Serveur d'exploration sur les relations entre la France et l'Australie

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.
***** Acces problem to record *****\

Identifieur interne : 0027769 ( Pmc/Corpus ); précédent : 0027768; suivant : 0027770 ***** probable Xml problem with record *****

Links to Exploration step


Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Pediatric cataract, myopic astigmatism, familial exudative vitreoretinopathy and primary open-angle glaucoma co-segregating in a family</title>
<author>
<name sortKey="Mackey, D A" sort="Mackey, D A" uniqKey="Mackey D" first="D. A." last="Mackey">D. A. Mackey</name>
<affiliation>
<nlm:aff id="aff1">Centre for Ophthalmology and Visual Science, University of Western Australia, Lions Eye Institute, Perth, Australia</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff2">Centre for Eye Research Australia, University of Melbourne, Department of Ophthalmology, Royal Victorian Eye and Ear Hospital, Melbourne, Australia</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff4">Eye Department, University of Tasmania, Royal Hobart Hospital, Hobart, Australia</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Hewitt, A W" sort="Hewitt, A W" uniqKey="Hewitt A" first="A. W." last="Hewitt">A. W. Hewitt</name>
<affiliation>
<nlm:aff id="aff2">Centre for Eye Research Australia, University of Melbourne, Department of Ophthalmology, Royal Victorian Eye and Ear Hospital, Melbourne, Australia</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Ruddle, J B" sort="Ruddle, J B" uniqKey="Ruddle J" first="J. B." last="Ruddle">J. B. Ruddle</name>
<affiliation>
<nlm:aff id="aff2">Centre for Eye Research Australia, University of Melbourne, Department of Ophthalmology, Royal Victorian Eye and Ear Hospital, Melbourne, Australia</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Vote, B" sort="Vote, B" uniqKey="Vote B" first="B." last="Vote">B. Vote</name>
<affiliation>
<nlm:aff id="aff5">The Launceston Eye Institute, Launceston, Australia</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Buttery, R G" sort="Buttery, R G" uniqKey="Buttery R" first="R. G." last="Buttery">R. G. Buttery</name>
<affiliation>
<nlm:aff id="aff3">Vitreoretinal Unit, Royal Victorian Eye and Ear Hospital, Melbourne, Australia</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Toomes, C" sort="Toomes, C" uniqKey="Toomes C" first="C." last="Toomes">C. Toomes</name>
<affiliation>
<nlm:aff id="aff6">Section of Ophthalmology and Neuroscience, Leeds Institute of Molecular Medicine, University of Leeds, Leeds, UK</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Metlapally, R" sort="Metlapally, R" uniqKey="Metlapally R" first="R." last="Metlapally">R. Metlapally</name>
<affiliation>
<nlm:aff id="aff7">Department of Ophthalmology, Duke University Eye Center, Durham, NC</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff8">School of Optometry, University of California at Berkeley, Berkeley, CA</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Li, Y J" sort="Li, Y J" uniqKey="Li Y" first="Y. J." last="Li">Y. J. Li</name>
<affiliation>
<nlm:aff id="aff9">Department of Biostatistics and Bioinformatics, Duke University Medical Center, Durham, NC</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff10">Center for Human Genetics, Duke University Medical Center, Durham, NC</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Tran Viet, K N" sort="Tran Viet, K N" uniqKey="Tran Viet K" first="K. N." last="Tran-Viet">K. N. Tran-Viet</name>
<affiliation>
<nlm:aff id="aff10">Center for Human Genetics, Duke University Medical Center, Durham, NC</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Malecaze, F" sort="Malecaze, F" uniqKey="Malecaze F" first="F." last="Malecaze">F. Malecaze</name>
<affiliation>
<nlm:aff id="aff11">Toulouse University Hospital, Université Paul Sabatier, Toulouse, France</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Calvas, P" sort="Calvas, P" uniqKey="Calvas P" first="P." last="Calvas">P. Calvas</name>
<affiliation>
<nlm:aff id="aff11">Toulouse University Hospital, Université Paul Sabatier, Toulouse, France</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Rosenberg, T" sort="Rosenberg, T" uniqKey="Rosenberg T" first="T." last="Rosenberg">T. Rosenberg</name>
<affiliation>
<nlm:aff id="aff12">Kennedy Center, Glostrup, Denmark</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Guggenheim, J A" sort="Guggenheim, J A" uniqKey="Guggenheim J" first="J. A." last="Guggenheim">J. A. Guggenheim</name>
<affiliation>
<nlm:aff id="aff13">School of Optometry and Vision Sciences, Cardiff University, Cardiff, Wales, United Kingdom</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Young, T L" sort="Young, T L" uniqKey="Young T" first="T. L." last="Young">T. L. Young</name>
<affiliation>
<nlm:aff id="aff7">Department of Ophthalmology, Duke University Eye Center, Durham, NC</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff10">Center for Human Genetics, Duke University Medical Center, Durham, NC</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">21850187</idno>
<idno type="pmc">3156798</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3156798</idno>
<idno type="RBID">PMC:3156798</idno>
<date when="2011">2011</date>
<idno type="wicri:Area/Pmc/Corpus">002776</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">002776</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Pediatric cataract, myopic astigmatism, familial exudative vitreoretinopathy and primary open-angle glaucoma co-segregating in a family</title>
<author>
<name sortKey="Mackey, D A" sort="Mackey, D A" uniqKey="Mackey D" first="D. A." last="Mackey">D. A. Mackey</name>
<affiliation>
<nlm:aff id="aff1">Centre for Ophthalmology and Visual Science, University of Western Australia, Lions Eye Institute, Perth, Australia</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff2">Centre for Eye Research Australia, University of Melbourne, Department of Ophthalmology, Royal Victorian Eye and Ear Hospital, Melbourne, Australia</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff4">Eye Department, University of Tasmania, Royal Hobart Hospital, Hobart, Australia</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Hewitt, A W" sort="Hewitt, A W" uniqKey="Hewitt A" first="A. W." last="Hewitt">A. W. Hewitt</name>
<affiliation>
<nlm:aff id="aff2">Centre for Eye Research Australia, University of Melbourne, Department of Ophthalmology, Royal Victorian Eye and Ear Hospital, Melbourne, Australia</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Ruddle, J B" sort="Ruddle, J B" uniqKey="Ruddle J" first="J. B." last="Ruddle">J. B. Ruddle</name>
<affiliation>
<nlm:aff id="aff2">Centre for Eye Research Australia, University of Melbourne, Department of Ophthalmology, Royal Victorian Eye and Ear Hospital, Melbourne, Australia</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Vote, B" sort="Vote, B" uniqKey="Vote B" first="B." last="Vote">B. Vote</name>
<affiliation>
<nlm:aff id="aff5">The Launceston Eye Institute, Launceston, Australia</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Buttery, R G" sort="Buttery, R G" uniqKey="Buttery R" first="R. G." last="Buttery">R. G. Buttery</name>
<affiliation>
<nlm:aff id="aff3">Vitreoretinal Unit, Royal Victorian Eye and Ear Hospital, Melbourne, Australia</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Toomes, C" sort="Toomes, C" uniqKey="Toomes C" first="C." last="Toomes">C. Toomes</name>
<affiliation>
<nlm:aff id="aff6">Section of Ophthalmology and Neuroscience, Leeds Institute of Molecular Medicine, University of Leeds, Leeds, UK</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Metlapally, R" sort="Metlapally, R" uniqKey="Metlapally R" first="R." last="Metlapally">R. Metlapally</name>
<affiliation>
<nlm:aff id="aff7">Department of Ophthalmology, Duke University Eye Center, Durham, NC</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff8">School of Optometry, University of California at Berkeley, Berkeley, CA</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Li, Y J" sort="Li, Y J" uniqKey="Li Y" first="Y. J." last="Li">Y. J. Li</name>
<affiliation>
<nlm:aff id="aff9">Department of Biostatistics and Bioinformatics, Duke University Medical Center, Durham, NC</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff10">Center for Human Genetics, Duke University Medical Center, Durham, NC</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Tran Viet, K N" sort="Tran Viet, K N" uniqKey="Tran Viet K" first="K. N." last="Tran-Viet">K. N. Tran-Viet</name>
<affiliation>
<nlm:aff id="aff10">Center for Human Genetics, Duke University Medical Center, Durham, NC</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Malecaze, F" sort="Malecaze, F" uniqKey="Malecaze F" first="F." last="Malecaze">F. Malecaze</name>
<affiliation>
<nlm:aff id="aff11">Toulouse University Hospital, Université Paul Sabatier, Toulouse, France</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Calvas, P" sort="Calvas, P" uniqKey="Calvas P" first="P." last="Calvas">P. Calvas</name>
<affiliation>
<nlm:aff id="aff11">Toulouse University Hospital, Université Paul Sabatier, Toulouse, France</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Rosenberg, T" sort="Rosenberg, T" uniqKey="Rosenberg T" first="T." last="Rosenberg">T. Rosenberg</name>
<affiliation>
<nlm:aff id="aff12">Kennedy Center, Glostrup, Denmark</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Guggenheim, J A" sort="Guggenheim, J A" uniqKey="Guggenheim J" first="J. A." last="Guggenheim">J. A. Guggenheim</name>
<affiliation>
<nlm:aff id="aff13">School of Optometry and Vision Sciences, Cardiff University, Cardiff, Wales, United Kingdom</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Young, T L" sort="Young, T L" uniqKey="Young T" first="T. L." last="Young">T. L. Young</name>
<affiliation>
<nlm:aff id="aff7">Department of Ophthalmology, Duke University Eye Center, Durham, NC</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff10">Center for Human Genetics, Duke University Medical Center, Durham, NC</nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">Molecular Vision</title>
<idno type="eISSN">1090-0535</idno>
<imprint>
<date when="2011">2011</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<sec>
<title>Purpose</title>
<p>To describe an Australian pedigree of European descent with a variable autosomal dominant phenotype of: pediatric cortical cataract (CC), asymmetric myopia with astigmatism, familial exudative vitreoretinopathy (FEVR), and primary open-angle glaucoma (POAG).</p>
</sec>
<sec>
<title>Methods</title>
<p>Probands with CC, FEVR, and POAG were enrolled in three independent genetic eye studies in Tasmania. Genealogy confirmed these individuals were closely related and subsequent examination revealed 11 other family members with some or all of the associated disorders.</p>
</sec>
<sec>
<title>Results</title>
<p>Twelve individuals had CC thought to be of childhood onset, with one child demonstrating progressive lenticular opacification. One individual had severe retinal detachment while five others had dragged retinal vessels. Seven individuals had POAG. Seven individuals had myopia in at least one eye ≤-3 Diopters. DNA testing excluded mutations in myocilin, trabecular meshwork inducible glucocorticoid response (
<italic>MYOC</italic>
) and tetraspanin 12 (
<italic>TSPAN12</italic>
). Haplotype analysis excluded frizzled family receptor 4 (
<italic>FZD4</italic>
) and low density lipoprotein receptor-related protein 5 (
<italic>LRP5</italic>
), but only partly excluded
<italic>EVR3</italic>
. Multipoint linkage analysis revealed multiple chromosomal single-nucleotide polymorphisms (SNPs) of interest, but no statistically significant focal localization.</p>
</sec>
<sec>
<title>Conclusions</title>
<p>This unusual clustering of ophthalmic diseases suggests a possible single genetic cause for an apparently new cataract syndrome. This family’s clinical ocular features may reflect the interplay between retinal disease with lenticular changes and axial length in the development of myopia and glaucoma.</p>
</sec>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Attebo, K" uniqKey="Attebo K">K Attebo</name>
</author>
<author>
<name sortKey="Ivers, R" uniqKey="Ivers R">R Ivers</name>
</author>
<author>
<name sortKey="Mitchell, P" uniqKey="Mitchell P">P Mitchell</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mitchell, P" uniqKey="Mitchell P">P Mitchell</name>
</author>
<author>
<name sortKey="Smith, W" uniqKey="Smith W">W Smith</name>
</author>
<author>
<name sortKey="Attebo, K" uniqKey="Attebo K">K Attebo</name>
</author>
<author>
<name sortKey="Healey, P" uniqKey="Healey P">P Healey</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wirth, Mg" uniqKey="Wirth M">MG Wirth</name>
</author>
<author>
<name sortKey="Russell Eggitt, I" uniqKey="Russell Eggitt I">I Russell-Eggitt</name>
</author>
<author>
<name sortKey="Craig, J" uniqKey="Craig J">J Craig</name>
</author>
<author>
<name sortKey="Elder, J" uniqKey="Elder J">J Elder</name>
</author>
<author>
<name sortKey="Mackey, D" uniqKey="Mackey D">D Mackey</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dickinson, J" uniqKey="Dickinson J">J Dickinson</name>
</author>
<author>
<name sortKey="Sale, M" uniqKey="Sale M">M Sale</name>
</author>
<author>
<name sortKey="Passmore, A" uniqKey="Passmore A">A Passmore</name>
</author>
<author>
<name sortKey="Fitzgerald, L" uniqKey="Fitzgerald L">L FitzGerald</name>
</author>
<author>
<name sortKey="Wheatley, C" uniqKey="Wheatley C">C Wheatley</name>
</author>
<author>
<name sortKey="Burdon, K" uniqKey="Burdon K">K Burdon</name>
</author>
<author>
<name sortKey="Craig, J" uniqKey="Craig J">J Craig</name>
</author>
<author>
<name sortKey="Tengtrisorn, S" uniqKey="Tengtrisorn S">S Tengtrisorn</name>
</author>
<author>
<name sortKey="Carden, S" uniqKey="Carden S">S Carden</name>
</author>
<author>
<name sortKey="Maclean, H" uniqKey="Maclean H">H Maclean</name>
</author>
<author>
<name sortKey="Mackey, D" uniqKey="Mackey D">D Mackey</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Young, Tl" uniqKey="Young T">TL Young</name>
</author>
<author>
<name sortKey="Metlapally, R" uniqKey="Metlapally R">R Metlapally</name>
</author>
<author>
<name sortKey="Shay, A" uniqKey="Shay A">A Shay</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mackey, Da" uniqKey="Mackey D">DA Mackey</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Seery, Cm" uniqKey="Seery C">CM Seery</name>
</author>
<author>
<name sortKey="Pruett, R" uniqKey="Pruett R">R Pruett</name>
</author>
<author>
<name sortKey="Liberfarb, R" uniqKey="Liberfarb R">R Liberfarb</name>
</author>
<author>
<name sortKey="Cohen, B" uniqKey="Cohen B">B Cohen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tasman, W" uniqKey="Tasman W">W Tasman</name>
</author>
<author>
<name sortKey="Patz, A" uniqKey="Patz A">A Patz</name>
</author>
<author>
<name sortKey="Mcnamara, J" uniqKey="Mcnamara J">J McNamara</name>
</author>
<author>
<name sortKey="Kaiser, R" uniqKey="Kaiser R">R Kaiser</name>
</author>
<author>
<name sortKey="Trese, M" uniqKey="Trese M">M Trese</name>
</author>
<author>
<name sortKey="Smith, B" uniqKey="Smith B">B Smith</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hartong, Dt" uniqKey="Hartong D">DT Hartong</name>
</author>
<author>
<name sortKey="Berson, E" uniqKey="Berson E">E Berson</name>
</author>
<author>
<name sortKey="Dryja, T" uniqKey="Dryja T">T Dryja</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sack, J" uniqKey="Sack J">J Sack</name>
</author>
<author>
<name sortKey="Healey, Dl" uniqKey="Healey D">DL Healey</name>
</author>
<author>
<name sortKey="De Graaf, Ap" uniqKey="De Graaf A">AP de Graaf</name>
</author>
<author>
<name sortKey="Wilkinson, Rm" uniqKey="Wilkinson R">RM Wilkinson</name>
</author>
<author>
<name sortKey="Wilkinson, Ch" uniqKey="Wilkinson C">CH Wilkinson</name>
</author>
<author>
<name sortKey="Barbour, Jm" uniqKey="Barbour J">JM Barbour</name>
</author>
<author>
<name sortKey="Coote, Ma" uniqKey="Coote M">MA Coote</name>
</author>
<author>
<name sortKey="Mccartney, Pj" uniqKey="Mccartney P">PJ McCartney</name>
</author>
<author>
<name sortKey="Rait, Jl" uniqKey="Rait J">JL Rait</name>
</author>
<author>
<name sortKey="Cooper, Rl" uniqKey="Cooper R">RL Cooper</name>
</author>
<author>
<name sortKey="Ring, Ma" uniqKey="Ring M">MA Ring</name>
</author>
<author>
<name sortKey="Mackey, Da" uniqKey="Mackey D">DA Mackey</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mackey, Da" uniqKey="Mackey D">DA Mackey</name>
</author>
<author>
<name sortKey="Healey, Dl" uniqKey="Healey D">DL Healey</name>
</author>
<author>
<name sortKey="Fingert, Jh" uniqKey="Fingert J">JH Fingert</name>
</author>
<author>
<name sortKey="Coote, Ma" uniqKey="Coote M">MA Coote</name>
</author>
<author>
<name sortKey="Wong, Tl" uniqKey="Wong T">TL Wong</name>
</author>
<author>
<name sortKey="Wilkinson, Ch" uniqKey="Wilkinson C">CH Wilkinson</name>
</author>
<author>
<name sortKey="Mccartney, Pj" uniqKey="Mccartney P">PJ McCartney</name>
</author>
<author>
<name sortKey="Rait, Jl" uniqKey="Rait J">JL Rait</name>
</author>
<author>
<name sortKey="De Graaf, Ap" uniqKey="De Graaf A">AP de Graaf</name>
</author>
<author>
<name sortKey="Stone, Em" uniqKey="Stone E">EM Stone</name>
</author>
<author>
<name sortKey="Craig, Je" uniqKey="Craig J">JE Craig</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Toomes, C" uniqKey="Toomes C">C Toomes</name>
</author>
<author>
<name sortKey="Downey, Lm" uniqKey="Downey L">LM Downey</name>
</author>
<author>
<name sortKey="Bottomley, Hm" uniqKey="Bottomley H">HM Bottomley</name>
</author>
<author>
<name sortKey="Mintz Hittner, Ha" uniqKey="Mintz Hittner H">HA Mintz-Hittner</name>
</author>
<author>
<name sortKey="Inglehearn, Cf" uniqKey="Inglehearn C">CF Inglehearn</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fingert, Jh" uniqKey="Fingert J">JH Fingert</name>
</author>
<author>
<name sortKey="Heon, E" uniqKey="Heon E">E Heon</name>
</author>
<author>
<name sortKey="Liebmann, Jm" uniqKey="Liebmann J">JM Liebmann</name>
</author>
<author>
<name sortKey="Yamamoto, T" uniqKey="Yamamoto T">T Yamamoto</name>
</author>
<author>
<name sortKey="Craig, Je" uniqKey="Craig J">JE Craig</name>
</author>
<author>
<name sortKey="Rait, J" uniqKey="Rait J">J Rait</name>
</author>
<author>
<name sortKey="Kawase, K" uniqKey="Kawase K">K Kawase</name>
</author>
<author>
<name sortKey="Hoh, St" uniqKey="Hoh S">ST Hoh</name>
</author>
<author>
<name sortKey="Buys, Ym" uniqKey="Buys Y">YM Buys</name>
</author>
<author>
<name sortKey="Dickinson, J" uniqKey="Dickinson J">J Dickinson</name>
</author>
<author>
<name sortKey="Hockey, Rr" uniqKey="Hockey R">RR Hockey</name>
</author>
<author>
<name sortKey="Williams Lyn, D" uniqKey="Williams Lyn D">D Williams-Lyn</name>
</author>
<author>
<name sortKey="Trope, G" uniqKey="Trope G">G Trope</name>
</author>
<author>
<name sortKey="Kitazawa, Y" uniqKey="Kitazawa Y">Y Kitazawa</name>
</author>
<author>
<name sortKey="Ritch, R" uniqKey="Ritch R">R Ritch</name>
</author>
<author>
<name sortKey="Mackey, Da" uniqKey="Mackey D">DA Mackey</name>
</author>
<author>
<name sortKey="Alward, Wl" uniqKey="Alward W">WL Alward</name>
</author>
<author>
<name sortKey="Sheffield, Vc" uniqKey="Sheffield V">VC Sheffield</name>
</author>
<author>
<name sortKey="Stone, Em" uniqKey="Stone E">EM Stone</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Poulter, Ja" uniqKey="Poulter J">JA Poulter</name>
</author>
<author>
<name sortKey="Ali, M" uniqKey="Ali M">M Ali</name>
</author>
<author>
<name sortKey="Gilmour, Df" uniqKey="Gilmour D">DF Gilmour</name>
</author>
<author>
<name sortKey="Rice, A" uniqKey="Rice A">A Rice</name>
</author>
<author>
<name sortKey="Kondo, H" uniqKey="Kondo H">H Kondo</name>
</author>
<author>
<name sortKey="Hayashi, K" uniqKey="Hayashi K">K Hayashi</name>
</author>
<author>
<name sortKey="Mackey, Da" uniqKey="Mackey D">DA Mackey</name>
</author>
<author>
<name sortKey="Kearns, Ls" uniqKey="Kearns L">LS Kearns</name>
</author>
<author>
<name sortKey="Ruddle, Jb" uniqKey="Ruddle J">JB Ruddle</name>
</author>
<author>
<name sortKey="Craig, Je" uniqKey="Craig J">JE Craig</name>
</author>
<author>
<name sortKey="Pierce, Ea" uniqKey="Pierce E">EA Pierce</name>
</author>
<author>
<name sortKey="Downey, Lm" uniqKey="Downey L">LM Downey</name>
</author>
<author>
<name sortKey="Mohamed, Md" uniqKey="Mohamed M">MD Mohamed</name>
</author>
<author>
<name sortKey="Markham, Af" uniqKey="Markham A">AF Markham</name>
</author>
<author>
<name sortKey="Inglehearn, Cf" uniqKey="Inglehearn C">CF Inglehearn</name>
</author>
<author>
<name sortKey="Toomes, C" uniqKey="Toomes C">C Toomes</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Li, Yj" uniqKey="Li Y">YJ Li</name>
</author>
<author>
<name sortKey="Guggenheim, Ja" uniqKey="Guggenheim J">JA Guggenheim</name>
</author>
<author>
<name sortKey="Bulusu, A" uniqKey="Bulusu A">A Bulusu</name>
</author>
<author>
<name sortKey="Metlapally, R" uniqKey="Metlapally R">R Metlapally</name>
</author>
<author>
<name sortKey="Abbott, D" uniqKey="Abbott D">D Abbott</name>
</author>
<author>
<name sortKey="Malecaze, F" uniqKey="Malecaze F">F Malecaze</name>
</author>
<author>
<name sortKey="Calvas, P" uniqKey="Calvas P">P Calvas</name>
</author>
<author>
<name sortKey="Rosenberg, T" uniqKey="Rosenberg T">T Rosenberg</name>
</author>
<author>
<name sortKey="Paget, S" uniqKey="Paget S">S Paget</name>
</author>
<author>
<name sortKey="Creer, Rc" uniqKey="Creer R">RC Creer</name>
</author>
<author>
<name sortKey="Kirov, G" uniqKey="Kirov G">G Kirov</name>
</author>
<author>
<name sortKey="Owen, Mj" uniqKey="Owen M">MJ Owen</name>
</author>
<author>
<name sortKey="Zhao, B" uniqKey="Zhao B">B Zhao</name>
</author>
<author>
<name sortKey="White, T" uniqKey="White T">T White</name>
</author>
<author>
<name sortKey="Mackey, Da" uniqKey="Mackey D">DA Mackey</name>
</author>
<author>
<name sortKey="Young, Tl" uniqKey="Young T">TL Young</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Epstein, Mp" uniqKey="Epstein M">MP Epstein</name>
</author>
<author>
<name sortKey="Duren, Wl" uniqKey="Duren W">WL Duren</name>
</author>
<author>
<name sortKey="Boehnke, M" uniqKey="Boehnke M">M Boehnke</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Toomes, C" uniqKey="Toomes C">C Toomes</name>
</author>
<author>
<name sortKey="Bottomley, Hm" uniqKey="Bottomley H">HM Bottomley</name>
</author>
<author>
<name sortKey="Jackson, Rm" uniqKey="Jackson R">RM Jackson</name>
</author>
<author>
<name sortKey="Towns, Kv" uniqKey="Towns K">KV Towns</name>
</author>
<author>
<name sortKey="Scott, S" uniqKey="Scott S">S Scott</name>
</author>
<author>
<name sortKey="Mackey, Da" uniqKey="Mackey D">DA Mackey</name>
</author>
<author>
<name sortKey="Craig, Je" uniqKey="Craig J">JE Craig</name>
</author>
<author>
<name sortKey="Jiang, L" uniqKey="Jiang L">L Jiang</name>
</author>
<author>
<name sortKey="Yang, Z" uniqKey="Yang Z">Z Yang</name>
</author>
<author>
<name sortKey="Trembath, R" uniqKey="Trembath R">R Trembath</name>
</author>
<author>
<name sortKey="Woodruff, G" uniqKey="Woodruff G">G Woodruff</name>
</author>
<author>
<name sortKey="Gregory Evans, Cy" uniqKey="Gregory Evans C">CY Gregory-Evans</name>
</author>
<author>
<name sortKey="Gregory Evans, K" uniqKey="Gregory Evans K">K Gregory-Evans</name>
</author>
<author>
<name sortKey="Parker, Mj" uniqKey="Parker M">MJ Parker</name>
</author>
<author>
<name sortKey="Black, Gc" uniqKey="Black G">GC Black</name>
</author>
<author>
<name sortKey="Downey, Lm" uniqKey="Downey L">LM Downey</name>
</author>
<author>
<name sortKey="Zhang, K" uniqKey="Zhang K">K Zhang</name>
</author>
<author>
<name sortKey="Inglehearn, Cf" uniqKey="Inglehearn C">CF Inglehearn</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Toomes, C" uniqKey="Toomes C">C Toomes</name>
</author>
<author>
<name sortKey="Bottomley, Hm" uniqKey="Bottomley H">HM Bottomley</name>
</author>
<author>
<name sortKey="Scott, S" uniqKey="Scott S">S Scott</name>
</author>
<author>
<name sortKey="Mackey, Da" uniqKey="Mackey D">DA Mackey</name>
</author>
<author>
<name sortKey="Craig, Je" uniqKey="Craig J">JE Craig</name>
</author>
<author>
<name sortKey="Appukuttan, B" uniqKey="Appukuttan B">B Appukuttan</name>
</author>
<author>
<name sortKey="Stout, Jt" uniqKey="Stout J">JT Stout</name>
</author>
<author>
<name sortKey="Flaxel, Cj" uniqKey="Flaxel C">CJ Flaxel</name>
</author>
<author>
<name sortKey="Zhang, K" uniqKey="Zhang K">K Zhang</name>
</author>
<author>
<name sortKey="Black, Gc" uniqKey="Black G">GC Black</name>
</author>
<author>
<name sortKey="Fryer, A" uniqKey="Fryer A">A Fryer</name>
</author>
<author>
<name sortKey="Downey, Lm" uniqKey="Downey L">LM Downey</name>
</author>
<author>
<name sortKey="Inglehearn, Cf" uniqKey="Inglehearn C">CF Inglehearn</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ragge, Nk" uniqKey="Ragge N">NK Ragge</name>
</author>
<author>
<name sortKey="Baser, M" uniqKey="Baser M">M Baser</name>
</author>
<author>
<name sortKey="Riccardi, V" uniqKey="Riccardi V">V Riccardi</name>
</author>
<author>
<name sortKey="Falk, R" uniqKey="Falk R">R Falk</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gicquel, Jj" uniqKey="Gicquel J">JJ Gicquel</name>
</author>
<author>
<name sortKey="Vabres, P" uniqKey="Vabres P">P Vabres</name>
</author>
<author>
<name sortKey="Mercie, M" uniqKey="Mercie M">M Mercié</name>
</author>
<author>
<name sortKey="Klossek, J" uniqKey="Klossek J">J Klossek</name>
</author>
<author>
<name sortKey="Dighiero, P" uniqKey="Dighiero P">P Dighiero</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Meyers, Sm" uniqKey="Meyers S">SM Meyers</name>
</author>
<author>
<name sortKey="Gutman, F" uniqKey="Gutman F">F Gutman</name>
</author>
<author>
<name sortKey="Kaye, L" uniqKey="Kaye L">L Kaye</name>
</author>
<author>
<name sortKey="Rothner, A" uniqKey="Rothner A">A Rothner</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kr Mer, F" uniqKey="Kr Mer F">F Krämer</name>
</author>
<author>
<name sortKey="White, K" uniqKey="White K">K White</name>
</author>
<author>
<name sortKey="Pauleikhoff, D" uniqKey="Pauleikhoff D">D Pauleikhoff</name>
</author>
<author>
<name sortKey="Gehrig, A" uniqKey="Gehrig A">A Gehrig</name>
</author>
<author>
<name sortKey="Passmore, L" uniqKey="Passmore L">L Passmore</name>
</author>
<author>
<name sortKey="Rivera, A" uniqKey="Rivera A">A Rivera</name>
</author>
<author>
<name sortKey="Rudolph, G" uniqKey="Rudolph G">G Rudolph</name>
</author>
<author>
<name sortKey="Kellner, U" uniqKey="Kellner U">U Kellner</name>
</author>
<author>
<name sortKey="Andrassi, M" uniqKey="Andrassi M">M Andrassi</name>
</author>
<author>
<name sortKey="Lorenz, B" uniqKey="Lorenz B">B Lorenz</name>
</author>
<author>
<name sortKey="Rohrschneider, K" uniqKey="Rohrschneider K">K Rohrschneider</name>
</author>
<author>
<name sortKey="Blankenagel, A" uniqKey="Blankenagel A">A Blankenagel</name>
</author>
<author>
<name sortKey="Jurklies, B" uniqKey="Jurklies B">B Jurklies</name>
</author>
<author>
<name sortKey="Schilling, H" uniqKey="Schilling H">H Schilling</name>
</author>
<author>
<name sortKey="Schutt, F" uniqKey="Schutt F">F Schutt</name>
</author>
<author>
<name sortKey="Holz, Fg" uniqKey="Holz F">FG Holz</name>
</author>
<author>
<name sortKey="Weber, Bh" uniqKey="Weber B">BH Weber</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ioachimescu, Oc" uniqKey="Ioachimescu O">OC Ioachimescu</name>
</author>
<author>
<name sortKey="Kavuru, M" uniqKey="Kavuru M">M Kavuru</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Stambolian, D" uniqKey="Stambolian D">D Stambolian</name>
</author>
<author>
<name sortKey="Ibay, G" uniqKey="Ibay G">G Ibay</name>
</author>
<author>
<name sortKey="Reider, L" uniqKey="Reider L">L Reider</name>
</author>
<author>
<name sortKey="Dana, D" uniqKey="Dana D">D Dana</name>
</author>
<author>
<name sortKey="Moy, C" uniqKey="Moy C">C Moy</name>
</author>
<author>
<name sortKey="Schlifka, M" uniqKey="Schlifka M">M Schlifka</name>
</author>
<author>
<name sortKey="Holmes, T" uniqKey="Holmes T">T Holmes</name>
</author>
<author>
<name sortKey="Ciner, E" uniqKey="Ciner E">E Ciner</name>
</author>
<author>
<name sortKey="Bailey Wilson, Je" uniqKey="Bailey Wilson J">JE Bailey-Wilson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Klein, Ap" uniqKey="Klein A">AP Klein</name>
</author>
<author>
<name sortKey="Duggal, P" uniqKey="Duggal P">P Duggal</name>
</author>
<author>
<name sortKey="Lee, K" uniqKey="Lee K">K Lee</name>
</author>
<author>
<name sortKey="Klein, R" uniqKey="Klein R">R Klein</name>
</author>
<author>
<name sortKey="Bailey Wilson, J" uniqKey="Bailey Wilson J">J Bailey-Wilson</name>
</author>
<author>
<name sortKey="Klein, B" uniqKey="Klein B">B Klein</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Clementi, M" uniqKey="Clementi M">M Clementi</name>
</author>
<author>
<name sortKey="Angi, M" uniqKey="Angi M">M Angi</name>
</author>
<author>
<name sortKey="Forabosco, P" uniqKey="Forabosco P">P Forabosco</name>
</author>
<author>
<name sortKey="Di Gianantonio, E" uniqKey="Di Gianantonio E">E Di Gianantonio</name>
</author>
<author>
<name sortKey="Tenconi, R" uniqKey="Tenconi R">R Tenconi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hornbeak, Dm" uniqKey="Hornbeak D">DM Hornbeak</name>
</author>
<author>
<name sortKey="Young, Tl" uniqKey="Young T">TL Young</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Mol Vis</journal-id>
<journal-id journal-id-type="publisher-id">MV</journal-id>
<journal-title-group>
<journal-title>Molecular Vision</journal-title>
</journal-title-group>
<issn pub-type="epub">1090-0535</issn>
<publisher>
<publisher-name>Molecular Vision</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">21850187</article-id>
<article-id pub-id-type="pmc">3156798</article-id>
<article-id pub-id-type="publisher-id">230</article-id>
<article-id pub-id-type="publisher-id">2011MOLVIS0250</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Research Article</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Pediatric cataract, myopic astigmatism, familial exudative vitreoretinopathy and primary open-angle glaucoma co-segregating in a family</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Mackey</surname>
<given-names>D.A.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Hewitt</surname>
<given-names>A.W.</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Ruddle</surname>
<given-names>J.B.</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Vote</surname>
<given-names>B.</given-names>
</name>
<xref ref-type="aff" rid="aff5">
<sup>5</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Buttery</surname>
<given-names>R.G.</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Toomes</surname>
<given-names>C.</given-names>
</name>
<xref ref-type="aff" rid="aff6">
<sup>6</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Metlapally</surname>
<given-names>R.</given-names>
</name>
<xref ref-type="aff" rid="aff7">
<sup>7</sup>
</xref>
<xref ref-type="aff" rid="aff8">
<sup>8</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Li</surname>
<given-names>Y.J.</given-names>
</name>
<xref ref-type="aff" rid="aff9">
<sup>9</sup>
</xref>
<xref ref-type="aff" rid="aff10">
<sup>10</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Tran-Viet</surname>
<given-names>K.N.</given-names>
</name>
<xref ref-type="aff" rid="aff10">
<sup>10</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Malecaze</surname>
<given-names>F.</given-names>
</name>
<xref ref-type="aff" rid="aff11">
<sup>11</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Calvas</surname>
<given-names>P.</given-names>
</name>
<xref ref-type="aff" rid="aff11">
<sup>11</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Rosenberg</surname>
<given-names>T.</given-names>
</name>
<xref ref-type="aff" rid="aff12">
<sup>12</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Guggenheim</surname>
<given-names>J.A.</given-names>
</name>
<xref ref-type="aff" rid="aff13">
<sup>13</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Young</surname>
<given-names>T.L.</given-names>
</name>
<xref ref-type="aff" rid="aff7">
<sup>7</sup>
</xref>
<xref ref-type="aff" rid="aff10">
<sup>10</sup>
</xref>
</contrib>
<aff id="aff1">
<label>1</label>
Centre for Ophthalmology and Visual Science, University of Western Australia, Lions Eye Institute, Perth, Australia</aff>
<aff id="aff2">
<label>2</label>
Centre for Eye Research Australia, University of Melbourne, Department of Ophthalmology, Royal Victorian Eye and Ear Hospital, Melbourne, Australia</aff>
<aff id="aff3">
<label>3</label>
Vitreoretinal Unit, Royal Victorian Eye and Ear Hospital, Melbourne, Australia</aff>
<aff id="aff4">
<label>4</label>
Eye Department, University of Tasmania, Royal Hobart Hospital, Hobart, Australia</aff>
<aff id="aff5">
<label>5</label>
The Launceston Eye Institute, Launceston, Australia</aff>
<aff id="aff6">
<label>6</label>
Section of Ophthalmology and Neuroscience, Leeds Institute of Molecular Medicine, University of Leeds, Leeds, UK</aff>
<aff id="aff7">
<label>7</label>
Department of Ophthalmology, Duke University Eye Center, Durham, NC</aff>
<aff id="aff8">
<label>8</label>
School of Optometry, University of California at Berkeley, Berkeley, CA</aff>
<aff id="aff9">
<label>9</label>
Department of Biostatistics and Bioinformatics, Duke University Medical Center, Durham, NC</aff>
<aff id="aff10">
<label>10</label>
Center for Human Genetics, Duke University Medical Center, Durham, NC</aff>
<aff id="aff11">
<label>11</label>
Toulouse University Hospital, Université Paul Sabatier, Toulouse, France</aff>
<aff id="aff12">
<label>12</label>
Kennedy Center, Glostrup, Denmark</aff>
<aff id="aff13">
<label>13</label>
School of Optometry and Vision Sciences, Cardiff University, Cardiff, Wales, United Kingdom</aff>
</contrib-group>
<author-notes>
<corresp id="cor1">Correspondence to: Dr. David A. Mackey, Lions Eye Institute, 2 Verdun St., NEDLANDS, Western Australia 6009, Australia; Phone: +61 8 9381 0779; FAX: +61 8 9381 0700; email:
<email xlink:href="D.Mackey@utas.edu.au">D.Mackey@utas.edu.au</email>
</corresp>
</author-notes>
<pub-date pub-type="collection">
<year>2011</year>
</pub-date>
<pub-date pub-type="epub">
<day>10</day>
<month>8</month>
<year>2011</year>
</pub-date>
<volume>17</volume>
<fpage>2118</fpage>
<lpage>2128</lpage>
<history>
<date date-type="received">
<day>02</day>
<month>6</month>
<year>2011</year>
</date>
<date date-type="accepted">
<day>26</day>
<month>7</month>
<year>2011</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright © 2011 Molecular Vision.</copyright-statement>
<copyright-year>2011</copyright-year>
<license license-type="open-access" xlink:href="http://creativecommons.org/licenses/by/3.0/">
<license-p>This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
</license>
</permissions>
<abstract>
<sec>
<title>Purpose</title>
<p>To describe an Australian pedigree of European descent with a variable autosomal dominant phenotype of: pediatric cortical cataract (CC), asymmetric myopia with astigmatism, familial exudative vitreoretinopathy (FEVR), and primary open-angle glaucoma (POAG).</p>
</sec>
<sec>
<title>Methods</title>
<p>Probands with CC, FEVR, and POAG were enrolled in three independent genetic eye studies in Tasmania. Genealogy confirmed these individuals were closely related and subsequent examination revealed 11 other family members with some or all of the associated disorders.</p>
</sec>
<sec>
<title>Results</title>
<p>Twelve individuals had CC thought to be of childhood onset, with one child demonstrating progressive lenticular opacification. One individual had severe retinal detachment while five others had dragged retinal vessels. Seven individuals had POAG. Seven individuals had myopia in at least one eye ≤-3 Diopters. DNA testing excluded mutations in myocilin, trabecular meshwork inducible glucocorticoid response (
<italic>MYOC</italic>
) and tetraspanin 12 (
<italic>TSPAN12</italic>
). Haplotype analysis excluded frizzled family receptor 4 (
<italic>FZD4</italic>
) and low density lipoprotein receptor-related protein 5 (
<italic>LRP5</italic>
), but only partly excluded
<italic>EVR3</italic>
. Multipoint linkage analysis revealed multiple chromosomal single-nucleotide polymorphisms (SNPs) of interest, but no statistically significant focal localization.</p>
</sec>
<sec>
<title>Conclusions</title>
<p>This unusual clustering of ophthalmic diseases suggests a possible single genetic cause for an apparently new cataract syndrome. This family’s clinical ocular features may reflect the interplay between retinal disease with lenticular changes and axial length in the development of myopia and glaucoma.</p>
</sec>
</abstract>
<custom-meta-group>
<custom-meta>
<meta-name>GalleyStatus</meta-name>
<meta-value>Export to XML</meta-value>
</custom-meta>
<custom-meta>
<meta-name>corr-author</meta-name>
<meta-value>Mackey</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body>
<sec sec-type="intro">
<title>Introduction</title>
<p>In this study, we describe the novel overlapping phenotype of congenital cataract (CC), familial exudative vitreoretinopathy (FEVR), myopia, and primary open-angle glaucoma (POAG) segregating in an apparently autosomal-dominant fashion.</p>
<p>In Australia, myopia affects approximately 15% of the population [
<xref ref-type="bibr" rid="r1">1</xref>
], POAG affects approximately 3% of the population [
<xref ref-type="bibr" rid="r2">2</xref>
], CC occurs in approximately 2.2 out of every 10,000 births [
<xref ref-type="bibr" rid="r3">3</xref>
], and FEVR affects an estimated 7 out of every 1000,000 people (derived from comparing 13 indexed FEVR cases [
<xref ref-type="bibr" rid="r4">4</xref>
] to 420 CC cases [
<xref ref-type="bibr" rid="r3">3</xref>
]). If we were to consider these diseases as completely independent clinical entities, the highly unlikely probability of a patient having all four diseases simultaneously, or of the four diseases co-segregating, would be approximately 1 in 148 billion. This denominator is more than 20 times the total population of earth today.</p>
<p>Interestingly, to some extent these clinical entities can be associated with each other. Many investigators have reported the association of high myopia with cataract, glaucoma, and retinal detachment [
<xref ref-type="bibr" rid="r5">5</xref>
]. Other associations are less common:</p>
<list list-type="simple">
<list-item>
<p>•anterior polar cataracts, seen in aniridia, are often associated with glaucoma [
<xref ref-type="bibr" rid="r6">6</xref>
];</p>
</list-item>
<list-item>
<p>•rubella embryopathy is associated with both congenital glaucoma and CC [
<xref ref-type="bibr" rid="r6">6</xref>
];</p>
</list-item>
<list-item>
<p>•aphakic glaucoma is observed very frequently, and cataract can develop as a complication of POAG-filtering surgery [
<xref ref-type="bibr" rid="r6">6</xref>
];</p>
</list-item>
<list-item>
<p>•retinal detachment is a feature of Stickler syndrome and is associated often with cortical lens opacities [
<xref ref-type="bibr" rid="r7">7</xref>
];</p>
</list-item>
<list-item>
<p>•retinal detachment from retinopathy of prematurity (ROP) is associated with myopia and cataract [
<xref ref-type="bibr" rid="r8">8</xref>
].</p>
</list-item>
<list-item>
<p>•Retinal dystrophies are associated with myopia and posterior subcapsular cataracts [
<xref ref-type="bibr" rid="r9">9</xref>
].</p>
</list-item>
</list>
<p>Although researchers have identified genes associated with each of these disorders, the genetic mechanisms and their interactions still are not fully understood.</p>
</sec>
<sec sec-type="methods">
<title>Methods</title>
<p>We identified three closely-related index cases from three genetic-eye-disease studies: VI:7 from the Glaucoma Inheritance Study in Tasmania (GIST) [
<xref ref-type="bibr" rid="r10">10</xref>
], VIII:7 from the Cataract Inheritance Study in South Eastern Australia (CISSEA) [
<xref ref-type="bibr" rid="r3">3</xref>
], and VIII:8 from the Familial Retinal Detachment Study (FRDA) [
<xref ref-type="bibr" rid="r4">4</xref>
]. The GIST study had ethical approval from the Royal Hobart Hospital; the CISSEA and FRDA studies had ethical approval from the Royal Victorian Eye and Ear Hospital. In each case, the work was conducted in accordance with the tenets of the Declaration of Helsinki.</p>
<p>When we realized that the index cases were a grandmother and two of her grandchildren who were genetic first cousins, we decided to examine the entire pedigree in detail to characterize a potentially novel phenotype. Our ultimate aim was to identify the gene responsible for this apparently-autosomal-dominant disorder.</p>
<p>From the genealogy of the index cases [
<xref ref-type="bibr" rid="r11">11</xref>
] we identified the living members of five lineal generations, as well as surviving more-distant relatives. We invited these family members for a comprehensive ophthalmic examination [
<xref ref-type="bibr" rid="r12">12</xref>
], including:</p>
<list list-type="simple">
<list-item>
<p>•a LogMAR visual acuity test,</p>
</list-item>
<list-item>
<p>•the Goldmann applanation intraocular pressure (IOP) measurement,</p>
</list-item>
<list-item>
<p>•refraction using a HARK-598 autorefractor (Carl Zeiss Meditec, Miami, FL),</p>
</list-item>
<list-item>
<p>•axial length measurement using an Ocuscan
<sup>®</sup>
(Alcon, Inc., Ft Worth, TX),</p>
</list-item>
<list-item>
<p>•corneal pachymetry using an IOPac (Heidelberg Instruments, Heidelberg, Germany),</p>
</list-item>
<list-item>
<p>•lens photographs,</p>
</list-item>
<list-item>
<p>•stereoscopic optic disc photography using a Nidek 3Dx camera (Nidek, Gamagori, Japan), and</p>
</list-item>
<list-item>
<p>•examination of the peripheral retina.</p>
</list-item>
</list>
<p>All participants provided venous blood or saliva specimens for DNA extraction and genetic analysis.</p>
<p>Genotyping was performed using fluorescently-tagged microsatellite markers as described previously [
<xref ref-type="bibr" rid="r13">13</xref>
]. Briefly, standard PCR reactions were carried out in a 25 μl volume containing 50 ng of genomic DNA using Invitrogen Taq DNA polymerase and buffers (Invitrogen). Microsatellite markers (including primer details;
<xref ref-type="table" rid="t1">Table 1</xref>
) surrounding EVR1 (D11S4187, D11S896, and D11S1367), EVR4 (D11S2006, D11S4095, and D11S937) and EVR3 (D11S929, D11S4115, D11S4154, D11S4203, D11S4083, and D11S4102) were selected from the
<ext-link ext-link-type="uri" xlink:href="http://genome.cse.ucsc.edu/index.html?org=Human&db=hg19&hgsid=202890647">genome browser</ext-link>
. Following amplification, PCR products were resolved using an ABI 3730 DNA sequencer and analyzed using GeneMapper
<sup>®</sup>
software from the same manufacturer (Applied Biosystems, Carlsbad, CA). The coding sequence and surrounding exons of myocilin, trabecular meshwork inducible glucocorticoid response (
<italic>MYOC</italic>
) and tetraspanin 12 (
<italic>TSPAN12</italic>
; primers and conditions are listed in
<xref ref-type="table" rid="t2">Table 2</xref>
) were screened using standard direct sequencing protocols as described previously (see above) [
<xref ref-type="bibr" rid="r14">14</xref>
,
<xref ref-type="bibr" rid="r15">15</xref>
].</p>
<table-wrap id="t1" position="float">
<label>Table 1</label>
<caption>
<title>Microsatellite primers and conditions.</title>
</caption>
<table frame="hsides" rules="groups">
<col width="62" span="1"></col>
<col width="231" span="1"></col>
<col width="53" span="1"></col>
<col width="74" span="1"></col>
<col width="81" span="1"></col>
<thead>
<tr>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>Marker</bold>
</th>
<th valign="top" align="left" scope="col" rowspan="1" colspan="1">
<bold>Primer names and sequences (5’-3’)</bold>
</th>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>Size (bp)</bold>
</th>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>Annealing temperature</bold>
</th>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>Amplification conditions</bold>
</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">D11S4187
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">F TCTTGAACCCGGGAAG
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">273-289
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">55 °C
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Invitrogen Taq & buffer
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">R CTGGTGCTGTGCTTGG
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">D11S896
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">F ATCTCCCCTAGCTGTTTTGGA
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">169-183
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">60 °C
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Invitrogen Taq & buffer
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">R AGTTCATATCCACCTCACACA
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">D11S1367
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">F GCTGACATTTATTCACATGGC
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">224-244
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">60 °C
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Invitrogen Taq & buffer
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">R ACAGTGTTATCTCCCTGGCA
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">D11S2006
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">F CTTGTGGGCTGTAGTTTGCT
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">~325
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">55 °C
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Invitrogen Taq & buffer
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">R AAAGAGTAAACTCAATGAAAGATGC
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">D11S4095
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">F TCCCTGGCTATCTTGAATC
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">173-205
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">55 °C
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Invitrogen Taq & buffer
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">R CTTGACTGGGTCCACG
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">D11S937
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">F CTAATAAACAAATCCCTCTACCTCC
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">230-264
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">60 °C
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Invitrogen Taq & buffer
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">R TAGTCAGTCAGGGACCCAAGT
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">D11S929
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">F AGGCCCTTCCAAGATCAG
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">218-240
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">60 °C
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Invitrogen Taq & buffer
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">R CCCAGTTGCCGAACTACC
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">D11S4115
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">F TGGCATGTAAATNTAAGAGACTCAC
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">185-199
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">50 °C
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Invitrogen Taq & buffer
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">R CTGCTACCTCAGAAGTATCTCAA
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">D11S4154
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">F ATCCCTTGGCTTTCTCAGAGCAC
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">146-158
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">65 °C
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Invitrogen Taq & buffer
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">R GGTGCCCCTAACCTCCATGT
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">D11S4203
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">F GAATAGCCACTGACTTCAGG
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">218-278
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">60 °C
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Invitrogen Taq & buffer
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">R CAGGATGCTGGAATAGAGAA
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">D11S4083
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">F TTTAACCCAAGGGCAGGAC
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">178-206
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">55 °C
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Invitrogen Taq & buffer
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">R CATGTGTACCCAAGGGCAG
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">D11S4102
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">F CACCACTGGGTACTGCCATC
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">142-174
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">60 °C
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Invitrogen Taq & buffer
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1"> </td>
<td valign="top" align="left" rowspan="1" colspan="1">R GCTAAATCCTGGAAAGCCCTG</td>
<td valign="top" align="center" rowspan="1" colspan="1"> </td>
<td valign="top" align="center" rowspan="1" colspan="1"> </td>
<td valign="top" align="center" rowspan="1" colspan="1"> </td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="t2" position="float">
<label>Table 2</label>
<caption>
<title>
<italic>TSPAN12</italic>
primers and PCR conditions.</title>
</caption>
<table frame="hsides" rules="groups">
<col width="37" span="1"></col>
<col width="232" span="1"></col>
<col width="32" span="1"></col>
<col width="74" span="1"></col>
<col width="81" span="1"></col>
<thead>
<tr>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>Exon</bold>
</th>
<th valign="top" align="left" scope="col" rowspan="1" colspan="1">
<bold>Primer names and sequences (5’-3’)</bold>
</th>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>Size (bp)</bold>
</th>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>Annealing temperature</bold>
</th>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>Amplification conditions</bold>
</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">2
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">TSPAN12-ex2-F ATGTCCCGTGTTCTCTCTCC
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">382
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">60 °C
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Invitrogen Taq & buffer
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">TSPAN12-ex2-R CCAGGGGTGGATTTCTTTGT
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">3
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">TSPAN12-ex3-F TGGTAATTGGGAAAGATATTATGTAAC
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">291
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">60 °C
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Invitrogen Taq & buffer
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">TSPAN12-ex3-R CCAAAAGATCAAGGAAGAGCA
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">4
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">TSPAN12-ex4-F TGAGGCATCATGATTGAAAGAA
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">346
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">60 °C
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Invitrogen Taq & buffer
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">TSPAN12-ex4-R GCTATCACTGCTCCCTAATCTTGT
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">5
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">TSPAN12-ex5-F GGTCCCCTTTCTTGGAGAAC
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">947
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">60 °C
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Invitrogen Taq & buffer
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">TSPAN12-ex5-R TGGAAATGTGCTTTAGACACAGA
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">6
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">TSPAN12-ex6-F GTACAAAATACCTCTTCATTTATCACA
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">529
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">60 °C
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Hot shot master mix
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">TSPAN12-ex6-R GAAGAAAAGCAGGCCATGAA
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">7
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">TSPAN12-ex7-F TGATGACAGATATAGCTCTGGGT
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">376
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">60 °C
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Hot shot master mix
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">TSPAN12-ex7-R TTTTAAGGCCTTTTACATTTAGACA
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1"> 
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">8
<hr></hr>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">TSPAN12-ex8-F GCTTTCCCTGAGAACCACTG
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">605
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">60 °C
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Hot shot master mix
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1"> </td>
<td valign="top" align="left" rowspan="1" colspan="1">TSPAN12-ex8-R CCATCCTCATTTTAAAGCATAGA</td>
<td valign="top" align="center" rowspan="1" colspan="1"> </td>
<td valign="top" align="center" rowspan="1" colspan="1"> </td>
<td valign="top" align="center" rowspan="1" colspan="1"> </td>
</tr>
</tbody>
</table>
</table-wrap>
<p>For the genotyping platform, we used Linkage Panel IVb of 6008 genome-wide single-nucleotide polymorphisms
<bold>(</bold>
SNPs; Illumina, San Diego, CA), and ran the analysis at the Center for Inherited Disease Research (CIDR) of Johns Hopkins University (Baltimore, MD). The results for the pedigree were analyzed with
<ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov/CBBresearch/Schaffer/fastlink.html">Fastlink</ext-link>
using a 2-point analysis (under a dominant model); multipoint results (both parametric and non-parametric) were analyzed using
<ext-link ext-link-type="uri" xlink:href="http://www.genomeutwin.org/member/cores/stat/linkage/merlin.html">MERLIN</ext-link>
. Merlin (Multipoint Engine for Rapid Likelihood Inference) is a software package that uses sparse inheritance trees for pedigree analysis [
<xref ref-type="bibr" rid="r16">16</xref>
].</p>
</sec>
<sec sec-type="results">
<title>Results</title>
<p>Genealogical information was available for nine generations of the participants’ family; the individuals examined for this study came from the five most recent generations.</p>
<list list-type="simple">
<list-item>
<p>
<xref ref-type="fig" rid="f1">Figure 1</xref>
shows the relevant portions of the full pedigree. A consanguineous loop enriched the pedigree with similar genes (
<ext-link ext-link-type="uri" xlink:href="http://csg.sph.umich.edu/boehnke/relpair.php">RELPAIR</ext-link>
[
<xref ref-type="bibr" rid="r17">17</xref>
] analysis suggested a grandparent-grandchild relationship when they were actually great-grandparent and great-grandchild).
<fig id="f1" fig-type="figure" position="float">
<label>Figure 1</label>
<caption>
<p>Reduced pedigree showing affected individuals. Square=male, circle=female, Top Right filled=myopia, Bottom Right filled=retinal detachment or dragged disc, Bottom Left filled=cataract, Top Left=primary open-angle glaucoma (POAG), n=examined and normal.</p>
</caption>
<graphic xlink:href="mv-v17-2118-f1"></graphic>
</fig>
</p>
</list-item>
<list-item>
<p>
<xref ref-type="table" rid="t3">Table 3</xref>
displays the participants’ ophthalmic phenotypes with autorefraction sphere and cylinder, Keratometry readings, and axial length.
<table-wrap id="t3" position="float">
<label>Table 3</label>
<caption>
<title>Clinical features of family members examined.</title>
</caption>
<table frame="hsides" rules="groups">
<col width="42" span="1"></col>
<col width="30" span="1"></col>
<col width="89" span="1"></col>
<col width="87" span="1"></col>
<col width="92" span="1"></col>
<col width="69" span="1"></col>
<col width="69" span="1"></col>
<col width="45" span="1"></col>
<col width="47" span="1"></col>
<col width="56" span="1"></col>
<col width="63" span="1"></col>
<col width="123" span="1"></col>
<thead>
<tr>
<th valign="top" align="left" scope="col" rowspan="1" colspan="1">
<hr></hr>
</th>
<th valign="top" align="left" scope="col" rowspan="1" colspan="1">
<hr></hr>
</th>
<th valign="top" align="left" scope="col" rowspan="1" colspan="1">
<hr></hr>
</th>
<th colspan="2" valign="top" align="center" scope="colgroup" rowspan="1">
<bold>Refractive error (D)</bold>
<hr></hr>
</th>
<th colspan="2" valign="top" align="center" scope="colgroup" rowspan="1">
<bold>Keratometry (D)</bold>
<hr></hr>
</th>
<th colspan="2" valign="top" align="center" scope="colgroup" rowspan="1">
<bold>Axial Length (mm)</bold>
<hr></hr>
</th>
<th valign="top" align="left" scope="col" rowspan="1" colspan="1">
<hr></hr>
</th>
<th valign="top" align="left" scope="col" rowspan="1" colspan="1">
<hr></hr>
</th>
<th valign="top" align="left" scope="col" rowspan="1" colspan="1">
<hr></hr>
</th>
</tr>
<tr>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>ID</bold>
</th>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>Sex</bold>
</th>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>Age at initial examination (years)</bold>
</th>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>Right</bold>
</th>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>Left</bold>
</th>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>Right</bold>
</th>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>Left</bold>
</th>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>Right</bold>
</th>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>Left</bold>
</th>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>Cataract</bold>
</th>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>Glaucoma</bold>
</th>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>Dragged disc or retinal detachment</bold>
</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">V:2
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">F
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">81
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">−0.75/-2.0x70
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">+0.75/-1.5x65
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">45.3/44.3
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">43.8/42.9
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">25.05
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">23.56
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Yes
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Yes
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">None
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">V:4
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">F
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">83
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">−2/-3.25x45
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">−3.25/-1.0x95
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">49.2/53.9*
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">48.6/46.2
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">25.44
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">24.37
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Yes
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Yes
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Dragged disc
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">VI:7
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">F
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">65
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">+0.25/-3.0x180
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">−0.25/-3.5x75
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">45.3/42.25*
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">45.8/43.0
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">23.75
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">23.88
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Yes
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Yes
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Dragged disc
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">VI:12
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">F
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">76
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Yes
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Yes
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">None
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">VI:13
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">F
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">86
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">No
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Yes
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">None
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">VII:1
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">M
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">45
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">0/-0.25x180
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">0/-0.25x180
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">No
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">No
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">None
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">VII:3
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">F
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">43
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">0/-1.5x180
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">0/-0.25x160
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">40.0/43.1
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">43.4/44.3
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Yes
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">No
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">None
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">VII:5
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">M
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">39
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">−3.25/-4.0x180
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">−0.5/-1x175
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">43.5/45.1
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">43.5/43.6
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">24.60
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">22.63
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Yes
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Yes
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Dragged disc
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">VII:6
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">F
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">33
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">−0.75
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">−0.5/-0.75x170
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">No
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">No
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">None
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">VII:7
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">M
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">36
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">−2.25/-0.5x155
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">−6.25/-1.5x145
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">42.1/ 42.3
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">43.5/43.1
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">24.62
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">26.77
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Yes
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Yes
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Dragged disc
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">VII:8
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">F
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">38
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">No
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">No
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">None
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">VIII:3
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">F
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">25
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">−0.25/-0.5x88
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">+0.5/-0.25x102
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Yes
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">No
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">None
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">VIII:5
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">M
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">16
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">−1.75/-1.25x50
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">−6.25/-6.75x175
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">40.0/43.1
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">43.4/ 44.3
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Yes
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">No
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">None
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">VIII:6
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">M
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">12
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">−2.0/-5.0x90
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">+0.5/-0.5x160
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Yes
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">No
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">None
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">VIII:7
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">M
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">8
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">−5.75/-0.5x55
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">−9.25/-3.5x95
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">41.0/41.8
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">40.0/41.0
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">25.65
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Yes
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">No
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Dragged disc
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">VIII:8
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">F
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">17
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">+0.5/-7.25x165
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">ND
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">ND
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">ND
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">ND
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">ND
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">Total detachment OU
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">VIII:9
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">F
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">15
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">−0.25/-0.5x135
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">0/-0.25x55
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">No
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">No
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">None
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">IX:1</td>
<td valign="top" align="center" rowspan="1" colspan="1">M</td>
<td valign="top" align="center" rowspan="1" colspan="1">3</td>
<td valign="top" align="center" rowspan="1" colspan="1">1.5</td>
<td valign="top" align="center" rowspan="1" colspan="1">0/-0.5x121</td>
<td valign="top" align="center" rowspan="1" colspan="1">45.3/44.3</td>
<td valign="top" align="center" rowspan="1" colspan="1">43.8/42.9</td>
<td valign="top" align="center" rowspan="1" colspan="1">25.05</td>
<td valign="top" align="center" rowspan="1" colspan="1">NR</td>
<td valign="top" align="center" rowspan="1" colspan="1">Yes</td>
<td valign="top" align="center" rowspan="1" colspan="1">No</td>
<td valign="top" align="center" rowspan="1" colspan="1">None</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<p>Abbreviations: F, female; M, male; D, diopters; NR, not recorded; ND, not determinable; OU, both eyes. *measured following cataract surgery</p>
</table-wrap-foot>
</table-wrap>
</p>
</list-item>
<list-item>
<p>
<xref ref-type="fig" rid="f2">Figure 2</xref>
and
<xref ref-type="fig" rid="f3">Figure 3A-N</xref>
show photos of the optic disc, retina, and lens.
<fig id="f2" fig-type="figure" position="float">
<label>Figure 2</label>
<caption>
<p>Lens, optic disc, and retina photos of individuals. In the figure,
<bold>A</bold>
indicates individual V:2;
<bold>B</bold>
indicates individual V:4;
<bold>C</bold>
indicates individual VI:7;
<bold>D</bold>
indicates individual VII:3;
<bold>E</bold>
indicates individual VII:5;
<bold>F</bold>
indicates individual VII:7;
<bold>G</bold>
indicates individual VIII:3;
<bold>H</bold>
indicates individual VIII:5;
<bold>I</bold>
indicates individual VIII:6;
<bold>J</bold>
indicates individual VIII:7;
<bold>K</bold>
indicates individual VIII:7 followup lens photo five years after first photos;
<bold>L</bold>
indicates individual VIII:8;
<bold>M</bold>
indicates individual VIII:9; and
<bold>N</bold>
indicates individual IX:1.</p>
</caption>
<graphic xlink:href="mv-v17-2118-f2"></graphic>
</fig>
<fig id="f3" fig-type="figure" position="float">
<label>Figure 3</label>
<caption>
<p>24–2 Humphrey Visual Fields of Individuals.
<bold>A</bold>
indicates individual V:2;
<bold>B</bold>
indicates individual V:4;
<bold>C</bold>
indicates individual VI:7;
<bold>D</bold>
indicates individual VII:5; and
<bold>E</bold>
indicates individual VII:7.</p>
</caption>
<graphic xlink:href="mv-v17-2118-f3"></graphic>
</fig>
</p>
</list-item>
<list-item>
<p>
<xref ref-type="fig" rid="f4">Figure 4A-E</xref>
show visual field defects.
<fig id="f4" fig-type="figure" position="float">
<label>Figure 4</label>
<caption>
<p>Haplotype analysis of FEVR genes. Only a subset of the pedigree is displayed; shaded individuals are those whose phenotype suggests FEVR.
<italic>EVR2</italic>
(Norrin) is excluded by the pedigree structure showing male to male transmission. For each locus examined, the affected individuals do not share the same haplotype, indicating that the causative gene does not reside in this region of the chromosomal.
<bold>A</bold>
: EVR1 (
<italic>FZD4</italic>
);
<bold>B</bold>
: EVR3 11p13-p12;
<bold>C</bold>
: EVR4 (
<italic>LRP5</italic>
).</p>
</caption>
<graphic xlink:href="mv-v17-2118-f4"></graphic>
</fig>
</p>
</list-item>
</list>
<p>Excluding the married-in spouses, we examined eight female and six male family members aged 3–86 years who apparently were affected.</p>
<list list-type="simple">
<list-item>
<p>•Visual acuity ranged from 6/5 to perception of light.</p>
</list-item>
<list-item>
<p>•Spherical-equivalent refractive error in Diopters (D) ranged from +0.25 D to −11.0 D, with five individuals having myopia in at least one eye of <-3D.</p>
</list-item>
<list-item>
<p>•Astigmatism varied from 0 to −7.25 D with the rule or −5 D against the rule.</p>
</list-item>
<list-item>
<p>•Axial length varied from 23.75 mm to 26.77 mm.</p>
</list-item>
<list-item>
<p>•Keratometry readings in eyes that had not been operated on ranged from 40.0 D to 48.62 D, with the largest corneal astigmatism measuring only 3.12 D.</p>
</list-item>
<list-item>
<p>•Maximum recorded IOP ranged from 13 mmHg to 36 mmHg.</p>
</list-item>
<list-item>
<p>•Central corneal thickness ranged from 510 μm to 590 μm.</p>
</list-item>
<list-item>
<p>•One male (VIII:6) was found to have a distance exotropia of 25 D.</p>
</list-item>
<list-item>
<p>•Twelve individuals (6 male and 6 female) had CC, thought to be pediatric in onset. (V:2, V:4,VI:7, VI:12, VII:3, VII:5, VII:3, VII:7, VIII:3, VIII:5, VIII:6, VIII:7, IX:1). The youngest age of documented cataract was 3 years of age (IX:1).</p>
</list-item>
<list-item>
<p>•One member (VIII:7) had photographic evidence of cataract progression (
<xref ref-type="fig" rid="f3">Figure 3J,K</xref>
). In addition, iris atrophy was noted at the 3 and 9 o’clock positions. This atrophy possibly became more notable with age (
<xref ref-type="fig" rid="f3">Figure 3K</xref>
).</p>
</list-item>
<list-item>
<p>•One female individual (VIII:8) had severe spontaneous retinal detachment consistent with FEVR, while five individuals (3 male and 2 female) had dragged retinal vessels (V:4,VI:7, VII:5, VII:7, VIII:7).</p>
</list-item>
<list-item>
<p>•Seven individuals (5 female and 2 male) had been diagnosed with POAG (V:2, V:4, VI:7, VI:12, VI:13, VII:5, VII:7).</p>
</list-item>
</list>
<p>Cataract extraction was performed on VII:7 after the cortical wedge progressed to complete lenticular opacification in the left eye and vision declined from 6/18 to 6/60. Post-operatively, this member’s best-corrected visual acuity improved to 6/6. Refraction in the left eye changed from −6.25/-1.5x145 to +0.00/-0.50 X 98 following cataract surgery. The brother of this individual (VII:5) had similar surgery for cataract and astigmatism, but his visual acuity did not improve from 6/60.</p>
<sec>
<title>Systemic associations</title>
<p>None of the family members had dysmorphia or an unusual stature consistent with the facial or body habitus features of Stickler syndrome. One member, who had not worn ear protection in his industrial employment, had noise-related hearing loss (VII:7) and one (V:4) had age-related hearing loss. Only one member (V:4) was found to have a single café-au-lait spot.</p>
<p>One participant (VII:7) had previously been diagnosed with pulmonary alveolar proteinosis (PAP) and treated with repeated pulmonary lavage. PAP is a rare disorder related to the receptor pathway of the granulocyte macrophage–colony stimulating factor (GM-CSF); it was diagnosed after recurrent bouts of pneumonia in adult life. No other family member has experienced similar medical problems; no individual reported any renal problems.</p>
<p>
<italic>MYOC</italic>
screening of the index case revealed no mutation [
<xref ref-type="bibr" rid="r14">14</xref>
]. Haplotype analysis of a central portion of the pedigree excluded the
<italic>EVR1</italic>
frizzled family receptor 4 (
<italic>FZD4</italic>
) and
<italic>EVR4</italic>
low density lipoprotein receptor-related protein 5 (
<italic>LRP5</italic>
)
<italic>FEVR</italic>
genes (Figure 4). Unfortunately, the
<italic>EVR3</italic>
locus could be only partially excluded due to uninformative markers. Given that this gene had not been identified, we cannot exclude this locus fully. Direct screening of VIII:8 excluded the recently-identified FEVR gene
<italic>TSPAN12</italic>
.</p>
<p>The family was included in the International High Myopia Consortium linkage analysis [
<xref ref-type="bibr" rid="r16">16</xref>
]; however, the family was dropped from the multipoint analyses for chromosomes 3, 4, 6, 7, 8, 11, and 12 due to the pedigree’s complexity.
<xref ref-type="table" rid="t4">Table 4</xref>
displays the two-point linkage results for this family showing the highest scoring logarithm of odds (LOD) scores above 1.5. There were multiple chromosomal SNPs of interest, but no statistically significant focal localization.</p>
<table-wrap id="t4" position="float">
<label>Table 4</label>
<caption>
<title>Summary of the Johns Hopkins Center for Inherited Disease Research (CIDR) results for the family.</title>
</caption>
<table frame="hsides" rules="groups">
<col width="79" span="1"></col>
<col width="70" span="1"></col>
<col width="70" span="1"></col>
<col width="70" span="1"></col>
<col width="71" span="1"></col>
<col width="71" span="1"></col>
<thead>
<tr>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>Chromosome</bold>
</th>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>Marker</bold>
</th>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>Position (cM)</bold>
</th>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>2PT-parametric (Fastlink)</bold>
</th>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>MPT-non-parametric</bold>
</th>
<th valign="top" align="center" scope="col" rowspan="1" colspan="1">
<bold>MPT-parametric</bold>
</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">1
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1981193
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">121.82
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.863</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">1
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1806753
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">160.34
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.079</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">2
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs2053372
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">47.98
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.592</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">2
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs2008535
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">54.9
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.128</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">2
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs764464
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">65.31
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.328</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">2
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1022298
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">117.27
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.162</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">2
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs264963
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">117.39
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.162</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">3
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs2076993
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">46.5
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.166</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">3
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1348979
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">49.44
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.166</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">3
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1127732
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">59.51
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.097</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">3
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs713144
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">60.4
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.477</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">3
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1382554
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">60.41
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.097</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">3
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1405793
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">64.61
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.159</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">3
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1495704
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">65.68
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.159</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">3
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1995137
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">66.29
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.159</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">3
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1351631
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">67.73
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.522</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">3
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs737516
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">67.73
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.522</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">3
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1013758
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">67.81
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.522</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">3
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs844438
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">78.91
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.123</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">3
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1447971
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">82.11
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.842</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">3
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs935734
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">92.98
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.586</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">3
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1019374
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">95
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.069</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">3
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1388276
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">99.96
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.116</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">4
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs751266
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">67.19
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.054</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">4
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs896656
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">93.96
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.326</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">8
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs2203837
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">23.58
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.615</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">8
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs334206
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">32.33
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.241</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">8
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs241202
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">48.58
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.849</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">8
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs4107736
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">50.87
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.248</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">8
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1481747
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">53.13
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.103</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">8
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1955185
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">61.16
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.05</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">8
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs716583
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">65.56
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.116</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">8
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs344278
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">74.88
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.582</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">8
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1460239
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">112.26
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.618</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">8
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1433396
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">122.14
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.119</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">8
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs766811
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">138.68
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.16</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">9
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1532310
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">0.124137
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.522</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">9
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1532309
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">0.124434
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.522</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">9
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1143025
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">30.9
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.176</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">9
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1029015
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">35.12
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.767</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">9
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs716933
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">60.37
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.089</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">9
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs987187
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">60.4
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.128</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">9
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1333342
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">69.96
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.477</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">10
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1346300
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">75.86
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.522</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">11
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs676943
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">125.79
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.015</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">12
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs871880
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">58.31
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.123</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">12
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs7134835
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">161.7
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.2</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">12
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1278602
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">171.56
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.089</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">12
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1278601
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">171.57
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.089</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">12
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs937538
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">171.78
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.094</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">13
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs2985981
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">49.25
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.004</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">13
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs2031836
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">115.73
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.003</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">15
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1435735
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">46.31
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.199</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">15
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs890153
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">46.31
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.554</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">15
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs725463
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">60.22
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.043</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">15
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1445020
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">71.05
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.049</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">16
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1019141
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">19.98
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.49</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">16
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs889593
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">122.83
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">0.018
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>0.701998</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">1.0217
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">16
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs299956
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">123.93
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">0.734
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>0.943619</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">1.5971
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">16
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs2076962
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">125.29
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">−0.036
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.127055</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">1.8771
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">16
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs3794668
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">126.97
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">−0.011
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.126755</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">1.8763
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">16
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1056707
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">128.94
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">0.057
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.12803</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">1.8782
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">16
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs750740
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">129.03
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">0.399
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.128125</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">1.8783
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">16
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs463701
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">130.14
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">−0.067
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.129806</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">1.8804
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">16
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs452176
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">130.21
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">0.01
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.129825</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">1.8804
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">16
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1006547
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">130.48
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">0.018
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.129924</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">1.8805
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">16
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1800330
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">130.5
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">0.891
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">
<bold>16</bold>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<bold>rs870856</bold>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<bold>130.83</bold>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<bold>
<italic>1.781</italic>
</bold>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<bold>
<italic>1.126244</italic>
</bold>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<bold>1.8762</bold>
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">16
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs8577
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">130.86
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">0.549
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.125715</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">1.8755
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">17
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs721429
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">95.95
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.199</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">18
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1972602
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">45.77
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.123</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">18
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1548755
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">51.57
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.252</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">18
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1131709
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">56.82
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.339</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">18
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs650680
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">58.25
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.767</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">18
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs931078
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">84.57
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.11</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">20
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1535382
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">14.16
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.046</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">21
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs1041756
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">33.98
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.07</italic>
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" align="center" scope="row" rowspan="1" colspan="1">21</td>
<td valign="top" align="center" rowspan="1" colspan="1">rs2839576</td>
<td valign="top" align="center" rowspan="1" colspan="1">62.26</td>
<td valign="top" align="center" rowspan="1" colspan="1">
<italic>1.324</italic>
</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS</td>
<td valign="top" align="center" rowspan="1" colspan="1">NS</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<p>2-point analyses with Fastlink under a dominant model; multipoint results, both parametric and non-parametric, using the multipoint engine for rapid likelihood inference (
<ext-link ext-link-type="uri" xlink:href="http://www.genomeutwin.org/member/cores/stat/linkage/merlin.html">MERLIN</ext-link>
). Results in italics highlight suggestive loci, while the results in bold were found to be suggestive under all models tested. Abbreviations: Chr, chromosome; cM, centimorgan; 2PT, two point; MPT, multi-point; NS, not significant.</p>
</table-wrap-foot>
</table-wrap>
</sec>
</sec>
<sec sec-type="discussion">
<title>Discussion</title>
<p>This Australian pedigree has a unique constellation of ophthalmic features that do not appear to have been described previously. Although we were unable to identify a similar family reported in the literature, the subtle and relatively common clinical features could be overlooked.</p>
<p>Many investigators have reported the association of high myopia with ocular morbidities of early-onset cataract, glaucoma and retinal detachment [
<xref ref-type="bibr" rid="r5">5</xref>
]. Pedigrees with myopia are common, but pedigrees with so many members affected with these early ocular issues along with myopic development are extremely rare; we were not able to identify any in the published literature.</p>
<p>Although we cannot discount that the associated ocular features may be secondary in origin, this family raises the possibility that the same gene may be responsible for all forms of the pathology observed in the pedigree.</p>
<p>Retinal detachment is an uncommon disorder in young people and is most commonly identified in patients with FEVR. X-linked FEVR and Norrie disease arose from mutations in Norrin (excluded by male-to-male transmission, in this pedigree). Dominant FEVR is due to mutations in
<italic>FZD4</italic>
and
<italic>LRP5,</italic>
and has been linked to the
<italic>EVR3</italic>
locus [
<xref ref-type="bibr" rid="r18">18</xref>
]. We excluded these loci through linkage analysis. The recently-described gene
<italic>TSPAN12</italic>
(
<italic>EVR5</italic>
) was excluded by sequence analysis. Nonetheless, despite a well characterized FEVR mutation, there still can be considerable variation in the expressivity of the phenotype and incomplete penetrance [
<xref ref-type="bibr" rid="r15">15</xref>
,
<xref ref-type="bibr" rid="r18">18</xref>
,
<xref ref-type="bibr" rid="r19">19</xref>
] (Personal communication; T.L. Edwards, Centre for Eye Research Australia, Melbourne, Australia [article in press]).</p>
<p>Since the cataract is the most “easily characterized” phenotype in this family’s pedigree, we compared it with other cataract phenotypes described in the literature. Although CC has been linked to or associated with many cataract loci and many chromosomal deletions, the causative mutation has not been identified for the majority of CC and pediatric cataract cases [
<xref ref-type="bibr" rid="r6">6</xref>
].</p>
<p>The peripheral cortical lamella wedge seen in this family is similar to that observed in Stickler syndrome [
<xref ref-type="bibr" rid="r7">7</xref>
] and also with neurofibromatosis Type 2 (NF2) [
<xref ref-type="bibr" rid="r20">20</xref>
]. Interestingly, one case describes NF2 associated with posterior subcapsular cataract and dragged disc [
<xref ref-type="bibr" rid="r21">21</xref>
]. In a series of 15 other NF2 patients, 12 patients had an epiretinal membrane in the macular or paramacular area and 11 patients had central posterior cortical, subcapsular, or peripheral cortical lens opacities [
<xref ref-type="bibr" rid="r22">22</xref>
]. NF2 arises from mutations in the
<italic>Merlin</italic>
gene on chromosome 22q12.2 [
<xref ref-type="bibr" rid="r23">23</xref>
].</p>
<p>The one case of PAP [
<xref ref-type="bibr" rid="r24">24</xref>
] prompted an investigation of possible genes involved in the GM-CSF pathway using the Online Mendelian Inheritance in Man
<sup>®</sup>
(
<ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov/omim">OMIM</ext-link>
) database at Johns Hopkins University. Of three loci associated with PAP, one gene located at chromosome 22q12.2-q13.1, Granulocyte-macrophage Colony-stimulating factor receptor, beta (
<italic>CSF2RB</italic>
) is adjacent to
<italic>Merlin</italic>
. Notably, on reviewing myopia loci, the myopia linkage found by Stambolian and colleagues [
<xref ref-type="bibr" rid="r25">25</xref>
] for marker D22S685 lies in chromosome region 22q12. This region has also been replicated in the Beaver Dam Eye study [
<xref ref-type="bibr" rid="r26">26</xref>
].</p>
<p>The refractive error recorded in this pedigree is atypical; most hereditary myopia is symmetric and usually is not associated with high astigmatism. To date there has been little investigation of the genetics of astigmatism, though genetic factors are likely to play a role [
<xref ref-type="bibr" rid="r27">27</xref>
]. It would appear that the myopia in this family originates in increased axial length rather than in the more usual primary lenticular fault. The degree of astigmatism in severely affected members, however, appeared to be both lenticular and corneal, suggesting a common mechanism of growth or compensation. The causative interaction of the cataract and the increased myopia remains to be elucidated, but may involve visual form deprivation [
<xref ref-type="bibr" rid="r28">28</xref>
].</p>
<p>We hope that characterization of this unusual phenotypic constellation will identify other families with similar characteristics. Further characterization of the genes involved in this family using methods such as next-generation sequencing should help shed light on the genetics of the four clinical entities —POAG, CC, FEVR, and myopia— as well as their interactions. In time, this further work also may help clarify the molecular pathways of developing myopia involving retinal signaling, lens growth and axial length.</p>
</sec>
</body>
<back>
<ack>
<title>Acknowledgments</title>
<p>We thank the family for their cooperation, Maree Ring for genealogical assistance and Tania Minehan, Lisa Kearns, Sandra Staffieri, and Patricia Coleman for assistance in examining patients and collecting specimens. This research was supported by the National Institutes of Health Grant EY014685 and Research to Prevent Blindness Inc. (T.L.Y.) and the Ophthalmic Research Institute of Australia. C. Toomes is a Royal Society University Research Fellow (URF).</p>
</ack>
<ref-list>
<title>References</title>
<ref id="r1">
<label>1</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Attebo</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Ivers</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Mitchell</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>Refractive errors in an older population: the Blue Mountains Eye Study.</article-title>
<source>Ophthalmology</source>
<year>1999</year>
<volume>106</volume>
<fpage>1066</fpage>
<lpage>72</lpage>
<pub-id pub-id-type="pmid">10366072</pub-id>
</element-citation>
</ref>
<ref id="r2">
<label>2</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mitchell</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Smith</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Attebo</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Healey</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>Prevalence of open-angle glaucoma in Australia. The Blue Mountains Eye Study.</article-title>
<source>Ophthalmology</source>
<year>1996</year>
<volume>103</volume>
<fpage>1661</fpage>
<lpage>9</lpage>
<pub-id pub-id-type="pmid">8874440</pub-id>
</element-citation>
</ref>
<ref id="r3">
<label>3</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wirth</surname>
<given-names>MG</given-names>
</name>
<name>
<surname>Russell-Eggitt</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Craig</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Elder</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Mackey</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Aetiology of congenital and paediatric cataract in an Australian population.</article-title>
<source>Br J Ophthalmol</source>
<year>2002</year>
<volume>86</volume>
<fpage>782</fpage>
<lpage>6</lpage>
<pub-id pub-id-type="pmid">12084750</pub-id>
</element-citation>
</ref>
<ref id="r4">
<label>4</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dickinson</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Sale</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Passmore</surname>
<given-names>A</given-names>
</name>
<name>
<surname>FitzGerald</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Wheatley</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Burdon</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Craig</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Tengtrisorn</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Carden</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Maclean</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Mackey</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Mutations in the NDP gene: contribution to Norrie disease, familial exudative vitreoretinopathy and retinopathy of prematurity.</article-title>
<source>Clin Experiment Ophthalmol</source>
<year>2006</year>
<volume>34</volume>
<fpage>682</fpage>
<lpage>8</lpage>
<pub-id pub-id-type="pmid">16970763</pub-id>
</element-citation>
</ref>
<ref id="r5">
<label>5</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Young</surname>
<given-names>TL</given-names>
</name>
<name>
<surname>Metlapally</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Shay</surname>
<given-names>A</given-names>
</name>
</person-group>
<article-title>Complex trait genetics of refractive error.</article-title>
<source>Arch Ophthalmol</source>
<year>2007</year>
<volume>125</volume>
<fpage>38</fpage>
<lpage>48</lpage>
<pub-id pub-id-type="pmid">17210850</pub-id>
</element-citation>
</ref>
<ref id="r6">
<label>6</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mackey</surname>
<given-names>DA</given-names>
</name>
</person-group>
<article-title>2005 Gregg Lecture: Congenital cataract–from rubella to genetics.</article-title>
<source>Clin Experiment Ophthalmol</source>
<year>2006</year>
<volume>34</volume>
<fpage>199</fpage>
<lpage>207</lpage>
<pub-id pub-id-type="pmid">16671898</pub-id>
</element-citation>
</ref>
<ref id="r7">
<label>7</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Seery</surname>
<given-names>CM</given-names>
</name>
<name>
<surname>Pruett</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Liberfarb</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Cohen</surname>
<given-names>B</given-names>
</name>
</person-group>
<article-title>Distinctive cataract in the Stickler syndrome.</article-title>
<source>Am J Ophthalmol</source>
<year>1990</year>
<volume>110</volume>
<fpage>143</fpage>
<lpage>8</lpage>
<pub-id pub-id-type="pmid">2378378</pub-id>
</element-citation>
</ref>
<ref id="r8">
<label>8</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tasman</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Patz</surname>
<given-names>A</given-names>
</name>
<name>
<surname>McNamara</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Kaiser</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Trese</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Smith</surname>
<given-names>B</given-names>
</name>
</person-group>
<article-title>Retinopathy of prematurity: the life of a lifetime disease.</article-title>
<source>Am J Ophthalmol</source>
<year>2006</year>
<volume>141</volume>
<fpage>167</fpage>
<lpage>74</lpage>
<pub-id pub-id-type="pmid">16386993</pub-id>
</element-citation>
</ref>
<ref id="r9">
<label>9</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hartong</surname>
<given-names>DT</given-names>
</name>
<name>
<surname>Berson</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Dryja</surname>
<given-names>T</given-names>
</name>
</person-group>
<article-title>Retinitis pigmentosa.</article-title>
<source>Lancet</source>
<year>2006</year>
<volume>368</volume>
<fpage>1795</fpage>
<lpage>809</lpage>
<pub-id pub-id-type="pmid">17113430</pub-id>
</element-citation>
</ref>
<ref id="r10">
<label>10</label>
<mixed-citation publication-type="book">Mackey D, Craig J. Glaucoma Inheritance Study in Tasmania: An International Collaboration. In: Ophthalmology AAo, editor. Basic Clinical Sciences Course Section 13 International Ophthalmology, Part 5. Collaborative Research. XXXIII. San Francisco: American Academy of Ophthalmology, 2002:265–69.</mixed-citation>
</ref>
<ref id="r11">
<label>11</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sack</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Healey</surname>
<given-names>DL</given-names>
</name>
<name>
<surname>de Graaf</surname>
<given-names>AP</given-names>
</name>
<name>
<surname>Wilkinson</surname>
<given-names>RM</given-names>
</name>
<name>
<surname>Wilkinson</surname>
<given-names>CH</given-names>
</name>
<name>
<surname>Barbour</surname>
<given-names>JM</given-names>
</name>
<name>
<surname>Coote</surname>
<given-names>MA</given-names>
</name>
<name>
<surname>McCartney</surname>
<given-names>PJ</given-names>
</name>
<name>
<surname>Rait</surname>
<given-names>JL</given-names>
</name>
<name>
<surname>Cooper</surname>
<given-names>RL</given-names>
</name>
<name>
<surname>Ring</surname>
<given-names>MA</given-names>
</name>
<name>
<surname>Mackey</surname>
<given-names>DA</given-names>
</name>
</person-group>
<article-title>The problem of overlapping glaucoma families in the Glaucoma Inheritance Study in Tasmania (GIST).</article-title>
<source>Ophthalmic Genet</source>
<year>1996</year>
<volume>17</volume>
<fpage>209</fpage>
<lpage>14</lpage>
<pub-id pub-id-type="pmid">9010872</pub-id>
</element-citation>
</ref>
<ref id="r12">
<label>12</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mackey</surname>
<given-names>DA</given-names>
</name>
<name>
<surname>Healey</surname>
<given-names>DL</given-names>
</name>
<name>
<surname>Fingert</surname>
<given-names>JH</given-names>
</name>
<name>
<surname>Coote</surname>
<given-names>MA</given-names>
</name>
<name>
<surname>Wong</surname>
<given-names>TL</given-names>
</name>
<name>
<surname>Wilkinson</surname>
<given-names>CH</given-names>
</name>
<name>
<surname>McCartney</surname>
<given-names>PJ</given-names>
</name>
<name>
<surname>Rait</surname>
<given-names>JL</given-names>
</name>
<name>
<surname>de Graaf</surname>
<given-names>AP</given-names>
</name>
<name>
<surname>Stone</surname>
<given-names>EM</given-names>
</name>
<name>
<surname>Craig</surname>
<given-names>JE</given-names>
</name>
</person-group>
<article-title>Glaucoma phenotype in pedigrees with the myocilin Thr377Met mutation.</article-title>
<source>Arch Ophthalmol</source>
<year>2003</year>
<volume>121</volume>
<fpage>1172</fpage>
<lpage>80</lpage>
<pub-id pub-id-type="pmid">12912696</pub-id>
</element-citation>
</ref>
<ref id="r13">
<label>13</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Toomes</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Downey</surname>
<given-names>LM</given-names>
</name>
<name>
<surname>Bottomley</surname>
<given-names>HM</given-names>
</name>
<name>
<surname>Mintz-Hittner</surname>
<given-names>HA</given-names>
</name>
<name>
<surname>Inglehearn</surname>
<given-names>CF</given-names>
</name>
</person-group>
<article-title>Further evidence of genetic heterogeneity in familial exudative vitreoretinopathy; exclusion of EVR1, EVR3, and EVR4 in a large autosomal dominant pedigree.</article-title>
<source>Br J Ophthalmol</source>
<year>2005</year>
<volume>89</volume>
<fpage>194</fpage>
<lpage>7</lpage>
<pub-id pub-id-type="pmid">15665352</pub-id>
</element-citation>
</ref>
<ref id="r14">
<label>14</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fingert</surname>
<given-names>JH</given-names>
</name>
<name>
<surname>Heon</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Liebmann</surname>
<given-names>JM</given-names>
</name>
<name>
<surname>Yamamoto</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Craig</surname>
<given-names>JE</given-names>
</name>
<name>
<surname>Rait</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Kawase</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Hoh</surname>
<given-names>ST</given-names>
</name>
<name>
<surname>Buys</surname>
<given-names>YM</given-names>
</name>
<name>
<surname>Dickinson</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Hockey</surname>
<given-names>RR</given-names>
</name>
<name>
<surname>Williams-Lyn</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Trope</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Kitazawa</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Ritch</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Mackey</surname>
<given-names>DA</given-names>
</name>
<name>
<surname>Alward</surname>
<given-names>WL</given-names>
</name>
<name>
<surname>Sheffield</surname>
<given-names>VC</given-names>
</name>
<name>
<surname>Stone</surname>
<given-names>EM</given-names>
</name>
</person-group>
<article-title>Analysis of myocilin mutations in 1703 glaucoma patients from five different populations.</article-title>
<source>Hum Mol Genet</source>
<year>1999</year>
<volume>8</volume>
<fpage>899</fpage>
<lpage>905</lpage>
<pub-id pub-id-type="pmid">10196380</pub-id>
</element-citation>
</ref>
<ref id="r15">
<label>15</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Poulter</surname>
<given-names>JA</given-names>
</name>
<name>
<surname>Ali</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Gilmour</surname>
<given-names>DF</given-names>
</name>
<name>
<surname>Rice</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Kondo</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Hayashi</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Mackey</surname>
<given-names>DA</given-names>
</name>
<name>
<surname>Kearns</surname>
<given-names>LS</given-names>
</name>
<name>
<surname>Ruddle</surname>
<given-names>JB</given-names>
</name>
<name>
<surname>Craig</surname>
<given-names>JE</given-names>
</name>
<name>
<surname>Pierce</surname>
<given-names>EA</given-names>
</name>
<name>
<surname>Downey</surname>
<given-names>LM</given-names>
</name>
<name>
<surname>Mohamed</surname>
<given-names>MD</given-names>
</name>
<name>
<surname>Markham</surname>
<given-names>AF</given-names>
</name>
<name>
<surname>Inglehearn</surname>
<given-names>CF</given-names>
</name>
<name>
<surname>Toomes</surname>
<given-names>C</given-names>
</name>
</person-group>
<article-title>Mutations in TSPAN12 cause autosomal-dominant familial exudative vitreoretinopathy.</article-title>
<source>Am J Hum Genet</source>
<year>2010</year>
<volume>86</volume>
<fpage>248</fpage>
<lpage>53</lpage>
<pub-id pub-id-type="pmid">20159112</pub-id>
</element-citation>
</ref>
<ref id="r16">
<label>16</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>YJ</given-names>
</name>
<name>
<surname>Guggenheim</surname>
<given-names>JA</given-names>
</name>
<name>
<surname>Bulusu</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Metlapally</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Abbott</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Malecaze</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Calvas</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Rosenberg</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Paget</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Creer</surname>
<given-names>RC</given-names>
</name>
<name>
<surname>Kirov</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Owen</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>B</given-names>
</name>
<name>
<surname>White</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Mackey</surname>
<given-names>DA</given-names>
</name>
<name>
<surname>Young</surname>
<given-names>TL</given-names>
</name>
</person-group>
<article-title>An international collaborative family-based whole-genome linkage scan for high-grade myopia.</article-title>
<source>Invest Ophthalmol Vis Sci</source>
<year>2009</year>
<volume>50</volume>
<fpage>3116</fpage>
<lpage>27</lpage>
<pub-id pub-id-type="pmid">19324860</pub-id>
</element-citation>
</ref>
<ref id="r17">
<label>17</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Epstein</surname>
<given-names>MP</given-names>
</name>
<name>
<surname>Duren</surname>
<given-names>WL</given-names>
</name>
<name>
<surname>Boehnke</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>Improved inference of relationship for pairs of individuals.</article-title>
<source>Am J Hum Genet</source>
<year>2000</year>
<volume>67</volume>
<fpage>1219</fpage>
<lpage>31</lpage>
<pub-id pub-id-type="pmid">11032786</pub-id>
</element-citation>
</ref>
<ref id="r18">
<label>18</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Toomes</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Bottomley</surname>
<given-names>HM</given-names>
</name>
<name>
<surname>Jackson</surname>
<given-names>RM</given-names>
</name>
<name>
<surname>Towns</surname>
<given-names>KV</given-names>
</name>
<name>
<surname>Scott</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Mackey</surname>
<given-names>DA</given-names>
</name>
<name>
<surname>Craig</surname>
<given-names>JE</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Trembath</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Woodruff</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Gregory-Evans</surname>
<given-names>CY</given-names>
</name>
<name>
<surname>Gregory-Evans</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Parker</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Black</surname>
<given-names>GC</given-names>
</name>
<name>
<surname>Downey</surname>
<given-names>LM</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Inglehearn</surname>
<given-names>CF</given-names>
</name>
</person-group>
<article-title>Mutations in LRP5 or FZD4 underlie the common familial exudative vitreoretinopathy locus on chromosome 11q.</article-title>
<source>Am J Hum Genet</source>
<year>2004</year>
<volume>74</volume>
<fpage>721</fpage>
<lpage>30</lpage>
<pub-id pub-id-type="pmid">15024691</pub-id>
</element-citation>
</ref>
<ref id="r19">
<label>19</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Toomes</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Bottomley</surname>
<given-names>HM</given-names>
</name>
<name>
<surname>Scott</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Mackey</surname>
<given-names>DA</given-names>
</name>
<name>
<surname>Craig</surname>
<given-names>JE</given-names>
</name>
<name>
<surname>Appukuttan</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Stout</surname>
<given-names>JT</given-names>
</name>
<name>
<surname>Flaxel</surname>
<given-names>CJ</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Black</surname>
<given-names>GC</given-names>
</name>
<name>
<surname>Fryer</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Downey</surname>
<given-names>LM</given-names>
</name>
<name>
<surname>Inglehearn</surname>
<given-names>CF</given-names>
</name>
</person-group>
<article-title>Spectrum and frequency of FZD4 mutations in familial exudative vitreoretinopathy.</article-title>
<source>Invest Ophthalmol Vis Sci</source>
<year>2004</year>
<volume>45</volume>
<fpage>2083</fpage>
<lpage>90</lpage>
<pub-id pub-id-type="pmid">15223780</pub-id>
</element-citation>
</ref>
<ref id="r20">
<label>20</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ragge</surname>
<given-names>NK</given-names>
</name>
<name>
<surname>Baser</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Riccardi</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Falk</surname>
<given-names>R</given-names>
</name>
</person-group>
<article-title>The ocular presentation of neurofibromatosis 2.</article-title>
<source>Eye (Lond)</source>
<year>1997</year>
<volume>11</volume>
<fpage>12</fpage>
<lpage>8</lpage>
<pub-id pub-id-type="pmid">9246269</pub-id>
</element-citation>
</ref>
<ref id="r21">
<label>21</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gicquel</surname>
<given-names>JJ</given-names>
</name>
<name>
<surname>Vabres</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Mercié</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Klossek</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Dighiero</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>Dragged disc syndrome in a patient presenting neurofibromatosis type II: a case study.</article-title>
<source>J Fr Ophtalmol</source>
<year>2005</year>
<volume>28</volume>
<fpage>527</fpage>
<lpage>9</lpage>
<pub-id pub-id-type="pmid">15976721</pub-id>
</element-citation>
</ref>
<ref id="r22">
<label>22</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Meyers</surname>
<given-names>SM</given-names>
</name>
<name>
<surname>Gutman</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Kaye</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Rothner</surname>
<given-names>A</given-names>
</name>
</person-group>
<article-title>Retinal changes associated with neurofibromatosis 2.</article-title>
<source>Trans Am Ophthalmol Soc</source>
<year>1995</year>
<volume>93</volume>
<fpage>245</fpage>
<lpage>52</lpage>
<pub-id pub-id-type="pmid">8719681</pub-id>
</element-citation>
</ref>
<ref id="r23">
<label>23</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Krämer</surname>
<given-names>F</given-names>
</name>
<name>
<surname>White</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Pauleikhoff</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Gehrig</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Passmore</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Rivera</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Rudolph</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Kellner</surname>
<given-names>U</given-names>
</name>
<name>
<surname>Andrassi</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Lorenz</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Rohrschneider</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Blankenagel</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Jurklies</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Schilling</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Schutt</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Holz</surname>
<given-names>FG</given-names>
</name>
<name>
<surname>Weber</surname>
<given-names>BH</given-names>
</name>
</person-group>
<article-title>Mutations in the VMD2 gene are associated with juvenile-onset vitelliform macular dystrophy (Best disease) and adult vitelliform macular dystrophy but not age-related macular degeneration.</article-title>
<source>Eur J Hum Genet</source>
<year>2000</year>
<volume>8</volume>
<fpage>286</fpage>
<lpage>92</lpage>
<pub-id pub-id-type="pmid">10854112</pub-id>
</element-citation>
</ref>
<ref id="r24">
<label>24</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ioachimescu</surname>
<given-names>OC</given-names>
</name>
<name>
<surname>Kavuru</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>Pulmonary alveolar proteinosis.</article-title>
<source>Chron Respir Dis</source>
<year>2006</year>
<volume>3</volume>
<fpage>149</fpage>
<lpage>59</lpage>
<pub-id pub-id-type="pmid">16916009</pub-id>
</element-citation>
</ref>
<ref id="r25">
<label>25</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Stambolian</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Ibay</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Reider</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Dana</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Moy</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Schlifka</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Holmes</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Ciner</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Bailey-Wilson</surname>
<given-names>JE</given-names>
</name>
</person-group>
<article-title>Genomewide linkage scan for myopia susceptibility loci among Ashkenazi Jewish families shows evidence of linkage on chromosome 22q12.</article-title>
<source>Am J Hum Genet</source>
<year>2004</year>
<volume>75</volume>
<fpage>448</fpage>
<lpage>59</lpage>
<pub-id pub-id-type="pmid">15273935</pub-id>
</element-citation>
</ref>
<ref id="r26">
<label>26</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Klein</surname>
<given-names>AP</given-names>
</name>
<name>
<surname>Duggal</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Klein</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Bailey-Wilson</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Klein</surname>
<given-names>B</given-names>
</name>
</person-group>
<article-title>Confirmation of linkage to ocular refraction on chromosome 22q and identification of a novel linkage region on 1q.</article-title>
<source>Arch Ophthalmol</source>
<year>2007</year>
<volume>125</volume>
<fpage>80</fpage>
<lpage>5</lpage>
<pub-id pub-id-type="pmid">17210856</pub-id>
</element-citation>
</ref>
<ref id="r27">
<label>27</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Clementi</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Angi</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Forabosco</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Di Gianantonio</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Tenconi</surname>
<given-names>R</given-names>
</name>
</person-group>
<article-title>Inheritance of astigmatism: evidence for a major autosomal dominant locus.</article-title>
<source>Am J Hum Genet</source>
<year>1998</year>
<volume>63</volume>
<fpage>825</fpage>
<lpage>30</lpage>
<pub-id pub-id-type="pmid">9718344</pub-id>
</element-citation>
</ref>
<ref id="r28">
<label>28</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hornbeak</surname>
<given-names>DM</given-names>
</name>
<name>
<surname>Young</surname>
<given-names>TL</given-names>
</name>
</person-group>
<article-title>Myopia genetics: a review of current research and emerging trends.</article-title>
<source>Curr Opin Ophthalmol</source>
<year>2009</year>
<volume>20</volume>
<fpage>356</fpage>
<lpage>62</lpage>
<pub-id pub-id-type="pmid">19587595</pub-id>
</element-citation>
</ref>
</ref-list>
</back>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Wicri/Asie/explor/AustralieFrV1/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 0027769 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 0027769 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Wicri/Asie
   |area=    AustralieFrV1
   |flux=    Pmc
   |étape=   Corpus
   |type=    RBID
   |clé=     
   |texte=   
}}

Wicri

This area was generated with Dilib version V0.6.33.
Data generation: Tue Dec 5 10:43:12 2017. Site generation: Tue Mar 5 14:07:20 2024