 plasmid in <italic>S</italic>
. Typhi followed by divergence into multiple plasmid lineages, rather it indicated that divergent IncHI1 plasmids have entered the <italic>S</italic>
. Typhi population on multiple occasions <xref rid="pntd.0001245-Phan1" ref-type="bibr">[37]</xref>
. However the phylogenetic relatedness of the <italic>S</italic>
. Typhi hosts was not determined, thus we were unable to estimate how many times plasmids may have been independently acquired.</p>
<p>In this study, we aimed to investigate the relative contribution of plasmid transfer, as opposed to the expansion of plasmid-bearing <italic>S</italic>
. Typhi clones, to the emergence of MDR typhoid. We found evidence for plasmid transfer in older <italic>S</italic>
. Typhi. However the vast majority of recent MDR typhoid was attributable to a single host-plasmid combination (<italic>S</italic>
. Typhi H58-IncHI1 plasmid ST6). We performed further experiments to investigate possible mechanisms for the success of this host-plasmid combination, and identified a transposon in PST6 that confers tolerance to high osmolarity.</p>
</sec>
<sec sec-type="materials|methods" id="s2"><title>Materials and Methods</title>
<sec id="s2a"><title>Bacterial isolates and DNA extraction</title>
<p>The bacterial isolates analyzed by SNP assay are summarized in <xref ref-type="table" rid="pntd-0001245-t001">Table 1</xref>
and listed in full in <xref ref-type="supplementary-material" rid="pntd.0001245.s001">Table S1</xref>
. DNA was extracted using Wizard Genomic DNA purification kits (Promega) according to manufacturer's instructions. Details of the isolates used for competition experiments are also listed in <xref ref-type="supplementary-material" rid="pntd.0001245.s001">Table S1</xref>
.</p>
<table-wrap id="pntd-0001245-t001" position="float"><object-id pub-id-type="doi">10.1371/journal.pntd.0001245.t001</object-id>
<label>Table 1</label>
<caption><title>Summary of 454 <italic>S</italic>
. Typhi isolates analyzed in this study.</title>
</caption>
<alternatives><graphic id="pntd-0001245-t001-1" xlink:href="pntd.0001245.t001"></graphic>
<table frame="hsides" rules="groups"><colgroup span="1"><col align="left" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead><tr><td align="left" rowspan="1" colspan="1">Region</td>
<td align="left" rowspan="1" colspan="1">No. countries</td>
<td align="left" rowspan="1" colspan="1">pre-1970s</td>
<td align="left" rowspan="1" colspan="1">1970s–1980s</td>
<td align="left" rowspan="1" colspan="1">1990s</td>
<td align="left" rowspan="1" colspan="1">2000–2007</td>
<td align="left" rowspan="1" colspan="1">Total isolates</td>
</tr>
</thead>
<tbody><tr><td align="left" rowspan="1" colspan="1">South & Central America</td>
<td align="left" rowspan="1" colspan="1">4</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">6</td>
<td align="left" rowspan="1" colspan="1">3</td>
<td align="left" rowspan="1" colspan="1">2</td>
<td align="left" rowspan="1" colspan="1">11</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Central, Southern, East Africa</td>
<td align="left" rowspan="1" colspan="1">7</td>
<td align="left" rowspan="1" colspan="1">10</td>
<td align="left" rowspan="1" colspan="1">3</td>
<td align="left" rowspan="1" colspan="1">3</td>
<td align="left" rowspan="1" colspan="1">26</td>
<td align="left" rowspan="1" colspan="1">42</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">North Africa</td>
<td align="left" rowspan="1" colspan="1">3</td>
<td align="left" rowspan="1" colspan="1">11</td>
<td align="left" rowspan="1" colspan="1">1</td>
<td align="left" rowspan="1" colspan="1">8</td>
<td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">25</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">West Africa</td>
<td align="left" rowspan="1" colspan="1">11</td>
<td align="left" rowspan="1" colspan="1">28</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">6</td>
<td align="left" rowspan="1" colspan="1">12</td>
<td align="left" rowspan="1" colspan="1">46</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">East Asia</td>
<td align="left" rowspan="1" colspan="1">8</td>
<td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">8</td>
<td align="left" rowspan="1" colspan="1">22</td>
<td align="left" rowspan="1" colspan="1">187</td>
<td align="left" rowspan="1" colspan="1">222</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Indian Subcontinent</td>
<td align="left" rowspan="1" colspan="1">3</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">3</td>
<td align="left" rowspan="1" colspan="1">1</td>
<td align="left" rowspan="1" colspan="1">66</td>
<td align="left" rowspan="1" colspan="1">70</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Middle East</td>
<td align="left" rowspan="1" colspan="1">3</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">31</td>
<td align="left" rowspan="1" colspan="1">31</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Europe</td>
<td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">1</td>
<td align="left" rowspan="1" colspan="1">1</td>
<td align="left" rowspan="1" colspan="1">2</td>
<td align="left" rowspan="1" colspan="1">2</td>
<td align="left" rowspan="1" colspan="1">6</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Unknown</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">1</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">1</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><italic>Total</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>44</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>56</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>22</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>45</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>331</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>454</italic>
</td>
</tr>
</tbody>
</table>
</alternatives>
</table-wrap>
<p>BRD948 is an attenuated Ty2-derived strain (also known as CVD908-<italic>htrA</italic>
), which has deletion mutations in <italic>aroC</italic>
(t0480), <italic>aroD</italic>
(t1231), and <italic>htrA</italic>
(t0210) <xref rid="pntd.0001245-Tacket1" ref-type="bibr">[42]</xref>
. The growth of BRD948 on LB agar or in LB broth was enabled by supplementation with aromatic amino acid mix (aro mix) to achieve the final concentration of 50 µM L-phenylalanine, 50 µM L-tryptophan, 1 µM para-aminobenzoic acid and 1 µM 2,3-dihydroxybenzoic acid.</p>
</sec>
<sec id="s2b"><title>Identification and phylogenetic analysis of IncHI1 SNPs</title>
<p>Plasmid sequences were downloaded from the European Nucleotide Archive (plasmid details and accessions in <xref ref-type="table" rid="pntd-0001245-t002">Table 2</xref>
). SNPs between finished plasmid sequences were identified using the <italic>nucmer</italic>
and <italic>show-snps</italic>
algorithms within the MUMmer 3.1 package <xref rid="pntd.0001245-Kurtz1" ref-type="bibr">[43]</xref>
, via pairwise comparisons with pAKU_1. To identify SNPs in <italic>S</italic>
. Typhi PST6 IncHI1 plasmids, 36 bp single-ended Illumina/Solexa sequencing reads from <italic>S</italic>
. Typhi isolates E03-9804, ISP-03-07467 and ISP-04-06979 were aligned to the pAKU_1 sequence using Maq <xref rid="pntd.0001245-Li1" ref-type="bibr">[44]</xref>
and quality filters as described previously <xref rid="pntd.0001245-Holt4" ref-type="bibr">[45]</xref>
. SNPs called in repetitive regions or inserted sequences were excluded from phylogenetic analysis, so that phylogenetic trees were based only on the conserved IncHI1 core regions. This resulted in a total of 347 SNPs, which were analyzed using BEAST <xref rid="pntd.0001245-Drummond1" ref-type="bibr">[46]</xref>
to simultaneously infer a phylogenetic tree and divergence dates (using the year of isolation of each plasmid as listed in <xref ref-type="table" rid="pntd-0001245-t001">Table 1</xref>
, resulting tree in <xref ref-type="fig" rid="pntd-0001245-g001">Figure 1</xref>
). Parameters used were as follows: generalised time reversible model with a Gamma model of site heterogeneity (4 gamma categories); a relaxed molecular clock with uncorrelated exponential rates <xref rid="pntd.0001245-Drummond1" ref-type="bibr">[46]</xref>
, a coalescent tree prior estimated using a Bayesian skyline model with 10 groups <xref rid="pntd.0001245-Drummond2" ref-type="bibr">[47]</xref>
, default priors and 20 million iterations.</p>
<fig id="pntd-0001245-g001" position="float"><object-id pub-id-type="doi">10.1371/journal.pntd.0001245.g001</object-id>
<label>Figure 1</label>
<caption><title>Phylogenetic tree for IncHI1 plasmid sequences.</title>
<p>Phylogenetic tree based on 347 SNPs identified among 8 publicly available IncHI1 plasmid sequences (<xref ref-type="table" rid="pntd-0001245-t002">Table 2</xref>
), constructed using BEAST (with 20 million iterations, 4 replicate runs, exponential clock model). Terminal nodes are labelled with the organism of origin (STy = <italic>Salmonella enterica</italic>
serovar Typhi, SCh = <italic>Salmonella enterica</italic>
serovar Choleraesuis, STm = <italic>Salmonella enterica</italic>
serovar Typhimurium, SPa = <italic>Salmonella enterica</italic>
serovar Paratyphi A, Ec = <italic>E. coli</italic>
O111:H-) and date of isolation. Isolation dates were input into the BEAST model in order to estimate divergence dates for internal nodes (open circles, labelled with divergence date estimates; brackets indicate 95% highest posterior density interval). Insertion sites (grey) are based on sequence data and verified (except for pO111_1 and pMAK1) by PCR. Precise insertion sites and PCR primers for verification are given in <xref ref-type="table" rid="pntd-0001245-t003">Tables 3</xref>
& <xref ref-type="table" rid="pntd-0001245-t004">4</xref>
. Four major plasmid groups, PST1, PST5, PST6, PST7, are coloured as labelled.</p>
</caption>
<graphic xlink:href="pntd.0001245.g001"></graphic>
</fig>
<table-wrap id="pntd-0001245-t002" position="float"><object-id pub-id-type="doi">10.1371/journal.pntd.0001245.t002</object-id>
<label>Table 2</label>
<caption><title>IncHI1 plasmid sequences analyzed in this study.</title>
</caption>
<alternatives><graphic id="pntd-0001245-t002-2" xlink:href="pntd.0001245.t002"></graphic>
<table frame="hsides" rules="groups"><colgroup span="1"><col align="left" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead><tr><td align="left" rowspan="1" colspan="1">Plasmid</td>
<td align="left" rowspan="1" colspan="1">Host</td>
<td align="left" rowspan="1" colspan="1">Year of isolation</td>
<td align="left" rowspan="1" colspan="1">Plasmid type</td>
<td align="left" rowspan="1" colspan="1">Accession</td>
<td align="left" rowspan="1" colspan="1">Citation</td>
</tr>
</thead>
<tbody><tr><td align="left" rowspan="1" colspan="1">pHCM1</td>
<td align="left" rowspan="1" colspan="1"><italic>S</italic>
. Typhi strain CT18</td>
<td align="left" rowspan="1" colspan="1">1993</td>
<td align="left" rowspan="1" colspan="1">PST1</td>
<td align="left" rowspan="1" colspan="1">AL513383</td>
<td align="left" rowspan="1" colspan="1"><xref rid="pntd.0001245-Parkhill1" ref-type="bibr">[54]</xref>
</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">pAKU_1</td>
<td align="left" rowspan="1" colspan="1"><italic>S</italic>
. Paratyphi A strain AKU_12601</td>
<td align="left" rowspan="1" colspan="1">2003</td>
<td align="left" rowspan="1" colspan="1">PST7</td>
<td align="left" rowspan="1" colspan="1">AM412236</td>
<td align="left" rowspan="1" colspan="1"><xref rid="pntd.0001245-Holt2" ref-type="bibr">[33]</xref>
</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">R27</td>
<td align="left" rowspan="1" colspan="1"><italic>S</italic>
. Typhimurium</td>
<td align="left" rowspan="1" colspan="1">1961</td>
<td align="left" rowspan="1" colspan="1">PST5</td>
<td align="left" rowspan="1" colspan="1">AF250878</td>
<td align="left" rowspan="1" colspan="1"><xref rid="pntd.0001245-Taylor3" ref-type="bibr">[65]</xref>
</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">pMAK1</td>
<td align="left" rowspan="1" colspan="1"><italic>S</italic>
. Choleraesuis strain L-2454</td>
<td align="left" rowspan="1" colspan="1">2002</td>
<td align="left" rowspan="1" colspan="1">PST1</td>
<td align="left" rowspan="1" colspan="1">AB366440</td>
<td align="left" rowspan="1" colspan="1">-</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">pO111_1</td>
<td align="left" rowspan="1" colspan="1"><italic>E. coli</italic>
O111:H- strain 11128</td>
<td align="left" rowspan="1" colspan="1">2001</td>
<td align="left" rowspan="1" colspan="1">PST1</td>
<td align="left" rowspan="1" colspan="1">AP010961</td>
<td align="left" rowspan="1" colspan="1"><xref rid="pntd.0001245-Ogura1" ref-type="bibr">[66]</xref>
</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">p9804_1</td>
<td align="left" rowspan="1" colspan="1"><italic>S</italic>
. Typhi strain E03-9804</td>
<td align="left" rowspan="1" colspan="1">2004</td>
<td align="left" rowspan="1" colspan="1">PST6</td>
<td align="left" rowspan="1" colspan="1">ERA000001</td>
<td align="left" rowspan="1" colspan="1"><xref rid="pntd.0001245-Holt4" ref-type="bibr">[45]</xref>
</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">p7467_1</td>
<td align="left" rowspan="1" colspan="1"><italic>S</italic>
. Typhi strain ISP-03-07467</td>
<td align="left" rowspan="1" colspan="1">2003</td>
<td align="left" rowspan="1" colspan="1">PST6</td>
<td align="left" rowspan="1" colspan="1">ERA000001</td>
<td align="left" rowspan="1" colspan="1"><xref rid="pntd.0001245-Holt4" ref-type="bibr">[45]</xref>
</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">p6979_1</td>
<td align="left" rowspan="1" colspan="1"><italic>S</italic>
. Typhi strain ISP-04-06979</td>
<td align="left" rowspan="1" colspan="1">2004</td>
<td align="left" rowspan="1" colspan="1">PST6</td>
<td align="left" rowspan="1" colspan="1">ERA000001</td>
<td align="left" rowspan="1" colspan="1"><xref rid="pntd.0001245-Holt4" ref-type="bibr">[45]</xref>
</td>
</tr>
</tbody>
</table>
</alternatives>
</table-wrap>
</sec>
<sec id="s2c"><title>SNP typing analysis</title>
<p>The chromosomal haplotype of <italic>S</italic>
. Typhi isolates was determined based on the SNPs present at 1,485 chromosomal loci identified previously from genome-wide surveys <xref rid="pntd.0001245-Roumagnac1" ref-type="bibr">[41]</xref>
, <xref rid="pntd.0001245-Holt4" ref-type="bibr">[45]</xref>
and listed in <xref rid="pntd.0001245-Kariuki1" ref-type="bibr">[22]</xref>
, <xref rid="pntd.0001245-Holt3" ref-type="bibr">[39]</xref>
. IncHI1 plasmid haplotypes were determined using 231 SNPs located in the conserved IncHI1 backbone sequence, listed in <xref ref-type="supplementary-material" rid="pntd.0001245.s002">Table S2</xref>
(note these do not include SNPs specific to pMAK1 or pO111_1 which were not available at the time of assay design, nor any SNPs falling within 10 bp of each other as these cannot be accurately targeted via GoldenGate assay; however additional SNPs identified via plasmid MLST <xref rid="pntd.0001245-Phan1" ref-type="bibr">[37]</xref>
were included, see <xref ref-type="supplementary-material" rid="pntd.0001245.s002">Table S2</xref>
). Resistance gene sequences were interrogated using additional oligonucleotide probes, listed in <xref rid="pntd.0001245-Holt1" ref-type="bibr">[16]</xref>
. All loci were interrogated using a GoldenGate (Illumina) custom assay according to the manufacturer's standard protocols, as described previously <xref rid="pntd.0001245-Holt1" ref-type="bibr">[16]</xref>
, <xref rid="pntd.0001245-Kariuki1" ref-type="bibr">[22]</xref>
, <xref rid="pntd.0001245-Holt3" ref-type="bibr">[39]</xref>
. SNP calls were generated from raw fluorescence signal data by clustering with a modified version of Illuminus <xref rid="pntd.0001245-Teo1" ref-type="bibr">[48]</xref>
as described previously <xref rid="pntd.0001245-Kariuki1" ref-type="bibr">[22]</xref>
. The percentage of IncHI1 SNP loci yielding positive signals in the GoldenGate assay clearly divided isolates into two groups, indicating presence of an IncHI plasmid (signals for >90% of IncHI1 loci) or absence of such a plasmid (signals for <10% of IncHI1 loci), see <xref ref-type="fig" rid="pntd-0001245-g002">Figure 2</xref>
. SNP alleles were concatenated to generate two multiple alignments, one for chromosomal SNPs and one for IncHI1 plasmid SNPs. Maximum likelihood phylogenetic trees (<xref ref-type="fig" rid="pntd-0001245-g003">Figure 3</xref>
) were fit to each alignment using RAxML <xref rid="pntd.0001245-Stamatakis1" ref-type="bibr">[49]</xref>
with a GTR+Γ model and 1,000 bootstraps.</p>
<fig id="pntd-0001245-g002" position="float"><object-id pub-id-type="doi">10.1371/journal.pntd.0001245.g002</object-id>
<label>Figure 2</label>
<caption><title>Distribution of IncHI1 loci among <italic>S</italic>
. Typhi isolates.</title>
<p>X-axis indicates the number of IncHI1 plasmid loci (out of 231 targets) generating a fluorescent signal in the Illumina GoldenGate SNP assay. Isolates clearly fall into two groups: either >90% of IncHI1 target loci were detected, taken to imply presence of an IncHI1 plasmid (red), or <10% of IncHI1 target loci were detected, taken to imply absence of any IncHI1 plasmid (blue).</p>
</caption>
<graphic xlink:href="pntd.0001245.g002"></graphic>
</fig>
</sec>
<sec id="s2d"><title>PCR</title>
<p>PCR primers were designed using Primer3 <xref rid="pntd.0001245-Rozen1" ref-type="bibr">[50]</xref>
according to the following criteria: melting temperature 56°C, no hairpins or dimers affecting 3′ ends, no cross-dimers between forward and reverse primers. Primer sequences are given in <xref ref-type="table" rid="pntd-0001245-t003">Table 3</xref>
. PCRs were performed on a TETRA DNA Engine Peltier Thermal Cycler (MJ Research) with a reaction consisting of 1.2 µl of 10X Mango PCR buffer, 1.5 mM MgCl2, 25 µM of each dNTP, 1.25 U Mango <italic>Taq</italic>
(Bioline), 0.3 µM of each primer, 1.0 µl DNA template (approx. 100 ng) and nuclease free water in a total reaction volume of 12 µl. Cycling conditions were as follows: 5 min at 94°C, 30 cycles of 15 s at 94°C, 15 s at 58°C, and 60 s at 72°C; final extension of 5 min at 72°C.</p>
<table-wrap id="pntd-0001245-t003" position="float"><object-id pub-id-type="doi">10.1371/journal.pntd.0001245.t003</object-id>
<label>Table 3</label>
<caption><title>PCR primers for detection of resistance gene insertion sites.</title>
</caption>
<alternatives><graphic id="pntd-0001245-t003-3" xlink:href="pntd.0001245.t003"></graphic>
<table frame="hsides" rules="groups"><colgroup span="1"><col align="left" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead><tr><td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">Forward primer, Reverse primer</td>
<td align="left" rowspan="1" colspan="1">Amplicon length in pAKU_1 (bp)</td>
<td align="left" rowspan="1" colspan="1">Amplicon length in pHCM1 (bp)</td>
</tr>
</thead>
<tbody><tr><td align="left" rowspan="1" colspan="1"><bold>G</bold>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">GATGGAGAAGAGGAGCAACG</named-content>
, <named-content content-type="gene">TTCGTTCCTGGTCGATTTTC</named-content>
</td>
<td align="left" rowspan="1" colspan="1">989</td>
<td align="left" rowspan="1" colspan="1">989</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold>H</bold>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">GTGCTGTGGAACACGGTCTA</named-content>
, <named-content content-type="gene">TCATCAACGCTTCCTGAATG</named-content>
</td>
<td align="left" rowspan="1" colspan="1">271</td>
<td align="left" rowspan="1" colspan="1">1598</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold>I</bold>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">ACGAAAGGGGAATGTTTCCT</named-content>
, <named-content content-type="gene">CGAGTGGGAATCCATGGTAG</named-content>
</td>
<td align="left" rowspan="1" colspan="1">163</td>
<td align="left" rowspan="1" colspan="1">1490</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold>J</bold>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">CAAAATGTTCTTTACGATGCC</named-content>
, <named-content content-type="gene">CCAGACAGGAAAACGCTCA</named-content>
</td>
<td align="left" rowspan="1" colspan="1">2219</td>
<td align="left" rowspan="1" colspan="1">none</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold>K</bold>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">CTGTGCCGAGCTAATCAACA</named-content>
, <named-content content-type="gene">ACGAAAGGGGAATGTTTCCT</named-content>
</td>
<td align="left" rowspan="1" colspan="1">1314</td>
<td align="left" rowspan="1" colspan="1">none</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold>L</bold>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">TTTTAAATGGCGGAAAATCG</named-content>
, <named-content content-type="gene">GCCAGTCTTGCCAACGTTAT</named-content>
</td>
<td align="left" rowspan="1" colspan="1">none</td>
<td align="left" rowspan="1" colspan="1">1872</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold>M</bold>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">GGGCGAAGAAGTTGTCCATA</named-content>
, <named-content content-type="gene">ATTCGAGCAAAACCATGGAA</named-content>
</td>
<td align="left" rowspan="1" colspan="1">none</td>
<td align="left" rowspan="1" colspan="1">2195</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold>N</bold>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">CGGGATGAAAAATGATGCTT</named-content>
, <named-content content-type="gene">GGTCGGTGCCTTTATTGTTG</named-content>
</td>
<td align="left" rowspan="1" colspan="1">none</td>
<td align="left" rowspan="1" colspan="1">2180</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold>O</bold>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">GCGTACAAAAGGCAGGTTTG</named-content>
, <named-content content-type="gene">GCTTGATGATGTGGCGAATA</named-content>
</td>
<td align="left" rowspan="1" colspan="1">1823</td>
<td align="left" rowspan="1" colspan="1">none</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold>P</bold>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">TGGTCGGTGCCTTTATTGTT</named-content>
, <named-content content-type="gene">GGGCGTCAGAGACTTTGTTC</named-content>
</td>
<td align="left" rowspan="1" colspan="1">1899</td>
<td align="left" rowspan="1" colspan="1">none</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold>Q</bold>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">TTCGCCCGATATAGTGAAGG</named-content>
, <named-content content-type="gene">CTAACGCCGAAGAGAACTGG</named-content>
</td>
<td align="left" rowspan="1" colspan="1">1923</td>
<td align="left" rowspan="1" colspan="1">none</td>
</tr>
</tbody>
</table>
</alternatives>
</table-wrap>
</sec>
<sec id="s2e"><title>Plasmid transfer</title>
<p>The transfer of pHCM1 and pSTY7 from respective <italic>E. coli</italic>
transconjugants to the attenuated <italic>S.</italic>
Typhi BRD948 was performed by cross-streaking onto LB agar supplemented with aro mix and incubating at 37°C overnight. The growth was harvested, resuspended in 2 ml of dH<sub>2</sub>
0, plated on MacConkey agar containing streptomycin (1 µg/ml or 5 µg/ml) and chloramphenicol (5 µg/ml or 20 µg/ml) and incubated overnight at 37°C. BRD948 transconjugants were confirmed by antimicrobial susceptibility patterns (disk diffusion) and colony PCR specific for BRD948 background (primers 5939-5′-CGTTCACCTGGCTGGAGTTTG-3′ and5940-5′-CATGCCAGCAGCGCAATCGCG-3′) and pHCM1 or pSTY7 plasmids (Insert1056L- <named-content content-type="gene">5′-TAGGGTTTGTGCGGCTTC-3′</named-content>
and Insert1056R-5′-CCTTCTTGTCGCCTTTGC-3′).</p>
</sec>
<sec id="s2f"><title>Competition assays in common host background</title>
<p>The competition between BRD948 (pHCM1) and BRD948 (pSTY7) was started with equal inoculums of roughly 5×10<sup>3</sup>
cfu each in 10 mL of LB broth supplemented with aro mix and chloramphenicol (5 µg/mL). The culture was incubated for 16 hours at 37°C with shaking. Approximately 10<sup>4</sup>
cfu of this culture were then used to inoculate the next passage. The cultures were passaged for a total of 4 days. Samples were collected at time point 0 (at the time of initial inoculation) and after 1, 2, 3 and 4 days of passage, diluted and spread on LB agar supplemented with aro mix. Sixty-four colonies from each sample were randomly picked and tested by PCR to identify their plasmid type (see below). The entire competition assay was performed in triplicate, i.e. beginning with three initial cultures of equal inoculums of the two isolates. The colony PCR was perform using standard condition (see PCR section above) with three primers (DF <named-content content-type="gene">5′-CGATTTGTGAAGTTGGGTCA-3′</named-content>
, DR2 <named-content content-type="gene">5′- CAACCTGGGCAGGTGTAAGT-3′</named-content>
and DR3 <named-content content-type="gene">5′- TTCGTTACGTGTTCATTCCA-3′</named-content>
). Expected sizes of PCR products were 511 bp for BRD948 (pHCM1) and 285 bp for BRD948 (pSTY7).</p>
</sec>
<sec id="s2g"><title>Competition assays using wildtype isolates</title>
<p>Four individual competitive growth assays were performed using wildtype host-plasmid combinations genotyped using the GoldenGate assay (isolates listed in <xref ref-type="supplementary-material" rid="pntd.0001245.s001">Table S1</xref>
); H58-C vs. H1, H58-E1 vs. H1, H58-C-ST6 vs. H1-ST1 and H58-E1-ST6 vs. H1-ST1. Bacterial isolates were recovered from frozen stocks onto Luria-Bertani (LB) media, supplemented with 20 mg/ml of chloramphenicol for isolates with MDR plasmids. Individual colonies were picked and used to inoculate 10 ml of LB broth, which were incubated overnight at 37°C with agitation. Bacterial cells were enumerated the following day by serial dilution and plating. Equivalent quantities of the two competing <italic>S</italic>
. Typhi isolates were inoculated into 10 ml of LB broth and were incubated as before (Day 0). The competition assays were conducted by growing the mixed bacteria to stationary phase and then passaging them into 10 ml of LB broth in a 1∶1000 dilution in triplicate over four days. One ml of media containing bacteria from each of the triplicates was stored at −80°C at each time point. DNA was extracted from the frozen samples by boiling for 10 minutes, samples were pelleted, the supernatant was removed and used as template in all of the subsequent competitive real-time PCR reactions (below), which were performed on each template in duplicate.</p>
</sec>
<sec id="s2h"><title>Real-time PCR for quantitation of wildtype isolates in competition assays</title>
<p>We performed two individual competitive real-time PCRs (Taqman system) with LNA probes to calculate the proportions of <italic>S.</italic>
Typhi H1 vs. <italic>S.</italic>
Typhi H58 and <italic>S.</italic>
Typhi H58-C vs. <italic>S.</italic>
Typhi H58-E1 in aliquots of DNA extracted from broth following competitive growth. These assays were performed to accurately calculate the relative proportion of the isolates in all competitive assays, including those that could not be calculated by plating alone. The haplotype specific primers and probes were designed using Primer Express Software (Applied Biosystems) and manufactured by Sigma-Proligo (Singapore). Primer and probe sequences were as follows (capital letters indicate the position of LNA and the letters in square brackets indicate the SNP position); H58 vs H1 (99 bp amplicon): F(71–83)-CCGAACGCGACGG, R(169-157)-TGCGGCACACGGC and probe 5′-FAM-ccggtAat[G]gtAatGaagc-BHQ1 (<italic>S.</italic>
Typhi H1) and 5′-Hex-ccggtAat[A]gtAatGaagc (<italic>S.</italic>
Typhi H58); H58-C vs H58-E1 (89 bp amplicon): F(60–75)-ACCCTGCACCGTGACC, R-(148–135)-GCATGATGCCGCCC and probe 5′-FAM-ttcCag[G]ccAtgAcgc –BHQ1 (<italic>S.</italic>
Typhi H58-C) and 5′-HEX-ttcCag[A]ccAtgAcgc-BHQ1 (<italic>S.</italic>
Typhi H58-E1). PCR amplification were performed using a light cycler (Roche, USA), with hot start Taq polymerase (Qiagen, USA) under the following conditions, 95°C for 15 minutes and 45 cycles of 95°C for 30 seconds, 60°C for 30 seconds and 72°C for 30 seconds. As the primer locations were identical for the internal competitive PCR assay, the efficiency of the PCR was also considered to be identical. Therefore, proportions of isolates at the various time points throughout the assay were calculated by taking the mean of six <italic>Cp</italic>
values (each competition assay was performed in triplicate and the PCR was performed in duplicate). The Mean <italic>Cp</italic>
values for each competitive assay was converted into a proportion (isolate A) using the following calculation: Proportion isolate A = 1/(2<sup>−ΔCp</sup>
+1), where ΔCp = Cp (isolate B) – Cp (isolate A).</p>
</sec>
<sec id="s2i"><title>Phenotype microarrays</title>
<p>Phenotype microarrays of osmotic/ionic response (PM 9), pH response (PM 10) and bacterial chemical sensitivity (PM 11 to 20) were performed as described previously by Biolog Inc. (Hayward, California USA) <xref rid="pntd.0001245-Bochner1" ref-type="bibr">[51]</xref>
. BRD948 was used as a reference for comparison with BRD948 (pHCM1) or BRD948 (pSTY7) test isolates to identify the phenotypes affected by the presence of IncHI1 plasmid pHCM1 (PST1) or pSTY7 (PST6).</p>
<p>The three isolates were pre-grown on LB (Luria-Bertani) agar plates supplemented with 1X of an aromatic amino acid mix (a 50X aromatic amino acid mix consisted of 50 µM L-phenylalanine, 50 µM L-tryptophan, 1 µM para-aminobenzoic acid and 1 µM 2,3-dihydroxybenzoic acid). Sterile cotton swabs were used to pick colonies and suspend them in 10 ml inoculating media IF-0a (Biolog), the optical density of which was then adjusted to 0.035 absorbance units at 610 nm. A total of 750 µl of this cell suspension was diluted 200 fold into 150 ml inoculating media IF-10 (Biolog), containing 1X aromatic acid mix (1.2X Biolog media, 22 ml of sterile water and 3 ml of 50X aromatic amino acid mix). PM microtitre plates 9–20 were inoculated with 100 µl of the inoculating media cell suspension per well. Microtitre plates were then incubated at 37°C for 48 h in the Omnilog (Biolog Inc) and each well was monitored for colour change (kinetic respiration). Tests were performed in duplicate and the kinetic data was analyzed using the OmniLog PM software set (Biolog Inc). A lower threshold of 80 omnilog units (measured as area under the kinetic response curve) was set, and the phenotypes of each of the three isolates were compared.</p>
</sec>
<sec id="s2j"><title>Cloning and growth curves</title>
<p>The fragment of two CDSs within Tn<italic>6062</italic>
of pSTY7 (3405 bp) was amplified using two primers IS1056-03 (<named-content content-type="gene">5′-CAGGCACCGTTTTCTTATTAGAATCTTCGCCACT-3′</named-content>
) and IS1056-04 (<named-content content-type="gene">5′-TCATTGAACTTTGCTACCCTGA-3′</named-content>
). The pACYC184 fragment (2033 bp) containing its p15A <italic>ori</italic>
and chloramphenicol resistant gene (<italic>cmR</italic>
) was amplified using pACYC184-01 (<named-content content-type="gene">5′-AAAATTACGCCCCGCCCTGC-3′</named-content>
) and pACYC184-03 (<named-content content-type="gene">5′-TAATAAGAAAACGGTGCCTGACTGCGTTAGCA-3′</named-content>
). The two fragments were then fused together by overlapping primer extension PCR (pACYC184-03 and IS1056-03 were two overlapping primers) using pACYC-01 and IS1056-04 primers. All three PCRs above were performed using <italic>PfuUltra</italic>
II Fusion HS DNA Polymerase (Agilent, former Stratagene, UK) to achieved highly accurate amplification. The PCRs were set up following the manufacturer's manual with the specific annealing temperature of 58°C and extension time of 45 s for Tn<italic>6062</italic>
and pACYC184 fragments or 1.5 min for the fusion fragment. The fused PCR product was re-circularised by T4 ligase (New England BioLabs, UK) to form pACYC184Δ<italic>tet</italic>
::Tn<italic>6062</italic>
and electroporated into BRD948. The pACYC184 fragment was also re-circularised to form the empty vector pACYC184Δ<italic>tet</italic>
and electroporated into BRD948.</p>
<p>Overnight bacterial cultures of BRD948 (pHCM1), BRD948 (pSTY7), BRD948 (pACYCΔ<italic>tet</italic>
) and BRD948 (pACYCΔ<italic>tet</italic>
::Tn<italic>6062</italic>
) were diluted by distilled water to the cell suspension of 0.1 OD600 before 1 µl of the cell suspension was inoculated into 200 µl of 0.8 M NaCl LB broth (supplemented with aro mix) in a well of a 96-well plate. Each isolate was inoculated into six wells (i.e. six biological replicates). The bacteria were grown at 37°C with shaking at 300 rpm and OD<sub>600</sub>
was measured automatically every 15 minutes for 24 hours in the Optima plate reader (BMG Labtech, Germany). Absorbance data were collected and saved in Excel format for graphing.</p>
</sec>
</sec>
<sec id="s3"><title>Results</title>
<sec id="s3a"><title>Evolution of MDR IncHI1 plasmids</title>
<p>We compared the DNA sequences of eight ∼200 kbp IncHI1 plasmids isolated from enteric pathogens (<xref ref-type="table" rid="pntd-0001245-t002">Table 2</xref>
) and identified a conserved IncHI1 core region (>99% identical at the nucleotide level) that included the <italic>tra1</italic>
and <italic>tra2</italic>
regions encoding conjugal transfer <xref rid="pntd.0001245-Wain1" ref-type="bibr">[29]</xref>
, <xref rid="pntd.0001245-Holt2" ref-type="bibr">[33]</xref>
, <xref rid="pntd.0001245-Phan1" ref-type="bibr">[37]</xref>
, <xref rid="pntd.0001245-Taylor2" ref-type="bibr">[52]</xref>
. Subsequently, we identified 347 single nucleotide polymorphisms (SNPs) within these conserved regions, which were used to construct a phylogenetic tree of IncHI1 plasmids and to estimate the divergence dates of internal nodes of this tree based on the known isolation dates for each plasmid <xref rid="pntd.0001245-Drummond3" ref-type="bibr">[53]</xref>
(<xref ref-type="fig" rid="pntd-0001245-g001">Figure 1</xref>
). The tree topology is in general agreement with that inferred previously using a plasmid MLST approach <xref rid="pntd.0001245-Phan1" ref-type="bibr">[37]</xref>
. The sequences of the three most recent <italic>S</italic>
. Typhi plasmids (isolated 2003–2004) were very closely related and correspond to a previously defined plasmid sequence type (PST) known as PST6 <xref rid="pntd.0001245-Phan1" ref-type="bibr">[37]</xref>
(<xref ref-type="fig" rid="pntd-0001245-g001">Figure 1</xref>
, red). According to our divergence date estimates, the most recent common ancestor (mrca) shared by these three plasmids existed circa 1999 (<xref ref-type="fig" rid="pntd-0001245-g001">Figure 1</xref>
). The PST6 plasmids were also closely related to the PST7 plasmid pAKU_1 from <italic>S.</italic>
Paratyphi A (<xref ref-type="fig" rid="pntd-0001245-g001">Figure 1</xref>
, orange), with mrca circa 1992. The plasmids pHCM1, pO111_1 and pMAK1 formed a distinct group corresponding to PST1, with mrca circa 1989 (<xref ref-type="fig" rid="pntd-0001245-g001">Figure 1</xref>
, green). The eighth reference plasmid R27 (PST5) was quite distinct from the others, with an estimated divergence date of 1952 (<xref ref-type="fig" rid="pntd-0001245-g001">Figure 1</xref>
, black).</p>
<p>In addition to the conserved IncHI1 core regions, the plasmids each harbour insertions of drug resistance elements. These include transposons Tn<italic>10</italic>
(encoding tetracycline resistance), Tn<italic>9</italic>
(encoding chloramphenicol resistance via the <italic>cat</italic>
gene (SPAP0067)), <italic>strAB</italic>
(SPAP0152-SPAP0153, SPAP0230-SPAP0231; encoding streptomycin resistance), <italic>sul1</italic>
and <italic>sul2</italic>
(SPAP0132 , SPAP0151; encoding sulfonamide resistance), <italic>dfrA7</italic>
(SPAP0133; encoding trimethoprim resistance) and <italic>bla</italic>
<sub>TEM-1</sub>
(SPAP0143; encoding ampicillin resistance) <xref rid="pntd.0001245-Wain1" ref-type="bibr">[29]</xref>
, <xref rid="pntd.0001245-Holt2" ref-type="bibr">[33]</xref>
, <xref rid="pntd.0001245-Parkhill1" ref-type="bibr">[54]</xref>
. The insertion sites of these elements, confirmed using PCR (<xref ref-type="table" rid="pntd-0001245-t003">Tables 3</xref>
& <xref ref-type="table" rid="pntd-0001245-t004">4</xref>
), differed between lineages of the IncHI1 phylogenetic tree (<xref ref-type="fig" rid="pntd-0001245-g001">Figure 1</xref>
, grey). All plasmid sequences included Tn<italic>10</italic>
, however three different insertion sites were evident (<xref ref-type="table" rid="pntd-0001245-t004">Table 4</xref>
), suggesting the transposon was acquired by IncHI1 plasmids on at least three separate occasions (<xref ref-type="fig" rid="pntd-0001245-g001">Figure 1</xref>
, grey). Tn<italic>9</italic>
was present in all plasmids other than R27, however the insertion site in PST6 and PST7 plasmids differed from that in PST1, suggesting at least two independent acquisitions. It was previously noted that pHCM1 (PST1) and pAKU_1 (PST7) share identical insertions into Tn<italic>9</italic>
of a sequence incorporating Tn<italic>21</italic>
(including <italic>sul1</italic>
, <italic>dfrA7</italic>
), <italic>bla</italic>
<sub>TEM-1</sub>
, <italic>sul2</italic>
, and <italic>strAB</italic>
<xref rid="pntd.0001245-Holt2" ref-type="bibr">[33]</xref>
; here we found this insertion into Tn<italic>9</italic>
was conserved in all PST1 and PST6 plasmid sequences. Together, this composite set of drug resistance elements encodes MDR (resistance to chloramphenicol, ampicillin and trimethoprim-sulfamethoxazole).</p>
<table-wrap id="pntd-0001245-t004" position="float"><object-id pub-id-type="doi">10.1371/journal.pntd.0001245.t004</object-id>
<label>Table 4</label>
<caption><title>Resistance gene insertion sites in IncHI1 plasmids inferred from a combination of PCR and sequencing.</title>
</caption>
<alternatives><graphic id="pntd-0001245-t004-4" xlink:href="pntd.0001245.t004"></graphic>
<table frame="hsides" rules="groups"><colgroup span="1"><col align="left" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead><tr><td align="left" rowspan="1" colspan="1">IncHI1 plasmid sequence type</td>
<td colspan="3" align="left" rowspan="1">PST1</td>
<td align="left" rowspan="1" colspan="1">PST5</td>
<td align="left" rowspan="1" colspan="1">PST6</td>
<td align="left" rowspan="1" colspan="1">PST6</td>
<td align="left" rowspan="1" colspan="1">PST7</td>
<td colspan="2" align="left" rowspan="1">PST8</td>
</tr>
</thead>
<tbody><tr><td align="left" rowspan="1" colspan="1"><bold>Plasmid or isolate</bold>
</td>
<td align="left" rowspan="1" colspan="1">pHCM1</td>
<td align="left" rowspan="1" colspan="1">pMAK1</td>
<td align="left" rowspan="1" colspan="1">pO111_1</td>
<td align="left" rowspan="1" colspan="1">R27</td>
<td align="left" rowspan="1" colspan="1">p6979</td>
<td align="left" rowspan="1" colspan="1">pSTY7</td>
<td align="left" rowspan="1" colspan="1">pAKU1</td>
<td align="left" rowspan="1" colspan="1">81918</td>
<td align="left" rowspan="1" colspan="1">81863, 81424</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold>Bacterial host</bold>
</td>
<td align="left" rowspan="1" colspan="1">STy</td>
<td align="left" rowspan="1" colspan="1">SCh</td>
<td align="left" rowspan="1" colspan="1">Ec</td>
<td align="left" rowspan="1" colspan="1">STm</td>
<td align="left" rowspan="1" colspan="1">STy</td>
<td align="left" rowspan="1" colspan="1">STy</td>
<td align="left" rowspan="1" colspan="1">SPa</td>
<td align="left" rowspan="1" colspan="1">STy</td>
<td align="left" rowspan="1" colspan="1">STy</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold><italic>Tn10 insertion</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>B</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>B</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>B</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>C</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>A</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>A</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>A</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>A</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>A</italic>
</bold>
</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><italic> sequence data</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>B</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>B</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>B</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>C</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>A</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>n/a</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>A</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>n/a</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>n/a</italic>
</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold> N</bold>
(Tn<italic>10</italic>
- HCM1.247)</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">n/d</td>
<td align="left" rowspan="1" colspan="1">n/d</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">-</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold> O</bold>
(<italic>tetD</italic>
- SPAP0276)</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">n/d</td>
<td align="left" rowspan="1" colspan="1">n/d</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">+</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold> P</bold>
(SPAP0261 - Tn<italic>10</italic>
)</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">n/d</td>
<td align="left" rowspan="1" colspan="1">n/d</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">+</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold><italic>Tn9 insertion</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>B</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>B</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>B</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>-</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>A</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>A</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>A</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>-</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>A</italic>
</bold>
</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><italic> sequence data</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>B</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>B</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>B</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>-</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>A</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>n/d</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>A</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>n/a</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>n/a</italic>
</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold> J</bold>
(<italic>cat</italic>
- <italic>trhN</italic>
)</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">n/d</td>
<td align="left" rowspan="1" colspan="1">n/d</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">+</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold> K</bold>
(<italic>mer</italic>
- <italic>trhI</italic>
)</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">n/d</td>
<td align="left" rowspan="1" colspan="1">n/d</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">+</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold> M</bold>
(<italic>cat</italic>
- HCM1.203)</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">n/d</td>
<td align="left" rowspan="1" colspan="1">n/d</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">-</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">L (<italic>insA</italic>
- <italic>tetA</italic>
)</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">n/d</td>
<td align="left" rowspan="1" colspan="1">n/d</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">-</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold><italic>Tn21 into Tn9</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>+</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>+</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>+</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>-</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>+</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>+</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>+</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>-</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>+</italic>
</bold>
</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><italic> sequence data</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>+</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>+</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>+</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>-</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>+</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>n/d</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>+</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>n/a</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>n/a</italic>
</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold> H</bold>
(<italic>tnpA</italic>
- Tn<italic>9</italic>
)</td>
<td align="left" rowspan="1" colspan="1">+<xref ref-type="table-fn" rid="nt102">*</xref>
</td>
<td align="left" rowspan="1" colspan="1">n/d</td>
<td align="left" rowspan="1" colspan="1">n/d</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">+</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold> I</bold>
(<italic>merR</italic>
- Tn<italic>9</italic>
)</td>
<td align="left" rowspan="1" colspan="1">+<xref ref-type="table-fn" rid="nt102">*</xref>
</td>
<td align="left" rowspan="1" colspan="1">n/d</td>
<td align="left" rowspan="1" colspan="1">n/d</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">+</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold><italic>bla/sul/str into Tn21</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>+</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>+</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>+</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>-</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>+</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>+</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>+</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>-</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>+</italic>
</bold>
</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><italic> sequence data</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>+</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>+</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>+</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>-</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>+</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>n/d</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>+</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>n/a</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>n/a</italic>
</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold> G</bold>
(<italic>strB</italic>
– <italic>tniAdelta</italic>
)</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">n/d</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">+</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold><italic>strAB 2<sup>nd</sup>
</italic>
</bold>
<italic> copy</italic>
(SPAP0230- SPAP0231)</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>-</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>-</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>-</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>-</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>-</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>-</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>+</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>+</italic>
</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold><italic>+</italic>
</bold>
</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><italic> sequence data</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>-</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>-</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>-</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>-</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>-</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>n/d</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>+</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>n/a</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>n/a</italic>
</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold> Q</bold>
(<italic>strB</italic>
– SPAP0228)</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">n/d</td>
<td align="left" rowspan="1" colspan="1">n/d</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">-</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">+</td>
<td align="left" rowspan="1" colspan="1">+</td>
</tr>
</tbody>
</table>
</alternatives>
<table-wrap-foot><fn id="nt101"><label></label>
<p>Summaries of five insertion patterns are shown in bold italics; these are inferred from sequence data where available (italics) and PCR using primers shown in <xref ref-type="table" rid="pntd-0001245-t003">Table 3</xref>
(labelled G–Q). STy = <italic>Salmonella enterica</italic>
serovar Typhi, SCh = <italic>Salmonella enterica</italic>
serovar Choleraesuis, STm = <italic>Salmonella enterica</italic>
serovar Typhimurium, SPa = <italic>Salmonella enterica</italic>
serovar Paratyphi A, Ec = <italic>E. coli</italic>
O111:H−. + positive PCR result (i.e. successful amplification); - negative PCR result (i.e. no amplification product detected);</p>
</fn>
<fn id="nt102"><label></label>
<p>*distinct amplicon size for PST1; n/d PCR not done; n/a sequence data not available. “<italic>strAB</italic>
2<sup>nd</sup>
” copy refers to the insertion of streptomycin resistance genes <italic>strAB</italic>
directly into the plasmid backbone (SPAP0230-SPAP0231), not as part of the <italic>bla/sul/str</italic>
element (SPAP0152-SPAP0153).</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="pntd-0001245-t005" position="float"><object-id pub-id-type="doi">10.1371/journal.pntd.0001245.t005</object-id>
<label>Table 5</label>
<caption><title>Chromosome, plasmid and resistance gene details of drug resistant <italic>S</italic>
. Typhi isolated up to 1993<xref ref-type="table-fn" rid="nt104">*</xref>
.</title>
</caption>
<alternatives><graphic id="pntd-0001245-t005-5" xlink:href="pntd.0001245.t005"></graphic>
<table frame="hsides" rules="groups"><colgroup span="1"><col align="left" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead><tr><td align="left" rowspan="1" colspan="1">Isolate</td>
<td align="left" rowspan="1" colspan="1">Year</td>
<td align="left" rowspan="1" colspan="1">Country</td>
<td align="left" rowspan="1" colspan="1">Chr</td>
<td align="left" rowspan="1" colspan="1">Plas</td>
<td align="left" rowspan="1" colspan="1"><italic>IS1</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>cat</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>tetA</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>tetC</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>tetD</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>tetR</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>Tn10LR</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>tnpA</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>merAPRT</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>IntI1</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>sul1</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>dhfR</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>dfrA7</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>bla</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>IS26</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>sul2</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>strAB</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>betU</italic>
</td>
</tr>
</thead>
<tbody><tr><td align="left" rowspan="1" colspan="1">76–54</td>
<td align="left" rowspan="1" colspan="1">1976</td>
<td align="left" rowspan="1" colspan="1">Chile</td>
<td align="left" rowspan="1" colspan="1">H50</td>
<td align="left" rowspan="1" colspan="1">7654</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">78–851</td>
<td align="left" rowspan="1" colspan="1">1978</td>
<td align="left" rowspan="1" colspan="1">Tunisia</td>
<td align="left" rowspan="1" colspan="1">H9</td>
<td align="left" rowspan="1" colspan="1">78851</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">CT18</td>
<td align="left" rowspan="1" colspan="1">1993</td>
<td align="left" rowspan="1" colspan="1">Vietnam</td>
<td align="left" rowspan="1" colspan="1">H1</td>
<td align="left" rowspan="1" colspan="1">PST1</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">76–1406</td>
<td align="left" rowspan="1" colspan="1">1976</td>
<td align="left" rowspan="1" colspan="1">Indonesia</td>
<td align="left" rowspan="1" colspan="1">H42</td>
<td align="left" rowspan="1" colspan="1">PST2</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">75–2507</td>
<td align="left" rowspan="1" colspan="1">1975</td>
<td align="left" rowspan="1" colspan="1">India</td>
<td align="left" rowspan="1" colspan="1">H55</td>
<td align="left" rowspan="1" colspan="1">PST2</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">77–302</td>
<td align="left" rowspan="1" colspan="1">1977</td>
<td align="left" rowspan="1" colspan="1">India</td>
<td align="left" rowspan="1" colspan="1">H55</td>
<td align="left" rowspan="1" colspan="1">PST2</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">77–303</td>
<td align="left" rowspan="1" colspan="1">1977</td>
<td align="left" rowspan="1" colspan="1">India</td>
<td align="left" rowspan="1" colspan="1">H55</td>
<td align="left" rowspan="1" colspan="1">PST2</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">72–1907</td>
<td align="left" rowspan="1" colspan="1">1972</td>
<td align="left" rowspan="1" colspan="1">Vietnam</td>
<td align="left" rowspan="1" colspan="1">H68</td>
<td align="left" rowspan="1" colspan="1">PST2</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">72–1258</td>
<td align="left" rowspan="1" colspan="1">1972</td>
<td align="left" rowspan="1" colspan="1">Mexico</td>
<td align="left" rowspan="1" colspan="1">H11</td>
<td align="left" rowspan="1" colspan="1">PST3</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">73–1102</td>
<td align="left" rowspan="1" colspan="1">1973</td>
<td align="left" rowspan="1" colspan="1">Vietnam</td>
<td align="left" rowspan="1" colspan="1">H87</td>
<td align="left" rowspan="1" colspan="1">PST4</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">81–863</td>
<td align="left" rowspan="1" colspan="1">1981</td>
<td align="left" rowspan="1" colspan="1">Peru</td>
<td align="left" rowspan="1" colspan="1">H50</td>
<td align="left" rowspan="1" colspan="1">PST8</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">81–424</td>
<td align="left" rowspan="1" colspan="1">1981</td>
<td align="left" rowspan="1" colspan="1">Peru</td>
<td align="left" rowspan="1" colspan="1">H77</td>
<td align="left" rowspan="1" colspan="1">PST8</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">81–918</td>
<td align="left" rowspan="1" colspan="1">1981</td>
<td align="left" rowspan="1" colspan="1">Peru</td>
<td align="left" rowspan="1" colspan="1">H77</td>
<td align="left" rowspan="1" colspan="1">PST8</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">57Laos</td>
<td align="left" rowspan="1" colspan="1">2000<xref ref-type="table-fn" rid="nt104">*</xref>
</td>
<td align="left" rowspan="1" colspan="1">Laos</td>
<td align="left" rowspan="1" colspan="1">H1</td>
<td align="left" rowspan="1" colspan="1">57Laos</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">03–4747</td>
<td align="left" rowspan="1" colspan="1">2003<xref ref-type="table-fn" rid="nt104">*</xref>
</td>
<td align="left" rowspan="1" colspan="1">Togo</td>
<td align="left" rowspan="1" colspan="1">H42</td>
<td align="left" rowspan="1" colspan="1">PST2</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">04–6845</td>
<td align="center" rowspan="1" colspan="1">2004<xref ref-type="table-fn" rid="nt104">*</xref>
</td>
<td align="center" rowspan="1" colspan="1">Benin</td>
<td align="center" rowspan="1" colspan="1">H42</td>
<td align="center" rowspan="1" colspan="1">PST2</td>
<td align="center" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">y</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
</tbody>
</table>
</alternatives>
<table-wrap-foot><fn id="nt103"><label></label>
<p>Chr - <italic>S</italic>
. Typhi chromosomal haplotype; Plas - IncHI1 plasmid sequence type;</p>
</fn>
<fn id="nt104"><label></label>
<p>*- MDR <italic>S</italic>
. Typhi isolated after 1993 that were not of the H58 haplotype or PST6 IncHI1 haplotype; y - gene detected in isolate.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s3b"><title>Dissecting the emergence of MDR typhoid</title>
<p>In order to investigate the contribution of distinct IncHI1 plasmid types over time to the emergence of MDR <italic>S</italic>
. Typhi, we performed high resolution SNP typing of <italic>S</italic>
. Typhi chromosomal and IncHI1 plasmid loci in a global collection of 454 <italic>S</italic>
. Typhi, isolated between 1958–2007 (<xref ref-type="table" rid="pntd-0001245-t001">Table 1</xref>
, <xref ref-type="supplementary-material" rid="pntd.0001245.s001">Table S1</xref>
). These isolates include 19 <italic>S</italic>
. Typhi isolates sequenced previously <xref rid="pntd.0001245-Holt4" ref-type="bibr">[45]</xref>
and 22 <italic>S</italic>
. Typhi isolated from Kenya in 2004–2007 <xref rid="pntd.0001245-Kariuki1" ref-type="bibr">[22]</xref>
. We also typed eight IncHI1 <italic>S</italic>
. Typhi plasmids harboured in <italic>E. coli</italic>
transconjugants <xref rid="pntd.0001245-Wain1" ref-type="bibr">[29]</xref>
, <xref rid="pntd.0001245-Phan1" ref-type="bibr">[37]</xref>
. SNP typing was performed using the GoldenGate (Illumina) platform to simultaneously assay chromosomal and plasmid SNP loci. We targeted 231 SNPs from the conserved region of the IncHI1 plasmid (<xref ref-type="supplementary-material" rid="pntd.0001245.s002">Table S2</xref>
, <xref rid="pntd.0001245-Phan1" ref-type="bibr">[37]</xref>
; note 116 of the 347 identified SNPs were not able to be included in the GoldenGate assay, see <xref ref-type="sec" rid="s2">Methods</xref>
) and 119 from resistance genes and associated transposons (see <xref rid="pntd.0001245-Holt1" ref-type="bibr">[16]</xref>
).</p>
<p>Of the 454 <italic>S</italic>
. Typhi that we typed, 193 (43%) harboured IncHI1 plasmids, which clustered into nine distinct haplotypes (<xref ref-type="fig" rid="pntd-0001245-g003">Figure 3B</xref>
). As expected, the majority of IncHI1 plasmids harboured multiple resistance genes or elements including Tn<italic>10</italic>
, Tn<italic>9</italic>
, <italic>strAB</italic>
, <italic>sul1</italic>
, <italic>sul2</italic>
, <italic>dfrA7</italic>
and <italic>bla</italic>
<sub>TEM-1</sub>
. Transposon insertion sites were confirmed for representative plasmids using PCR (<xref ref-type="table" rid="pntd-0001245-t004">Table 4</xref>
) and agree with the patterns of insertion sites determined by sequencing (<xref ref-type="fig" rid="pntd-0001245-g001">Figure 1</xref>
& <xref ref-type="fig" rid="pntd-0001245-g003">3B</xref>
). Thirteen IncHI1 plasmids were identified among <italic>S</italic>
. Typhi isolated prior to 1994 (<xref ref-type="table" rid="pntd-0001245-t005">Table 5</xref>
), including seven of the total nine distinct IncHI1 plasmid haplotypes (<xref ref-type="fig" rid="pntd-0001245-g003">Figure 3B</xref>
).</p>
<fig id="pntd-0001245-g003" position="float"><object-id pub-id-type="doi">10.1371/journal.pntd.0001245.g003</object-id>
<label>Figure 3</label>
<caption><title>Phylogenetic trees of <italic>S</italic>
. Typhi chromosome and IncHI1 plasmid.</title>
<p>(A) Phylogenetic tree indicating chromosomal haplotypes of 454 <italic>S</italic>
. Typhi isolates determined by SNP typing with the GoldenGate assay. Circles correspond to detected <italic>S</italic>
. Typhi haplotypes; node sizes are scaled to the number of isolates detected with that haplotype and labelled with this number. Unfilled circle indicates tree root; reference isolates used to define the <italic>S</italic>
. Typhi SNPs are labelled with the isolate name. <italic>S.</italic>
Typhi haplotypes in which IncHI1 plasmids were detected (N = 201) are coloured; black circles indicate no IncHI1 plasmids were found among <italic>S</italic>
. Typhi of that haplotype; other colours indicate the presence of specific IncHI1 plasmid haplotypes corresponding to the colours in (B). Note that most of the coloured nodes also contain <italic>S</italic>
. Typhi isolates with no plasmid, and the colours do not represent the proportion of isolates harbouring the various plasmid types. (B) Phylogenetic tree of IncHI1 plasmids determined by SNP typing with the GoldenGate assay (coloured leaf nodes); grey leaf nodes indicate the position of non-<italic>S</italic>
. Typhi plasmids, as determined from plasmid sequence data listed in <xref ref-type="table" rid="pntd-0001245-t002">Table 2</xref>
.</p>
</caption>
<graphic xlink:href="pntd.0001245.g003"></graphic>
</fig>
<p>A total of 26 distinct <italic>S</italic>
. Typhi haplotypes were identified by typing of chromosomal SNPs; their phylogenetic relationships are shown in <xref ref-type="fig" rid="pntd-0001245-g003">Figure 3A</xref>
. The PST2 plasmid was detected in three <italic>S</italic>
. Typhi haplotypes isolated in Asia between 1972 and 1977 (<xref ref-type="table" rid="pntd-0001245-t005">Table 5</xref>
), consistent with repeated introduction of closely related IncHI1 plasmids into distinct <italic>S</italic>
. Typhi hosts. Similarly, PST8 was present in two <italic>S</italic>
. Typhi haplotypes from Peru in 1981 (<xref ref-type="table" rid="pntd-0001245-t005">Table 5</xref>
) <xref rid="pntd.0001245-Goldstein1" ref-type="bibr">[55]</xref>
, consistent with transfer of the PST8 plasmid among multiple <italic>S</italic>
. Typhi haplotypes co-circulating in Peru at this time. Significantly, from 1995 onwards, nearly all IncHI1 plasmids were type PST6 (180/184 plasmids, 98%). Remarkably, there was an exclusive relationship between PST6 plasmids and <italic>S</italic>
. Typhi haplogroup H58, with all PST6 plasmids found in <italic>S</italic>
. Typhi H58 hosts, and no <italic>S</italic>
. Typhi H58 harbouring non-PST6 plasmids (although 35% of <italic>S</italic>
. Typhi H58 were non-MDR and plasmid-free). This strongly suggests that the apparent rise in MDR typhoid since the mid-1990s <xref rid="pntd.0001245-Hermans1" ref-type="bibr">[11]</xref>
, <xref rid="pntd.0001245-Connerton1" ref-type="bibr">[12]</xref>
, <xref rid="pntd.0001245-Rowe1" ref-type="bibr">[13]</xref>
is due to the clonal expansion of H58 <italic>S</italic>
. Typhi carrying the MDR PST6 plasmid. This is in contrast to the longer-term situation described above, which showed that in the years following the first emergence of MDR typhoid (1970s–1980s), MDR IncHI1 plasmids had transferred repeatedly into distinct co-circulating <italic>S</italic>
. Typhi haplotypes.</p>
<p>The clonal expansion of H58 <italic>S</italic>
. Typhi has been documented previously <xref rid="pntd.0001245-Kariuki1" ref-type="bibr">[22]</xref>
, <xref rid="pntd.0001245-Roumagnac1" ref-type="bibr">[41]</xref>
, however the role of the PST6 plasmid has not been investigated. Among our collection, the oldest <italic>S</italic>
. Typhi H58 isolate dates back to 1995 and carries the PST6 plasmid. To ascertain whether the common ancestor of <italic>S</italic>
. Typhi H58 might have carried the PST6 plasmid, the phylogenetic structure among our 293 <italic>S</italic>
. Typhi H58 isolates was resolved using 45 of the assayed SNP loci that differentiate within the H58 haplogroup (<xref ref-type="fig" rid="pntd-0001245-g004">Figure 4</xref>
). These SNPs divided the isolates into 24 distinct H58 haplotypes, with the majority (N = 270) in 13 haplotypes (<xref ref-type="fig" rid="pntd-0001245-g004">Figure 4</xref>
). Most of the H58 haplotypes (N = 14), including the ancestral haplotype A, included isolates harbouring the PST6 plasmid (<xref ref-type="fig" rid="pntd-0001245-g004">Figure 4</xref>
). We have previously sequenced the genomes of 19 <italic>S</italic>
. Typhi, including seven isolates from the H58 haplogroup <xref rid="pntd.0001245-Holt4" ref-type="bibr">[45]</xref>
, and observed the insertion of an IS<italic>1</italic>
transposase between protein coding sequences STY3618 and STY3619 within all sequenced H58 <italic>S</italic>
. Typhi genomes. This transposase was identical at the nucleotide level to the IS<italic>1</italic>
sequences within Tn<italic>9</italic>
in IncHI1 plasmids pHCM1 and pAKU_1, and shared a common insertion site in all seven <italic>S</italic>
. Typhi H58 chromosomes sequenced <xref rid="pntd.0001245-Holt4" ref-type="bibr">[45]</xref>
. In the present study, our SNP assays included a probe targeting sequences within the IS<italic>1</italic>
gene (SPAP0007). Nearly all of the <italic>S</italic>
. Typhi H58 isolates gave positive signals for this IS<italic>1</italic>
target (<xref ref-type="fig" rid="pntd-0001245-g004">Figure 4</xref>
; coloured or white), with the sole exception of six isolates belonging to the H58 ancestral haplotype A (<xref ref-type="fig" rid="pntd-0001245-g004">Figure 4</xref>
, grey), which also included three isolates that carried the PST6 plasmid and tested positive for IS<italic>1</italic>
(<xref ref-type="fig" rid="pntd-0001245-g004">Figure 4</xref>
, purple). This suggests that the PST6 plasmid was likely acquired by the most recent common ancestor of <italic>S</italic>
. Typhi H58 (<xref ref-type="fig" rid="pntd-0001245-g004">Figure 4</xref>
, haplotype A), followed by transposition of IS<italic>1</italic>
into the <italic>S</italic>
. Typhi chromosome prior to divergence into subtypes of H58. Thus the dominance of PST6 over other MDR IncHI1 plasmids (noted here and previously <xref rid="pntd.0001245-Phan1" ref-type="bibr">[37]</xref>
) and the dominance of H58 over other <italic>S</italic>
. Typhi haplotypes (noted here and previously <xref rid="pntd.0001245-Kariuki1" ref-type="bibr">[22]</xref>
, <xref rid="pntd.0001245-Roumagnac1" ref-type="bibr">[41]</xref>
) appears to be the result of a trans-continental clonal expansion of MDR <italic>S</italic>
. Typhi H58 carrying the PST6 plasmid.</p>
<fig id="pntd-0001245-g004" position="float"><object-id pub-id-type="doi">10.1371/journal.pntd.0001245.g004</object-id>
<label>Figure 4</label>
<caption><title>Phylogenetic tree of the H58 haplogroup of <italic>S</italic>
. Typhi.</title>
<p>Dashed line indicates where this tree joins into the larger phylogenetic tree of <italic>S</italic>
. Typhi (shown in <xref ref-type="fig" rid="pntd-0001245-g003">Figure 3A</xref>
). The two major H58 lineages are indicated by colour (blue, lineage I; red, lineage II; purple, common ancestor of both lineages). Nodes are labelled with isolate names (outer nodes representing sequenced isolates; see <xref rid="pntd.0001245-Holt4" ref-type="bibr">[45]</xref>
), haplotype (H followed by number, as defined in <xref rid="pntd.0001245-Roumagnac1" ref-type="bibr">[41]</xref>
) or letters indicating nodes resolved by SNP typing. Node sizes indicate the relative frequency of each haplotype within the study collection of 269 H58 <italic>S</italic>
. Typhi isolates, according to the scale provided. The proportion of isolates in each node carrying the PST6 plasmid and IS<italic>1</italic>
(solid colour), IS<italic>1</italic>
only (white) or neither (grey) is indicated by shading.</p>
</caption>
<graphic xlink:href="pntd.0001245.g004"></graphic>
</fig>
</sec>
<sec id="s3c"><title>Possible selective advantages of IncHI1 PST6</title>
<p>These results indicate that the recent global spread of MDR typhoid is attributable to the emergence of a single plasmid-host combination (H58-PST6). We were able to transfer the PST6 plasmid pSTY7 from <italic>S</italic>
. Typhi to <italic>E. coli</italic>
<xref rid="pntd.0001245-Wain1" ref-type="bibr">[29]</xref>
and back to <italic>S</italic>
. Typhi (data not shown), confirming that the PST6 plasmid retains the ability to transfer between bacteria via conjugation, yet we found no evidence of PST6 transfer in natural <italic>S</italic>
. Typhi populations (above). This raises the question of why this particular plasmid-host association has been so successful and exclusive.</p>
<p>To investigate whether PST6 could confer any selective advantage over other IncHI1 plasmids harbouring similar antimicrobial resistance genes, representative PST6 (pSTY7) and PST1 (pHCM1) IncHI1 plasmids from Vietnamese <italic>S</italic>
. Typhi were introduced into a common <italic>S</italic>
. Typhi BRD948 host, derived from <italic>S</italic>
. Typhi Ty2 (haplotype H10). The PST1 plasmid pHCM1 was chosen for comparison since its complete sequence is available <xref rid="pntd.0001245-Parkhill1" ref-type="bibr">[54]</xref>
and it was previously observed to be common in MDR <italic>S</italic>
. Typhi in Vietnam in the early 1990s, just prior to the emergence of PST6 in <italic>S</italic>
. Typhi in Vietnam and elsewhere <xref rid="pntd.0001245-Wain1" ref-type="bibr">[29]</xref>
. BRD948 (pHCM1) grew to three times the number of cfu compared to BRD948 (pSTY7) after 4 days of mixed growth in LB broth (<xref ref-type="fig" rid="pntd-0001245-g005">Figure 5</xref>
, black). We therefore hypothesized that the advantage conferred by PST6 plasmids, if any, might be related to specific environmental conditions or to plasmid-host compatibility. To test the latter, we compared the growth of wildtype PST1-bearing <italic>S</italic>
. Typhi H1 and PST6-bearing <italic>S</italic>
. Typhi H58 isolated from typhoid patients in Vietnam and Pakistan and genotyped using the GoldenGate assay (listed in <xref ref-type="supplementary-material" rid="pntd.0001245.s001">Table S1</xref>
). The two PST6-bearing <italic>S</italic>
. Typhi H58 isolates tested were both able to out compete the PST1-bearing H1 isolate, so that <italic>S</italic>
. Typhi H1 was barely detectable after four days of competitive growth (<xref ref-type="fig" rid="pntd-0001245-g005">Figure 5</xref>
, red). However plasmid-free <italic>S.</italic>
Typhi H58 isolates were also able to outcompete a plasmid-free <italic>S</italic>
. Typhi H1 isolate (<xref ref-type="fig" rid="pntd-0001245-g005">Figure 5</xref>
, blue), thus we cannot confirm the plasmid plays a role in the competitive advantage of H58-PST6 <italic>S</italic>
. Typhi over and above that of the H58 chromosomal haplotype.</p>
<fig id="pntd-0001245-g005" position="float"><object-id pub-id-type="doi">10.1371/journal.pntd.0001245.g005</object-id>
<label>Figure 5</label>
<caption><title>Competitive growth assays for <italic>S</italic>
. Typhi H58 and H1 with and without IncHI1 plasmids.</title>
<p>The dynamics of five competitive growth assays conducted over four days of sequential sub-culture. Black line indicates competition in a common host background (attenuated laboratory strain <italic>S</italic>
. Typhi BRD948; haplotype H10); the proportion of PST1- and PST6-bearing bacteria at each time point was calculated by streaking an aliquot of the sample onto agar plates and testing random colonies using a PCR that differentiates PST1 and PST6. Coloured lines indicate competition between wildtype <italic>S</italic>
. Typhi isolates as specified in the legend (see <xref ref-type="supplementary-material" rid="pntd.0001245.s001">Table S1</xref>
for isolate names); the proportion of H58 and H1 chromosomes at each time point was calculated by quantifying the relative abundance of two alleles at a SNP locus that differs between H58 and H1 <italic>S</italic>
. Typhi using quantitative PCR. For all assays, experiments were replicated at least three times; data points represent the mean proportion of culture corresponding to the isolate underlined in the legend; error bars show the standard deviation of this proportion.</p>
</caption>
<graphic xlink:href="pntd.0001245.g005"></graphic>
</fig>
<p>To screen for conditions under which PST6 plasmids confer an advantage compared to PST1 plasmids, we used Biolog phenotyping arrays to compare the growth of plasmid-free <italic>S</italic>
. Typhi BRD948 to BRD948 (pHCM1) and BRD948 (pSTY7) under a wide variety of conditions including various pH levels and osmotic/ionic strengths, and a wide variety of antibiotics and chemicals <xref rid="pntd.0001245-Bochner1" ref-type="bibr">[51]</xref>
. As expected, both IncHI1 plasmids conferred enhanced growth in the presence of a wide range of antibiotics including amoxicillin, azlocillin, oxacillin, penicillin G, phenethicillin, chloramphenicol, streptomycin, gentamicin, tetracyclines and trimethoprim (<xref ref-type="supplementary-material" rid="pntd.0001245.s003">Table S3</xref>
). BRD948 (pHCM1) displayed some minor growth advantages in the presence of additional antimicrobials, however none of these reached clinically relevant levels (<xref ref-type="supplementary-material" rid="pntd.0001245.s003">Table S3</xref>
). The only conditions under which BRD948 (pSTY7) grew better than BRD948 and BRD948 (pHCM1) was under high osmotic stress (3-5% NaCl or 6% KCl) (<xref ref-type="supplementary-material" rid="pntd.0001245.s003">Table S3</xref>
). We confirmed this phenotype by inoculating each isolate into high salt concentration media (0.8 M NaCl LB broth, approx. 4.7% NaCl); only the PST6-bearing isolate BRD948 (pSTY7) was able to grow under these conditions (<xref ref-type="fig" rid="pntd-0001245-g006">Figure 6</xref>
, red and grey).</p>
<fig id="pntd-0001245-g006" position="float"><object-id pub-id-type="doi">10.1371/journal.pntd.0001245.g006</object-id>
<label>Figure 6</label>
<caption><title>The effect of Tn<italic>6062</italic>
on osmotolerance in <italic>S.</italic>
Typhi BRD948.</title>
<p>Growth curves for <italic>S</italic>
. Typhi isolates in 0.8 M NaCl LB broth. Error bars indicate range of maximum and minimum values.</p>
</caption>
<graphic xlink:href="pntd.0001245.g006"></graphic>
</fig>
<p>We hypothesised that the osmotolerant properties of PST6 plasmids may be explained by the presence of two putative transporters encoded within a composite transposon, Tn<italic>6062</italic>
(SPAP0100, SPAP0105, SPAP0106, SPAP0110; this transposon was referred to as Ins<italic>1056</italic>
in <xref rid="pntd.0001245-Phan1" ref-type="bibr">[37]</xref>
). Tn<italic>6062</italic>
was present in all PST6 plasmids, the novel subtype of PST1 (57Laos) and two of the three PST8 plasmids, but absent from all other isolates (detected via two Tn<italic>6062</italic>
-specific probes included in our SNP typing assay). To determine if Tn<italic>6062</italic>
was responsible for the osmotolerant phenotype of BRD948 (pSTY7), the two putative transporter genes from Tn<italic>6062</italic>
(SPAP0105 and SPAP0106) were inserted into the plasmid vector pAYCY184 and we assessed their effect on <italic>S</italic>
. Typhi BRD948 in high salt concentration medium (0.8 M NaCl LB broth, approx. 4.7% NaCl). BRD948 (pAYCY184-Tn<italic>6062</italic>
) was able to grow at a slightly lower rate than BRD948 (pSTY7) (<xref ref-type="fig" rid="pntd-0001245-g006">Figure 6</xref>
, blue), while BRD948 carrying the empty pAYCY184 vector was unable to grow (<xref ref-type="fig" rid="pntd-0001245-g006">Figure 6</xref>
, black). Therefore the transposon Tn<italic>6062</italic>
carried by the PST6 IncHI1 plasmids confers an osmotolerant phenotype on its <italic>S</italic>
. Typhi host.</p>
</sec>
</sec>
<sec id="s4"><title>Discussion</title>
<p>Our analysis of IncHI1 plasmid sequences indicates that plasmids responsible for the MDR phenotype in <italic>S</italic>
. Typhi are closely related to those associated with MDR in other enteric pathogens including <italic>S</italic>
. Paratyphi A, <italic>S</italic>
. Choleraesuis and enterohaemorrhagic <italic>E. coli</italic>
O111:H- (<xref ref-type="fig" rid="pntd-0001245-g001">Figure 1</xref>
, <xref ref-type="table" rid="pntd-0001245-t002">Table 2</xref>
). These plasmids share a recent common ancestor approximately six decades old and have evolved into several distinct lineages via accumulation of point mutations, followed by acquisition of resistance elements and further point mutation (<xref ref-type="fig" rid="pntd-0001245-g001">Figure 1</xref>
). Simultaneous SNP typing of plasmid and host enabled us to differentiate between the clonal expansion of MDR <italic>S</italic>
. Typhi, and independent acquisitions of related MDR plasmids by distinct <italic>S</italic>
. Typhi hosts. Evidence for the latter includes the detection of PST2 and PST8 plasmids in co-circulating <italic>S</italic>
. Typhi isolates of distinct haplotypes in the 1970s and 1980s (<xref ref-type="table" rid="pntd-0001245-t005">Table 5</xref>
). This indicates that the emergence of MDR typhoid during this period was in part due to transfer of IncHI1 plasmids within local <italic>S</italic>
. Typhi populations. One of the PST2-<italic>S</italic>
. Typhi combinations (chromosomal haplotype H42) was later detected among two isolates from Africa in 2003–2004, suggesting that an individual IncHI1 plasmid may be able to persist in a single host haplotype for decades (<xref ref-type="table" rid="pntd-0001245-t005">Table 5</xref>
). In stark contrast, all 193 PST6 plasmids were observed in <italic>S</italic>
. Typhi of the H58 haplotype and virtually all MDR <italic>S</italic>
. Typhi observed after 1995 belonged to the same PST6-H58 clone, indicative of global spread of MDR typhoid via clonal expansion. Since humans are the only known reservoir for <italic>S</italic>
. Typhi <xref rid="pntd.0001245-Edsall1" ref-type="bibr">[56]</xref>
, it is likely that trans-continental spread of this clone depends on international travel or migration. If this is the case it will be particularly difficult to control since <italic>S</italic>
. Typhi can be transmitted by asymptomatic carriers <xref rid="pntd.0001245-Khatri1" ref-type="bibr">[57]</xref>
, <xref rid="pntd.0001245-Levine1" ref-type="bibr">[58]</xref>
, who are usually unaware of their status and are difficult to detect <xref rid="pntd.0001245-Lanata1" ref-type="bibr">[59]</xref>
, <xref rid="pntd.0001245-Ferreccio1" ref-type="bibr">[60]</xref>
.</p>
<p>Our data suggest that the PST6 plasmid was acquired by the most recent common ancestor of <italic>S</italic>
. Typhi H58 (<xref ref-type="fig" rid="pntd-0001245-g004">Figure 4</xref>
), implying that the expansion of <italic>S</italic>
. Typhi H58 did not begin until after acquisition of the plasmid. To our knowledge, the oldest confirmed <italic>S</italic>
. Typhi H58 isolate is 9105928K <xref rid="pntd.0001245-Roumagnac1" ref-type="bibr">[41]</xref>
, which was isolated in India in 1991 and is MDR (Mia Torpdhal, personal communication). This suggests that the initial expansion of <italic>S</italic>
. Typhi H58 may have been associated with the acquisition of the PST6 plasmid, implying a selective advantage over and above that of MDR, which was also conferred by other IncHI1 plasmid types circulating in <italic>S</italic>
. Typhi in the 1990s. The only growth advantage we detected for PST6 plasmids via our phenotype screen was that of osmotolerance, which we showed to be conferred by the Tn<italic>6062</italic>
transposon carried by PST6 plasmids. The transposon Tn<italic>6062</italic>
includes betU (SPAP0106), which encodes a betaine uptake system capable of transporting glycine betaine and proline betaine <xref rid="pntd.0001245-Culham1" ref-type="bibr">[61]</xref>
. It was first described in <italic>E. coli</italic>
isolates causing pyelonephritis (ascending urinary tract infection) and is believed to be an osmoregulator, allowing <italic>E. coli</italic>
to survive the high osmolarity and urea content in urine <xref rid="pntd.0001245-Culham1" ref-type="bibr">[61]</xref>
. However the gene is distributed among <italic>E. coli</italic>
with a range of pathogenic phenotypes, so its osmoprotectant properties may be useful in other environmental contexts <xref rid="pntd.0001245-Ly1" ref-type="bibr">[62]</xref>
. It is possible that enhanced osmotolerance may enhance survival of <italic>S</italic>
. Typhi in specific niches within the human body, including the gut, gall bladder, urinary tract or liver. It is also possible that the ability to grow in the presence of high salt concentrations might enable <italic>S</italic>
. Typhi to continue replicating in certain environments outside the host, which may lower the infectious dose or enhance the possibility of transmission by increasing the level of <italic>S</italic>
. Typhi contamination in certain environments. This may have contributed to the selection of PST6 over other IncHI1 plasmids previously circulating among <italic>S</italic>
. Typhi and the initial clonal expansion of H58 <italic>S</italic>
. Typhi, however questions remain as to why the PST6 plasmid has not been detected among non-H58 <italic>S</italic>
. Typhi. The PST6 plasmid appears to have been lost from H58 <italic>S</italic>
. Typhi in some areas where the recommended treatment of typhoid was switched to fluoroquinolones, including Nepal and Vietnam <xref rid="pntd.0001245-Holt3" ref-type="bibr">[39]</xref>
, <xref rid="pntd.0001245-Weill1" ref-type="bibr">[63]</xref>
, <xref rid="pntd.0001245-Le1" ref-type="bibr">[64]</xref>
, while it has been maintained in areas such as Kenya where chloramphenicol is still commonly used to treat typhoid <xref rid="pntd.0001245-Mengo1" ref-type="bibr">[17]</xref>
, <xref rid="pntd.0001245-Kariuki1" ref-type="bibr">[22]</xref>
. This confirms that antimicrobial use exerts a strong selective pressure for maintenance of the IncHI1 plasmid among <italic>S</italic>
. Typhi and indicates that in the absence of such pressure any additional advantages conferred, including the increased osmotolerance described above, is not enough to maintain the PST6 plasmid indefinitely.</p>
</sec>
<sec sec-type="supplementary-material" id="s5"><title>Supporting Information</title>
<supplementary-material content-type="local-data" id="pntd.0001245.s001"><label>Table S1</label>
<caption><p><bold>Bacterial isolates analyzed in this study.</bold>
</p>
<p>(XLS)</p>
</caption>
<media xlink:href="pntd.0001245.s001.xls"><caption><p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="pntd.0001245.s002"><label>Table S2</label>
<caption><p><bold>IncHI1 SNP loci targeted in this study.</bold>
</p>
<p>(XLS)</p>
</caption>
<media xlink:href="pntd.0001245.s002.xls"><caption><p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="pntd.0001245.s003"><label>Table S3</label>
<caption><p><bold>Biolog phenotype array results.</bold>
</p>
<p>(XLS)</p>
</caption>
<media xlink:href="pntd.0001245.s003.xls"><caption><p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
</sec>
</body>
<back><ack><p><italic>S</italic>
. Typhi isolates were kindly contributed by To Song Diep, Tran Tinh Hien and Christiane Dolecek (Oxford University Clinical Research Unit, Hospital for Tropical Diseases, Ho Chi Minh City, Vietnam), John Albert (Department of Microbiology, Faculty of Medicine, Kuwait University, Kuwait), Getenet Bevene (Department of Microbiology, Immunology and Parasitology, Jimma University, Ethiopia), Bianca Paglietti (Università di Sassari, Sardinia, Italy) and Rattanaphone Phetsouvanh (Wellcome Trust-Mahosot Hospital-Oxford University Tropical Medicine Research, Laos).</p>
</ack>
<fn-group><fn fn-type="COI-statement"><p>The authors have declared that no competing interests exist.</p>
</fn>
<fn fn-type="financial-disclosure"><p>This work was supported by the Wellcome Trust. KEH was supported by a Wellcome Trust Studentship and a Fellowship from the NHMRC of Australia (#628930). MDP was supported by a Wellcome Trust Studentship. SB is supported by an OAK Foundation Fellowship through Oxford University. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</p>
</fn>
</fn-group>
<ref-list><title>References</title>
<ref id="pntd.0001245-Kothari1"><label>1</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kothari</surname>
<given-names>A</given-names>
</name>
<name><surname>Pruthi</surname>
<given-names>A</given-names>
</name>
<name><surname>Chugh</surname>
<given-names>TD</given-names>
</name>
</person-group>
<year>2008</year>
<article-title>The burden of enteric fever.</article-title>
<source>J Infect Dev Ctries</source>
<volume>2</volume>
<fpage>253</fpage>
<lpage>259</lpage>
<pub-id pub-id-type="pmid">19741285</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Crump1"><label>2</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Crump</surname>
<given-names>JA</given-names>
</name>
<name><surname>Luby</surname>
<given-names>SP</given-names>
</name>
<name><surname>Mintz</surname>
<given-names>ED</given-names>
</name>
</person-group>
<year>2004</year>
<article-title>The global burden of typhoid fever.</article-title>
<source>Bull World Health Organ</source>
<volume>82</volume>
<fpage>346</fpage>
<lpage>353</lpage>
<pub-id pub-id-type="pmid">15298225</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-World1"><label>3</label>
<element-citation publication-type="book"><collab>World Health Organization</collab>
<year>2003</year>
<article-title>The diagnosis, treatment and prevention of typhoid fever.</article-title>
<publisher-name>Communicable Disease Surveillance and Response Vaccine and Biologicals</publisher-name>
<fpage>7</fpage>
<lpage>18</lpage>
</element-citation>
</ref>
<ref id="pntd.0001245-Whitaker1"><label>4</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Whitaker</surname>
<given-names>JA</given-names>
</name>
<name><surname>Franco-Paredes</surname>
<given-names>C</given-names>
</name>
<name><surname>del Rio</surname>
<given-names>C</given-names>
</name>
<name><surname>Edupuganti</surname>
<given-names>S</given-names>
</name>
</person-group>
<year>2009</year>
<article-title>Rethinking typhoid fever vaccines: implications for travelers and people living in highly endemic areas.</article-title>
<source>J Travel Med</source>
<volume>16</volume>
<fpage>46</fpage>
<lpage>52</lpage>
<pub-id pub-id-type="pmid">19192128</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Ochiai1"><label>5</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ochiai</surname>
<given-names>RL</given-names>
</name>
<name><surname>Acosta</surname>
<given-names>CJ</given-names>
</name>
<name><surname>Agtini</surname>
<given-names>M</given-names>
</name>
<name><surname>Bhattacharya</surname>
<given-names>SK</given-names>
</name>
<name><surname>Bhutta</surname>
<given-names>ZA</given-names>
</name>
<etal></etal>
</person-group>
<year>2007</year>
<article-title>The use of typhoid vaccines in Asia: the DOMI experience.</article-title>
<source>Clin Infect Dis</source>
<volume>45</volume>
<issue>Suppl 1</issue>
<fpage>S34</fpage>
<lpage>38</lpage>
<pub-id pub-id-type="pmid">17582567</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Colquhoun1"><label>6</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Colquhoun</surname>
<given-names>J</given-names>
</name>
<name><surname>Weetch</surname>
<given-names>RS</given-names>
</name>
</person-group>
<year>1950</year>
<article-title>Resistance to chloramphenicol developing during treatment of typhoid fever.</article-title>
<source>Lancet</source>
<volume>2</volume>
<fpage>621</fpage>
<lpage>623</lpage>
<pub-id pub-id-type="pmid">14785226</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Olarte1"><label>7</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Olarte</surname>
<given-names>J</given-names>
</name>
<name><surname>Galindo</surname>
<given-names>E</given-names>
</name>
</person-group>
<year>1973</year>
<article-title>Salmonella typhi resistant to chloramphenicol, ampicillin, and other antimicrobial agents: strains isolated during an extensive typhoid fever epidemic in Mexico.</article-title>
<source>Antimicrob Agents Chemother</source>
<volume>4</volume>
<fpage>597</fpage>
<lpage>601</lpage>
<pub-id pub-id-type="pmid">4602828</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Anderson1"><label>8</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Anderson</surname>
<given-names>ES</given-names>
</name>
</person-group>
<year>1975</year>
<article-title>The problem and implications of chloramphenicol resistance in the typhoid bacillus.</article-title>
<source>J Hyg (Lond)</source>
<volume>74</volume>
<fpage>289</fpage>
<lpage>299</lpage>
<pub-id pub-id-type="pmid">1091698</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Chau1"><label>9</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chau</surname>
<given-names>TT</given-names>
</name>
<name><surname>Campbell</surname>
<given-names>JI</given-names>
</name>
<name><surname>Galindo</surname>
<given-names>CM</given-names>
</name>
<name><surname>Van Minh Hoang</surname>
<given-names>N</given-names>
</name>
<name><surname>Diep</surname>
<given-names>TS</given-names>
</name>
<etal></etal>
</person-group>
<year>2007</year>
<article-title>Antimicrobial drug resistance of Salmonella enterica serovar typhi in asia and molecular mechanism of reduced susceptibility to the fluoroquinolones.</article-title>
<source>Antimicrob Agents Chemother</source>
<volume>51</volume>
<fpage>4315</fpage>
<lpage>4323</lpage>
<pub-id pub-id-type="pmid">17908946</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Ochiai2"><label>10</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ochiai</surname>
<given-names>RL</given-names>
</name>
<name><surname>Acosta</surname>
<given-names>CJ</given-names>
</name>
<name><surname>Danovaro-Holliday</surname>
<given-names>MC</given-names>
</name>
<name><surname>Baiqing</surname>
<given-names>D</given-names>
</name>
<name><surname>Bhattacharya</surname>
<given-names>SK</given-names>
</name>
<etal></etal>
</person-group>
<year>2008</year>
<article-title>A study of typhoid fever in five Asian countries: disease burden and implications for controls.</article-title>
<source>Bull World Health Organ</source>
<volume>86</volume>
<fpage>260</fpage>
<lpage>268</lpage>
<pub-id pub-id-type="pmid">18438514</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Hermans1"><label>11</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hermans</surname>
<given-names>PW</given-names>
</name>
<name><surname>Saha</surname>
<given-names>SK</given-names>
</name>
<name><surname>van Leeuwen</surname>
<given-names>WJ</given-names>
</name>
<name><surname>Verbrugh</surname>
<given-names>HA</given-names>
</name>
<name><surname>van Belkum</surname>
<given-names>A</given-names>
</name>
<etal></etal>
</person-group>
<year>1996</year>
<article-title>Molecular typing of Salmonella typhi strains from Dhaka (Bangladesh) and development of DNA probes identifying plasmid-encoded multidrug-resistant isolates.</article-title>
<source>J Clin Microbiol</source>
<volume>34</volume>
<fpage>1373</fpage>
<lpage>1379</lpage>
<pub-id pub-id-type="pmid">8735083</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Connerton1"><label>12</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Connerton</surname>
<given-names>P</given-names>
</name>
<name><surname>Wain</surname>
<given-names>J</given-names>
</name>
<name><surname>Hien</surname>
<given-names>TT</given-names>
</name>
<name><surname>Ali</surname>
<given-names>T</given-names>
</name>
<name><surname>Parry</surname>
<given-names>C</given-names>
</name>
<etal></etal>
</person-group>
<year>2000</year>
<article-title>Epidemic typhoid in vietnam: molecular typing of multiple-antibiotic-resistant Salmonella enterica serotype typhi from four outbreaks.</article-title>
<source>J Clin Microbiol</source>
<volume>38</volume>
<fpage>895</fpage>
<lpage>897</lpage>
<pub-id pub-id-type="pmid">10655411</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Rowe1"><label>13</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rowe</surname>
<given-names>B</given-names>
</name>
<name><surname>Ward</surname>
<given-names>LR</given-names>
</name>
<name><surname>Threlfall</surname>
<given-names>EJ</given-names>
</name>
</person-group>
<year>1997</year>
<article-title>Multidrug-resistant Salmonella typhi: a worldwide epidemic.</article-title>
<source>Clin Infect Dis</source>
<volume>24</volume>
<issue>Suppl 1</issue>
<fpage>S106</fpage>
<lpage>109</lpage>
<pub-id pub-id-type="pmid">8994789</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Nagshetty1"><label>14</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nagshetty</surname>
<given-names>K</given-names>
</name>
<name><surname>Channappa</surname>
<given-names>ST</given-names>
</name>
<name><surname>Gaddad</surname>
<given-names>SM</given-names>
</name>
</person-group>
<year>2010</year>
<article-title>Antimicrobial susceptibility of Salmonella Typhi in India.</article-title>
<source>J Infect Dev Ctries</source>
<volume>4</volume>
<fpage>70</fpage>
<lpage>73</lpage>
<pub-id pub-id-type="pmid">20212336</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Kasper1"><label>15</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kasper</surname>
<given-names>MR</given-names>
</name>
<name><surname>Sokhal</surname>
<given-names>B</given-names>
</name>
<name><surname>Blair</surname>
<given-names>PJ</given-names>
</name>
<name><surname>Wierzba</surname>
<given-names>TF</given-names>
</name>
<name><surname>Putnam</surname>
<given-names>SD</given-names>
</name>
</person-group>
<year>2010</year>
<article-title>Emergence of multidrug-resistant Salmonella enterica serovar Typhi with reduced susceptibility to fluoroquinolones in Cambodia.</article-title>
<source>Diagn Microbiol Infect Dis</source>
<volume>66</volume>
<fpage>207</fpage>
<lpage>209</lpage>
<pub-id pub-id-type="pmid">19800753</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Holt1"><label>16</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Holt</surname>
<given-names>K</given-names>
</name>
<name><surname>Dolecek</surname>
<given-names>C</given-names>
</name>
<name><surname>Chau</surname>
<given-names>T</given-names>
</name>
<name><surname>Duy</surname>
<given-names>P</given-names>
</name>
<name><surname>La</surname>
<given-names>TTP</given-names>
</name>
<etal></etal>
</person-group>
<year>2011</year>
<article-title>Temporal Fluctuation of Multidrug Resistant Salmonella Typhi Haplotypes in the Mekong River Delta Region of Vietnam.</article-title>
<source>PloS NTD</source>
<volume>5</volume>
<fpage>e929</fpage>
</element-citation>
</ref>
<ref id="pntd.0001245-Mengo1"><label>17</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mengo</surname>
<given-names>DM</given-names>
</name>
<name><surname>Kariuki</surname>
<given-names>S</given-names>
</name>
<name><surname>Muigai</surname>
<given-names>A</given-names>
</name>
<name><surname>Revathi</surname>
<given-names>G</given-names>
</name>
</person-group>
<year>2010</year>
<article-title>Trends in Salmonella enteric serovar Typhi in Nairobi, Kenya from 2004 to 2006.</article-title>
<source>J Infect Dev Ctries</source>
<volume>4</volume>
<fpage>393</fpage>
<lpage>396</lpage>
<pub-id pub-id-type="pmid">20601792</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-AlSanouri1"><label>18</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Al-Sanouri</surname>
<given-names>TM</given-names>
</name>
<name><surname>Paglietti</surname>
<given-names>B</given-names>
</name>
<name><surname>Haddadin</surname>
<given-names>A</given-names>
</name>
<name><surname>Murgia</surname>
<given-names>M</given-names>
</name>
<name><surname>Bacciu</surname>
<given-names>D</given-names>
</name>
<etal></etal>
</person-group>
<year>2008</year>
<article-title>Emergence of plasmid-mediated multidrug resistance in epidemic and non-epidemic strains of Salmonella enterica serotype Typhi from Jordan.</article-title>
<source>J Infect Dev Ctries</source>
<volume>2</volume>
<fpage>295</fpage>
<lpage>301</lpage>
<pub-id pub-id-type="pmid">19741292</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Patel1"><label>19</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Patel</surname>
<given-names>TA</given-names>
</name>
<name><surname>Armstrong</surname>
<given-names>M</given-names>
</name>
<name><surname>Morris-Jones</surname>
<given-names>SD</given-names>
</name>
<name><surname>Wright</surname>
<given-names>SG</given-names>
</name>
<name><surname>Doherty</surname>
<given-names>T</given-names>
</name>
</person-group>
<year>2010</year>
<article-title>Imported enteric fever: case series from the hospital for tropical diseases, London, United Kingdom.</article-title>
<source>Am J Trop Med Hyg</source>
<volume>82</volume>
<fpage>1121</fpage>
<lpage>1126</lpage>
<pub-id pub-id-type="pmid">20519611</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Lynch1"><label>20</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lynch</surname>
<given-names>MF</given-names>
</name>
<name><surname>Blanton</surname>
<given-names>EM</given-names>
</name>
<name><surname>Bulens</surname>
<given-names>S</given-names>
</name>
<name><surname>Polyak</surname>
<given-names>C</given-names>
</name>
<name><surname>Vojdani</surname>
<given-names>J</given-names>
</name>
<etal></etal>
</person-group>
<year>2009</year>
<article-title>Typhoid fever in the United States, 1999-2006.</article-title>
<source>JAMA</source>
<volume>302</volume>
<fpage>859</fpage>
<lpage>865</lpage>
<pub-id pub-id-type="pmid">19706859</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Demczuk1"><label>21</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Demczuk</surname>
<given-names>WH</given-names>
</name>
<name><surname>Finley</surname>
<given-names>R</given-names>
</name>
<name><surname>Nadon</surname>
<given-names>C</given-names>
</name>
<name><surname>Spencer</surname>
<given-names>A</given-names>
</name>
<name><surname>Gilmour</surname>
<given-names>M</given-names>
</name>
<etal></etal>
</person-group>
<year>2010</year>
<article-title>Characterization of antimicrobial resistance, molecular and phage types of Salmonella enterica serovar Typhi isolations.</article-title>
<source>Epidemiol Infect</source>
<volume>138</volume>
<fpage>1414</fpage>
<lpage>1426</lpage>
<pub-id pub-id-type="pmid">20149265</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Kariuki1"><label>22</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kariuki</surname>
<given-names>S</given-names>
</name>
<name><surname>Revathi</surname>
<given-names>G</given-names>
</name>
<name><surname>Kiiru</surname>
<given-names>J</given-names>
</name>
<name><surname>Mengo</surname>
<given-names>DM</given-names>
</name>
<name><surname>Mwituria</surname>
<given-names>J</given-names>
</name>
<etal></etal>
</person-group>
<year>2010</year>
<article-title>Typhoid in Kenya is associated with a dominant multidrug-resistant Salmonella enterica serovar Typhi haplotype that is also widespread in Southeast Asia.</article-title>
<source>J Clin Microbiol</source>
<volume>48</volume>
<fpage>2171</fpage>
<lpage>2176</lpage>
<pub-id pub-id-type="pmid">20392916</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Parry1"><label>23</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Parry</surname>
<given-names>CM</given-names>
</name>
<name><surname>Ho</surname>
<given-names>VA</given-names>
</name>
<name><surname>Phuong le</surname>
<given-names>T</given-names>
</name>
<name><surname>Bay</surname>
<given-names>PV</given-names>
</name>
<name><surname>Lanh</surname>
<given-names>MN</given-names>
</name>
<etal></etal>
</person-group>
<year>2007</year>
<article-title>Randomized controlled comparison of ofloxacin, azithromycin, and an ofloxacin-azithromycin combination for treatment of multidrug-resistant and nalidixic acid-resistant typhoid fever.</article-title>
<source>Antimicrob Agents Chemother</source>
<volume>51</volume>
<fpage>819</fpage>
<lpage>825</lpage>
<pub-id pub-id-type="pmid">17145784</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Meltzer1"><label>24</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Meltzer</surname>
<given-names>E</given-names>
</name>
<name><surname>Schwartz</surname>
<given-names>E</given-names>
</name>
</person-group>
<year>2010</year>
<article-title>Enteric fever: a travel medicine oriented view.</article-title>
<source>Curr Opin Infect Dis</source>
<volume>23</volume>
<fpage>432</fpage>
<lpage>437</lpage>
<pub-id pub-id-type="pmid">20613510</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Taylor1"><label>25</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Taylor</surname>
<given-names>DE</given-names>
</name>
<name><surname>Chumpitaz</surname>
<given-names>JC</given-names>
</name>
<name><surname>Goldstein</surname>
<given-names>F</given-names>
</name>
</person-group>
<year>1985</year>
<article-title>Variability of IncHI1 plasmids from Salmonella typhi with special reference to Peruvian plasmids encoding resistance to trimethoprim and other antibiotics.</article-title>
<source>Antimicrob Agents Chemother</source>
<volume>28</volume>
<fpage>452</fpage>
<lpage>455</lpage>
<pub-id pub-id-type="pmid">3000289</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Fica1"><label>26</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fica</surname>
<given-names>A</given-names>
</name>
<name><surname>Fernandez-Beros</surname>
<given-names>ME</given-names>
</name>
<name><surname>Aron-Hott</surname>
<given-names>L</given-names>
</name>
<name><surname>Rivas</surname>
<given-names>A</given-names>
</name>
<name><surname>D'Ottone</surname>
<given-names>K</given-names>
</name>
<etal></etal>
</person-group>
<year>1997</year>
<article-title>Antibiotic-resistant Salmonella typhi from two outbreaks: few ribotypes and IS200 types harbor Inc HI1 plasmids.</article-title>
<source>Microb Drug Resist</source>
<volume>3</volume>
<fpage>339</fpage>
<lpage>343</lpage>
<pub-id pub-id-type="pmid">9442485</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Shanahan1"><label>27</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shanahan</surname>
<given-names>PM</given-names>
</name>
<name><surname>Jesudason</surname>
<given-names>MV</given-names>
</name>
<name><surname>Thomson</surname>
<given-names>CJ</given-names>
</name>
<name><surname>Amyes</surname>
<given-names>SG</given-names>
</name>
</person-group>
<year>1998</year>
<article-title>Molecular analysis of and identification of antibiotic resistance genes in clinical isolates of Salmonella typhi from India.</article-title>
<source>J Clin Microbiol</source>
<volume>36</volume>
<fpage>1595</fpage>
<lpage>1600</lpage>
<pub-id pub-id-type="pmid">9620383</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Shanahan2"><label>28</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shanahan</surname>
<given-names>PM</given-names>
</name>
<name><surname>Karamat</surname>
<given-names>KA</given-names>
</name>
<name><surname>Thomson</surname>
<given-names>CJ</given-names>
</name>
<name><surname>Amyes</surname>
<given-names>SG</given-names>
</name>
</person-group>
<year>2000</year>
<article-title>Characterization of multi-drug resistant Salmonella typhi isolated from Pakistan.</article-title>
<source>Epidemiol Infect</source>
<volume>124</volume>
<fpage>9</fpage>
<lpage>16</lpage>
<pub-id pub-id-type="pmid">10722124</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Wain1"><label>29</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wain</surname>
<given-names>J</given-names>
</name>
<name><surname>Diem Nga</surname>
<given-names>LT</given-names>
</name>
<name><surname>Kidgell</surname>
<given-names>C</given-names>
</name>
<name><surname>James</surname>
<given-names>K</given-names>
</name>
<name><surname>Fortune</surname>
<given-names>S</given-names>
</name>
<etal></etal>
</person-group>
<year>2003</year>
<article-title>Molecular analysis of incHI1 antimicrobial resistance plasmids from Salmonella serovar Typhi strains associated with typhoid fever.</article-title>
<source>Antimicrob Agents Chemother</source>
<volume>47</volume>
<fpage>2732</fpage>
<lpage>2739</lpage>
<pub-id pub-id-type="pmid">12936967</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Kariuki2"><label>30</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kariuki</surname>
<given-names>S</given-names>
</name>
<name><surname>Revathi</surname>
<given-names>G</given-names>
</name>
<name><surname>Muyodi</surname>
<given-names>J</given-names>
</name>
<name><surname>Mwituria</surname>
<given-names>J</given-names>
</name>
<name><surname>Munyalo</surname>
<given-names>A</given-names>
</name>
<etal></etal>
</person-group>
<year>2004</year>
<article-title>Characterization of multidrug-resistant typhoid outbreaks in Kenya.</article-title>
<source>J Clin Microbiol</source>
<volume>42</volume>
<fpage>1477</fpage>
<lpage>1482</lpage>
<pub-id pub-id-type="pmid">15070992</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Mirza1"><label>31</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mirza</surname>
<given-names>S</given-names>
</name>
<name><surname>Kariuki</surname>
<given-names>S</given-names>
</name>
<name><surname>Mamun</surname>
<given-names>KZ</given-names>
</name>
<name><surname>Beeching</surname>
<given-names>NJ</given-names>
</name>
<name><surname>Hart</surname>
<given-names>CA</given-names>
</name>
</person-group>
<year>2000</year>
<article-title>Analysis of plasmid and chromosomal DNA of multidrug-resistant Salmonella enterica serovar typhi from Asia.</article-title>
<source>J Clin Microbiol</source>
<volume>38</volume>
<fpage>1449</fpage>
<lpage>1452</lpage>
<pub-id pub-id-type="pmid">10747124</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Maher1"><label>32</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Maher</surname>
<given-names>D</given-names>
</name>
<name><surname>Taylor</surname>
<given-names>DE</given-names>
</name>
</person-group>
<year>1993</year>
<article-title>Host range and transfer efficiency of incompatibility group HI plasmids.</article-title>
<source>Can J Microbiol</source>
<volume>39</volume>
<fpage>581</fpage>
<lpage>587</lpage>
<pub-id pub-id-type="pmid">8358670</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Holt2"><label>33</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Holt</surname>
<given-names>KE</given-names>
</name>
<name><surname>Thomson</surname>
<given-names>NR</given-names>
</name>
<name><surname>Wain</surname>
<given-names>J</given-names>
</name>
<name><surname>Phan</surname>
<given-names>MD</given-names>
</name>
<name><surname>Nair</surname>
<given-names>S</given-names>
</name>
<etal></etal>
</person-group>
<year>2007</year>
<article-title>Multidrug-resistant Salmonella enterica serovar paratyphi A harbors IncHI1 plasmids similar to those found in serovar typhi.</article-title>
<source>J Bacteriol</source>
<volume>189</volume>
<fpage>4257</fpage>
<lpage>4264</lpage>
<pub-id pub-id-type="pmid">17384186</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Leopold1"><label>34</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Leopold</surname>
<given-names>SR</given-names>
</name>
<name><surname>Magrini</surname>
<given-names>V</given-names>
</name>
<name><surname>Holt</surname>
<given-names>NJ</given-names>
</name>
<name><surname>Shaikh</surname>
<given-names>N</given-names>
</name>
<name><surname>Mardis</surname>
<given-names>ER</given-names>
</name>
<etal></etal>
</person-group>
<year>2009</year>
<article-title>A precise reconstruction of the emergence and constrained radiations of Escherichia coli O157 portrayed by backbone concatenomic analysis.</article-title>
<source>Proc Natl Acad Sci U S A</source>
<volume>106</volume>
<fpage>8713</fpage>
<lpage>8718</lpage>
<pub-id pub-id-type="pmid">19439656</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Johnson1"><label>35</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Johnson</surname>
<given-names>TJ</given-names>
</name>
<name><surname>Wannemuehler</surname>
<given-names>YM</given-names>
</name>
<name><surname>Johnson</surname>
<given-names>SJ</given-names>
</name>
<name><surname>Logue</surname>
<given-names>CM</given-names>
</name>
<name><surname>White</surname>
<given-names>DG</given-names>
</name>
<etal></etal>
</person-group>
<year>2007</year>
<article-title>Plasmid replicon typing of commensal and pathogenic Escherichia coli isolates.</article-title>
<source>Appl Environ Microbiol</source>
<volume>73</volume>
<fpage>1976</fpage>
<lpage>1983</lpage>
<pub-id pub-id-type="pmid">17277222</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Johnson2"><label>36</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Johnson</surname>
<given-names>TJ</given-names>
</name>
<name><surname>Wannemuehler</surname>
<given-names>Y</given-names>
</name>
<name><surname>Johnson</surname>
<given-names>SJ</given-names>
</name>
<name><surname>Stell</surname>
<given-names>AL</given-names>
</name>
<name><surname>Doetkott</surname>
<given-names>C</given-names>
</name>
<etal></etal>
</person-group>
<year>2008</year>
<article-title>Comparison of extraintestinal pathogenic Escherichia coli strains from human and avian sources reveals a mixed subset representing potential zoonotic pathogens.</article-title>
<source>Appl Environ Microbiol</source>
<volume>74</volume>
<fpage>7043</fpage>
<lpage>7050</lpage>
<pub-id pub-id-type="pmid">18820066</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Phan1"><label>37</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Phan</surname>
<given-names>MD</given-names>
</name>
<name><surname>Kidgell</surname>
<given-names>C</given-names>
</name>
<name><surname>Nair</surname>
<given-names>S</given-names>
</name>
<name><surname>Holt</surname>
<given-names>KE</given-names>
</name>
<name><surname>Turner</surname>
<given-names>AK</given-names>
</name>
<etal></etal>
</person-group>
<year>2009</year>
<article-title>Variation in Salmonella enterica serovar typhi IncHI1 plasmids during the global spread of resistant typhoid fever.</article-title>
<source>Antimicrob Agents Chemother</source>
<volume>53</volume>
<fpage>716</fpage>
<lpage>727</lpage>
<pub-id pub-id-type="pmid">19015365</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Baker1"><label>38</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Baker</surname>
<given-names>S</given-names>
</name>
<name><surname>Holt</surname>
<given-names>K</given-names>
</name>
<name><surname>van de Vosse</surname>
<given-names>E</given-names>
</name>
<name><surname>Roumagnac</surname>
<given-names>P</given-names>
</name>
<name><surname>Whitehead</surname>
<given-names>S</given-names>
</name>
<etal></etal>
</person-group>
<year>2008</year>
<article-title>High-throughput genotyping of Salmonella enterica serovar Typhi allowing geographical assignment of haplotypes and pathotypes within an urban District of Jakarta, Indonesia.</article-title>
<source>J Clin Microbiol</source>
<volume>46</volume>
<fpage>1741</fpage>
<lpage>1746</lpage>
<pub-id pub-id-type="pmid">18322069</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Holt3"><label>39</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Holt</surname>
<given-names>KE</given-names>
</name>
<name><surname>Baker</surname>
<given-names>S</given-names>
</name>
<name><surname>Dongol</surname>
<given-names>S</given-names>
</name>
<name><surname>Basnyat</surname>
<given-names>B</given-names>
</name>
<name><surname>Adhikari</surname>
<given-names>N</given-names>
</name>
<etal></etal>
</person-group>
<year>2010</year>
<article-title>High-throughput bacterial SNP typing identifies distinct clusters of Salmonella Typhi causing typhoid in Nepalese children.</article-title>
<source>BMC Infect Dis</source>
<volume>10</volume>
<fpage>144</fpage>
<pub-id pub-id-type="pmid">20509974</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Octavia1"><label>40</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Octavia</surname>
<given-names>S</given-names>
</name>
<name><surname>Lan</surname>
<given-names>R</given-names>
</name>
</person-group>
<year>2007</year>
<article-title>Single-nucleotide-polymorphism typing and genetic relationships of Salmonella enterica serovar Typhi isolates.</article-title>
<source>J Clin Microbiol</source>
<volume>45</volume>
<fpage>3795</fpage>
<lpage>3801</lpage>
<pub-id pub-id-type="pmid">17728466</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Roumagnac1"><label>41</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Roumagnac</surname>
<given-names>P</given-names>
</name>
<name><surname>Weill</surname>
<given-names>FX</given-names>
</name>
<name><surname>Dolecek</surname>
<given-names>C</given-names>
</name>
<name><surname>Baker</surname>
<given-names>S</given-names>
</name>
<name><surname>Brisse</surname>
<given-names>S</given-names>
</name>
<etal></etal>
</person-group>
<year>2006</year>
<article-title>Evolutionary history of Salmonella typhi.</article-title>
<source>Science</source>
<volume>314</volume>
<fpage>1301</fpage>
<lpage>1304</lpage>
<pub-id pub-id-type="pmid">17124322</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Tacket1"><label>42</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tacket</surname>
<given-names>CO</given-names>
</name>
<name><surname>Sztein</surname>
<given-names>MB</given-names>
</name>
<name><surname>Losonsky</surname>
<given-names>GA</given-names>
</name>
<name><surname>Wasserman</surname>
<given-names>SS</given-names>
</name>
<name><surname>Nataro</surname>
<given-names>JP</given-names>
</name>
<etal></etal>
</person-group>
<year>1997</year>
<article-title>Safety of live oral Salmonella typhi vaccine strains with deletions in htrA and aroC aroD and immune response in humans.</article-title>
<source>Infect Immun</source>
<volume>65</volume>
<fpage>452</fpage>
<lpage>456</lpage>
<pub-id pub-id-type="pmid">9009296</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Kurtz1"><label>43</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kurtz</surname>
<given-names>S</given-names>
</name>
<name><surname>Phillippy</surname>
<given-names>A</given-names>
</name>
<name><surname>Delcher</surname>
<given-names>AL</given-names>
</name>
<name><surname>Smoot</surname>
<given-names>M</given-names>
</name>
<name><surname>Shumway</surname>
<given-names>M</given-names>
</name>
<etal></etal>
</person-group>
<year>2004</year>
<article-title>Versatile and open software for comparing large genomes.</article-title>
<source>Genome Biol</source>
<volume>5</volume>
<fpage>R12</fpage>
<pub-id pub-id-type="pmid">14759262</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Li1"><label>44</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname>
<given-names>H</given-names>
</name>
<name><surname>Ruan</surname>
<given-names>J</given-names>
</name>
<name><surname>Durbin</surname>
<given-names>R</given-names>
</name>
</person-group>
<year>2008</year>
<article-title>Mapping short DNA sequencing reads and calling variants using mapping quality scores.</article-title>
<source>Genome Res</source>
<volume>18</volume>
<fpage>1851</fpage>
<lpage>1858</lpage>
<pub-id pub-id-type="pmid">18714091</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Holt4"><label>45</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Holt</surname>
<given-names>KE</given-names>
</name>
<name><surname>Parkhill</surname>
<given-names>J</given-names>
</name>
<name><surname>Mazzoni</surname>
<given-names>CJ</given-names>
</name>
<name><surname>Roumagnac</surname>
<given-names>P</given-names>
</name>
<name><surname>Weill</surname>
<given-names>FX</given-names>
</name>
<etal></etal>
</person-group>
<year>2008</year>
<article-title>High-throughput sequencing provides insights into genome variation and evolution in Salmonella Typhi.</article-title>
<source>Nat Genet</source>
<volume>40</volume>
<fpage>987</fpage>
<lpage>993</lpage>
<pub-id pub-id-type="pmid">18660809</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Drummond1"><label>46</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Drummond</surname>
<given-names>AJ</given-names>
</name>
<name><surname>Rambaut</surname>
<given-names>A</given-names>
</name>
</person-group>
<year>2007</year>
<article-title>BEAST: Bayesian evolutionary analysis by sampling trees.</article-title>
<source>BMC Evol Biol</source>
<volume>7</volume>
<fpage>214</fpage>
<pub-id pub-id-type="pmid">17996036</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Drummond2"><label>47</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Drummond</surname>
<given-names>AJ</given-names>
</name>
<name><surname>Rambaut</surname>
<given-names>A</given-names>
</name>
<name><surname>Shapiro</surname>
<given-names>B</given-names>
</name>
<name><surname>Pybus</surname>
<given-names>OG</given-names>
</name>
</person-group>
<year>2005</year>
<article-title>Bayesian coalescent inference of past population dynamics from molecular sequences.</article-title>
<source>Mol Biol Evol</source>
<volume>22</volume>
<fpage>1185</fpage>
<lpage>1192</lpage>
<pub-id pub-id-type="pmid">15703244</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Teo1"><label>48</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Teo</surname>
<given-names>YY</given-names>
</name>
<name><surname>Inouye</surname>
<given-names>M</given-names>
</name>
<name><surname>Small</surname>
<given-names>KS</given-names>
</name>
<name><surname>Gwilliam</surname>
<given-names>R</given-names>
</name>
<name><surname>Deloukas</surname>
<given-names>P</given-names>
</name>
<etal></etal>
</person-group>
<year>2007</year>
<article-title>A genotype calling algorithm for the Illumina BeadArray platform.</article-title>
<source>Bioinformatics</source>
<volume>23</volume>
<fpage>2741</fpage>
<lpage>2746</lpage>
<pub-id pub-id-type="pmid">17846035</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Stamatakis1"><label>49</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Stamatakis</surname>
<given-names>A</given-names>
</name>
<name><surname>Ludwig</surname>
<given-names>T</given-names>
</name>
<name><surname>Meier</surname>
<given-names>H</given-names>
</name>
</person-group>
<year>2005</year>
<article-title>RAxML-III: a fast program for maximum likelihood-based inference of large phylogenetic trees.</article-title>
<source>Bioinformatics</source>
<volume>21</volume>
<fpage>456</fpage>
<lpage>463</lpage>
<pub-id pub-id-type="pmid">15608047</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Rozen1"><label>50</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rozen</surname>
<given-names>S</given-names>
</name>
<name><surname>Skaletsky</surname>
<given-names>H</given-names>
</name>
</person-group>
<year>2000</year>
<article-title>Primer3 on the WWW for general users and for biologist programmers.</article-title>
<source>Methods Mol Biol</source>
<volume>132</volume>
<fpage>365</fpage>
<lpage>386</lpage>
<pub-id pub-id-type="pmid">10547847</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Bochner1"><label>51</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bochner</surname>
<given-names>BR</given-names>
</name>
<name><surname>Gadzinski</surname>
<given-names>P</given-names>
</name>
<name><surname>Panomitros</surname>
<given-names>E</given-names>
</name>
</person-group>
<year>2001</year>
<article-title>Phenotype microarrays for high-throughput phenotypic testing and assay of gene function.</article-title>
<source>Genome Res</source>
<volume>11</volume>
<fpage>1246</fpage>
<lpage>1255</lpage>
<pub-id pub-id-type="pmid">11435407</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Taylor2"><label>52</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Taylor</surname>
<given-names>DE</given-names>
</name>
<name><surname>Newnham</surname>
<given-names>PJ</given-names>
</name>
<name><surname>Sherburne</surname>
<given-names>C</given-names>
</name>
<name><surname>Lawley</surname>
<given-names>TD</given-names>
</name>
<name><surname>Rooker</surname>
<given-names>MM</given-names>
</name>
</person-group>
<year>1999</year>
<article-title>Sequencing and characterization of Salmonella typhi plasmid R27 (incompatibility group HI1) trhC, a transfer gene encoding a potential nucleoside triphosphate-binding domain.</article-title>
<source>Plasmid</source>
<volume>41</volume>
<fpage>207</fpage>
<lpage>218</lpage>
<pub-id pub-id-type="pmid">10366526</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Drummond3"><label>53</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Drummond</surname>
<given-names>AJ</given-names>
</name>
<name><surname>Ho</surname>
<given-names>SY</given-names>
</name>
<name><surname>Phillips</surname>
<given-names>MJ</given-names>
</name>
<name><surname>Rambaut</surname>
<given-names>A</given-names>
</name>
</person-group>
<year>2006</year>
<article-title>Relaxed phylogenetics and dating with confidence.</article-title>
<source>PLoS Biol</source>
<volume>4</volume>
<fpage>e88</fpage>
<pub-id pub-id-type="pmid">16683862</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Parkhill1"><label>54</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Parkhill</surname>
<given-names>J</given-names>
</name>
<name><surname>Dougan</surname>
<given-names>G</given-names>
</name>
<name><surname>James</surname>
<given-names>KD</given-names>
</name>
<name><surname>Thomson</surname>
<given-names>NR</given-names>
</name>
<name><surname>Pickard</surname>
<given-names>D</given-names>
</name>
<etal></etal>
</person-group>
<year>2001</year>
<article-title>Complete genome sequence of a multiple drug resistant Salmonella enterica serovar Typhi CT18.</article-title>
<source>Nature</source>
<volume>413</volume>
<fpage>848</fpage>
<lpage>852</lpage>
<pub-id pub-id-type="pmid">11677608</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Goldstein1"><label>55</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Goldstein</surname>
<given-names>FW</given-names>
</name>
<name><surname>Chumpitaz</surname>
<given-names>JC</given-names>
</name>
<name><surname>Guevara</surname>
<given-names>JM</given-names>
</name>
<name><surname>Papadopoulou</surname>
<given-names>B</given-names>
</name>
<name><surname>Acar</surname>
<given-names>JF</given-names>
</name>
<etal></etal>
</person-group>
<year>1986</year>
<article-title>Plasmid-mediated resistance to multiple antibiotics in Salmonella typhi.</article-title>
<source>J Infect Dis</source>
<volume>153</volume>
<fpage>261</fpage>
<lpage>266</lpage>
<pub-id pub-id-type="pmid">3944481</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Edsall1"><label>56</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Edsall</surname>
<given-names>G</given-names>
</name>
<name><surname>Gaines</surname>
<given-names>S</given-names>
</name>
<name><surname>Landy</surname>
<given-names>M</given-names>
</name>
<name><surname>Tigertt</surname>
<given-names>WD</given-names>
</name>
<name><surname>Sprinz</surname>
<given-names>H</given-names>
</name>
<etal></etal>
</person-group>
<year>1960</year>
<article-title>Studies on infection and immunity in experimental typhoid fever. I. Typhoid fever in chimpanzees orally infected with Salmonella typhosa.</article-title>
<source>J Exp Med</source>
<volume>112</volume>
<fpage>143</fpage>
<lpage>166</lpage>
<pub-id pub-id-type="pmid">13725751</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Khatri1"><label>57</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Khatri</surname>
<given-names>NS</given-names>
</name>
<name><surname>Maskey</surname>
<given-names>P</given-names>
</name>
<name><surname>Poudel</surname>
<given-names>S</given-names>
</name>
<name><surname>Jaiswal</surname>
<given-names>VK</given-names>
</name>
<name><surname>Karkey</surname>
<given-names>A</given-names>
</name>
<etal></etal>
</person-group>
<year>2009</year>
<article-title>Gallbladder carriage of Salmonella paratyphi A may be an important factor in the increasing incidence of this infection in South Asia.</article-title>
<source>Ann Intern Med</source>
<volume>150</volume>
<fpage>567</fpage>
<lpage>568</lpage>
<pub-id pub-id-type="pmid">19380862</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Levine1"><label>58</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Levine</surname>
<given-names>MM</given-names>
</name>
<name><surname>Black</surname>
<given-names>RE</given-names>
</name>
<name><surname>Lanata</surname>
<given-names>C</given-names>
</name>
</person-group>
<year>1982</year>
<article-title>Precise estimation of the numbers of chronic carriers of Salmonella typhi in Santiago, Chile, an endemic area.</article-title>
<source>J Infect Dis</source>
<volume>146</volume>
<fpage>724</fpage>
<lpage>726</lpage>
<pub-id pub-id-type="pmid">7142746</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Lanata1"><label>59</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lanata</surname>
<given-names>CF</given-names>
</name>
<name><surname>Levine</surname>
<given-names>MM</given-names>
</name>
<name><surname>Ristori</surname>
<given-names>C</given-names>
</name>
<name><surname>Black</surname>
<given-names>RE</given-names>
</name>
<name><surname>Jimenez</surname>
<given-names>L</given-names>
</name>
<etal></etal>
</person-group>
<year>1983</year>
<article-title>Vi serology in detection of chronic Salmonella typhi carriers in an endemic area.</article-title>
<source>Lancet</source>
<volume>2</volume>
<fpage>441</fpage>
<lpage>443</lpage>
<pub-id pub-id-type="pmid">6192305</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Ferreccio1"><label>60</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ferreccio</surname>
<given-names>C</given-names>
</name>
<name><surname>Levine</surname>
<given-names>M</given-names>
</name>
<name><surname>Astroza</surname>
<given-names>L</given-names>
</name>
<name><surname>Berrios</surname>
<given-names>G</given-names>
</name>
<name><surname>Solari</surname>
<given-names>V</given-names>
</name>
<etal></etal>
</person-group>
<year>1990</year>
<article-title>[The detection of chronic Salmonella typhi carriers: a practical method applied to food handlers].</article-title>
<source>Rev Med Chil</source>
<volume>118</volume>
<fpage>33</fpage>
<lpage>37</lpage>
<pub-id pub-id-type="pmid">2152699</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Culham1"><label>61</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Culham</surname>
<given-names>DE</given-names>
</name>
<name><surname>Lu</surname>
<given-names>A</given-names>
</name>
<name><surname>Jishage</surname>
<given-names>M</given-names>
</name>
<name><surname>Krogfelt</surname>
<given-names>KA</given-names>
</name>
<name><surname>Ishihama</surname>
<given-names>A</given-names>
</name>
<etal></etal>
</person-group>
<year>2001</year>
<article-title>The osmotic stress response and virulence in pyelonephritis isolates of Escherichia coli: contributions of RpoS, ProP, ProU and other systems.</article-title>
<source>Microbiology</source>
<volume>147</volume>
<fpage>1657</fpage>
<lpage>1670</lpage>
<pub-id pub-id-type="pmid">11390697</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Ly1"><label>62</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ly</surname>
<given-names>A</given-names>
</name>
<name><surname>Henderson</surname>
<given-names>J</given-names>
</name>
<name><surname>Lu</surname>
<given-names>A</given-names>
</name>
<name><surname>Culham</surname>
<given-names>DE</given-names>
</name>
<name><surname>Wood</surname>
<given-names>JM</given-names>
</name>
</person-group>
<year>2004</year>
<article-title>Osmoregulatory systems of Escherichia coli: identification of betaine-carnitine-choline transporter family member BetU and distributions of betU and trkG among pathogenic and nonpathogenic isolates.</article-title>
<source>J Bacteriol</source>
<volume>186</volume>
<fpage>296</fpage>
<lpage>306</lpage>
<pub-id pub-id-type="pmid">14702297</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Weill1"><label>63</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Weill</surname>
<given-names>FX</given-names>
</name>
<name><surname>Tran</surname>
<given-names>HH</given-names>
</name>
<name><surname>Roumagnac</surname>
<given-names>P</given-names>
</name>
<name><surname>Fabre</surname>
<given-names>L</given-names>
</name>
<name><surname>Minh</surname>
<given-names>NB</given-names>
</name>
<etal></etal>
</person-group>
<year>2007</year>
<article-title>Clonal reconquest of antibiotic-susceptible Salmonella enterica serotype Typhi in Son La Province, Vietnam.</article-title>
<source>Am J Trop Med Hyg</source>
<volume>76</volume>
<fpage>1174</fpage>
<lpage>1181</lpage>
<pub-id pub-id-type="pmid">17556632</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Le1"><label>64</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Le</surname>
<given-names>TA</given-names>
</name>
<name><surname>Fabre</surname>
<given-names>L</given-names>
</name>
<name><surname>Roumagnac</surname>
<given-names>P</given-names>
</name>
<name><surname>Grimont</surname>
<given-names>PA</given-names>
</name>
<name><surname>Scavizzi</surname>
<given-names>MR</given-names>
</name>
<etal></etal>
</person-group>
<year>2007</year>
<article-title>Clonal expansion and microevolution of quinolone-resistant Salmonella enterica serotype typhi in Vietnam from 1996 to 2004.</article-title>
<source>J Clin Microbiol</source>
<volume>45</volume>
<fpage>3485</fpage>
<lpage>3492</lpage>
<pub-id pub-id-type="pmid">17728470</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Taylor3"><label>65</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Taylor</surname>
<given-names>DE</given-names>
</name>
<name><surname>Brose</surname>
<given-names>EC</given-names>
</name>
<name><surname>Kwan</surname>
<given-names>S</given-names>
</name>
<name><surname>Yan</surname>
<given-names>W</given-names>
</name>
</person-group>
<year>1985</year>
<article-title>Mapping of transfer regions within incompatibility group HI plasmid R27.</article-title>
<source>J Bacteriol</source>
<volume>162</volume>
<fpage>1221</fpage>
<lpage>1226</lpage>
<pub-id pub-id-type="pmid">2987187</pub-id>
</element-citation>
</ref>
<ref id="pntd.0001245-Ogura1"><label>66</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ogura</surname>
<given-names>Y</given-names>
</name>
<name><surname>Ooka</surname>
<given-names>T</given-names>
</name>
<name><surname>Iguchi</surname>
<given-names>A</given-names>
</name>
<name><surname>Toh</surname>
<given-names>H</given-names>
</name>
<name><surname>Asadulghani</surname>
<given-names>M</given-names>
</name>
<etal></etal>
</person-group>
<year>2009</year>
<article-title>Comparative genomics reveal the mechanism of the parallel evolution of O157 and non-O157 enterohemorrhagic Escherichia coli.</article-title>
<source>Proc Natl Acad Sci U S A</source>
<volume>106</volume>
<fpage>17939</fpage>
<lpage>17944</lpage>
<pub-id pub-id-type="pmid">19815525</pub-id>
</element-citation>
</ref>
</ref-list>
</back>
</pmc>
</record>
Pour manipuler ce document sous Unix (Dilib)
EXPLOR_STEP=$WICRI_ROOT/Wicri/Asie/explor/AustralieFrV1/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 0029280 | SxmlIndent | more
Ou
HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 0029280 | SxmlIndent | more
Pour mettre un lien sur cette page dans le réseau Wicri
{{Explor lien |wiki= Wicri/Asie |area= AustralieFrV1 |flux= Pmc |étape= Corpus |type= RBID |clé= |texte= }}
![]() | This area was generated with Dilib version V0.6.33. | ![]() |