Links to Exploration step
Le document en format XML
<record><TEI><teiHeader><fileDesc><titleStmt><title xml:lang="en">Integrated Molecular Meta-Analysis of 1,000 Pediatric High-Grade and Diffuse Intrinsic Pontine Glioma</title>
<author><name sortKey="Mackay, Alan" sort="Mackay, Alan" uniqKey="Mackay A" first="Alan" last="Mackay">Alan Mackay</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Burford, Anna" sort="Burford, Anna" uniqKey="Burford A" first="Anna" last="Burford">Anna Burford</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Carvalho, Diana" sort="Carvalho, Diana" uniqKey="Carvalho D" first="Diana" last="Carvalho">Diana Carvalho</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Izquierdo, Elisa" sort="Izquierdo, Elisa" uniqKey="Izquierdo E" first="Elisa" last="Izquierdo">Elisa Izquierdo</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Fazal Salom, Janat" sort="Fazal Salom, Janat" uniqKey="Fazal Salom J" first="Janat" last="Fazal-Salom">Janat Fazal-Salom</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Taylor, Kathryn R" sort="Taylor, Kathryn R" uniqKey="Taylor K" first="Kathryn R." last="Taylor">Kathryn R. Taylor</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff3">Department of Neurology, Stanford University School of Medicine, Stanford, CA, USA</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Bjerke, Lynn" sort="Bjerke, Lynn" uniqKey="Bjerke L" first="Lynn" last="Bjerke">Lynn Bjerke</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Clarke, Matthew" sort="Clarke, Matthew" uniqKey="Clarke M" first="Matthew" last="Clarke">Matthew Clarke</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Vinci, Mara" sort="Vinci, Mara" uniqKey="Vinci M" first="Mara" last="Vinci">Mara Vinci</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Nandhabalan, Meera" sort="Nandhabalan, Meera" uniqKey="Nandhabalan M" first="Meera" last="Nandhabalan">Meera Nandhabalan</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Temelso, Sara" sort="Temelso, Sara" uniqKey="Temelso S" first="Sara" last="Temelso">Sara Temelso</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Popov, Sergey" sort="Popov, Sergey" uniqKey="Popov S" first="Sergey" last="Popov">Sergey Popov</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff4">Department of Cellular Pathology, University Hospital of Wales, Cardiff, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Molinari, Valeria" sort="Molinari, Valeria" uniqKey="Molinari V" first="Valeria" last="Molinari">Valeria Molinari</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Raman, Pichai" sort="Raman, Pichai" uniqKey="Raman P" first="Pichai" last="Raman">Pichai Raman</name>
<affiliation><nlm:aff id="aff5">The Center for Data Driven Discovery in Biomedicine (D<sup>3</sup>
b), Children's Hospital of Philadelphia, Philadelphia, PA, USA</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff6">Division of Neurosurgery, Children's Hospital of Philadelphia, Philadelphia, PA, USA</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Waanders, Angela J" sort="Waanders, Angela J" uniqKey="Waanders A" first="Angela J." last="Waanders">Angela J. Waanders</name>
<affiliation><nlm:aff id="aff5">The Center for Data Driven Discovery in Biomedicine (D<sup>3</sup>
b), Children's Hospital of Philadelphia, Philadelphia, PA, USA</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff7">Division of Oncology, Children's Hospital of Philadelphia, Philadelphia, PA, USA</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Han, Harry J" sort="Han, Harry J" uniqKey="Han H" first="Harry J." last="Han">Harry J. Han</name>
<affiliation><nlm:aff id="aff5">The Center for Data Driven Discovery in Biomedicine (D<sup>3</sup>
b), Children's Hospital of Philadelphia, Philadelphia, PA, USA</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff7">Division of Oncology, Children's Hospital of Philadelphia, Philadelphia, PA, USA</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Gupta, Saumya" sort="Gupta, Saumya" uniqKey="Gupta S" first="Saumya" last="Gupta">Saumya Gupta</name>
<affiliation><nlm:aff id="aff8">Institute of Molecular Life Sciences, Swiss Institute of Bioinformatics, University of Zürich, Zürich, Switzerland</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Marshall, Lynley" sort="Marshall, Lynley" uniqKey="Marshall L" first="Lynley" last="Marshall">Lynley Marshall</name>
<affiliation><nlm:aff id="aff9">Pediatric Oncology Drug Development Team, Children and Young People's Unit, Royal Marsden Hospital, Sutton, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Zacharoulis, Stergios" sort="Zacharoulis, Stergios" uniqKey="Zacharoulis S" first="Stergios" last="Zacharoulis">Stergios Zacharoulis</name>
<affiliation><nlm:aff id="aff9">Pediatric Oncology Drug Development Team, Children and Young People's Unit, Royal Marsden Hospital, Sutton, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Vaidya, Sucheta" sort="Vaidya, Sucheta" uniqKey="Vaidya S" first="Sucheta" last="Vaidya">Sucheta Vaidya</name>
<affiliation><nlm:aff id="aff9">Pediatric Oncology Drug Development Team, Children and Young People's Unit, Royal Marsden Hospital, Sutton, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Mandeville, Henry C" sort="Mandeville, Henry C" uniqKey="Mandeville H" first="Henry C." last="Mandeville">Henry C. Mandeville</name>
<affiliation><nlm:aff id="aff10">Department of Radiotherapy, Royal Marsden Hospital, Sutton, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Bridges, Leslie R" sort="Bridges, Leslie R" uniqKey="Bridges L" first="Leslie R." last="Bridges">Leslie R. Bridges</name>
<affiliation><nlm:aff id="aff11">Department of Cellular Pathology, St George's Hospital NHS Trust, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Martin, Andrew J" sort="Martin, Andrew J" uniqKey="Martin A" first="Andrew J." last="Martin">Andrew J. Martin</name>
<affiliation><nlm:aff id="aff12">Department of Neurosurgery, St George's Hospital NHS Trust, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Al Sarraj, Safa" sort="Al Sarraj, Safa" uniqKey="Al Sarraj S" first="Safa" last="Al-Sarraj">Safa Al-Sarraj</name>
<affiliation><nlm:aff id="aff13">Department of Neuropathology, Kings College Hospital, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Chandler, Christopher" sort="Chandler, Christopher" uniqKey="Chandler C" first="Christopher" last="Chandler">Christopher Chandler</name>
<affiliation><nlm:aff id="aff14">Department of Neurosurgery, Kings College Hospital, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Ng, Ho Keung" sort="Ng, Ho Keung" uniqKey="Ng H" first="Ho-Keung" last="Ng">Ho-Keung Ng</name>
<affiliation><nlm:aff id="aff15">Department of Anatomical and Cellular Pathology, The Chinese University of Hong Kong, Hong Kong, China</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Li, Xingang" sort="Li, Xingang" uniqKey="Li X" first="Xingang" last="Li">Xingang Li</name>
<affiliation><nlm:aff id="aff16">Department of Neurosurgery, Qilu Hospital of Shandong University and Brain Science Research Institute, Shandong University, Jinan, China</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Mu, Kun" sort="Mu, Kun" uniqKey="Mu K" first="Kun" last="Mu">Kun Mu</name>
<affiliation><nlm:aff id="aff17">Department of Pathology, Shandong University School of Medicine, Jinan, China</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Trabelsi, Saoussen" sort="Trabelsi, Saoussen" uniqKey="Trabelsi S" first="Saoussen" last="Trabelsi">Saoussen Trabelsi</name>
<affiliation><nlm:aff id="aff18">Department of Cytogenetics and Reproductive Biology, Farhat Hached Hospital, Sousse, Tunisia</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Brahim, Dorra H Ida Ben" sort="Brahim, Dorra H Ida Ben" uniqKey="Brahim D" first="Dorra H Ida-Ben" last="Brahim">Dorra H Ida-Ben Brahim</name>
<affiliation><nlm:aff id="aff18">Department of Cytogenetics and Reproductive Biology, Farhat Hached Hospital, Sousse, Tunisia</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Kisljakov, Alexei N" sort="Kisljakov, Alexei N" uniqKey="Kisljakov A" first="Alexei N." last="Kisljakov">Alexei N. Kisljakov</name>
<affiliation><nlm:aff id="aff19">Department of Pathology, Morozov Children's Hospital, Moscow, Russian Federation</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Konovalov, Dmitry M" sort="Konovalov, Dmitry M" uniqKey="Konovalov D" first="Dmitry M." last="Konovalov">Dmitry M. Konovalov</name>
<affiliation><nlm:aff id="aff20">Department of Pathology, Dmitrii Rogachev Research and Clinical Centre of Pediatric Hematology, Oncology and Immunology, Moscow, Russian Federation</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Moore, Andrew S" sort="Moore, Andrew S" uniqKey="Moore A" first="Andrew S." last="Moore">Andrew S. Moore</name>
<affiliation><nlm:aff id="aff21">UQ Child Health Research Centre, The University of Queensland, Brisbane, Australia</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff22">Oncology Services Group, Children's Health Queensland Hospital and Health Service, Brisbane, Australia</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff23">The University of Queensland Diamantina Institute, Translational Research Institute, Brisbane, Australia</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Carcaboso, Angel Montero" sort="Carcaboso, Angel Montero" uniqKey="Carcaboso A" first="Angel Montero" last="Carcaboso">Angel Montero Carcaboso</name>
<affiliation><nlm:aff id="aff24">Institut de Recerca Sant Joan de Deu, Barcelona, Spain</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Sunol, Mariona" sort="Sunol, Mariona" uniqKey="Sunol M" first="Mariona" last="Sunol">Mariona Sunol</name>
<affiliation><nlm:aff id="aff24">Institut de Recerca Sant Joan de Deu, Barcelona, Spain</nlm:aff>
</affiliation>
</author>
<author><name sortKey="De Torres, Carmen" sort="De Torres, Carmen" uniqKey="De Torres C" first="Carmen" last="De Torres">Carmen De Torres</name>
<affiliation><nlm:aff id="aff24">Institut de Recerca Sant Joan de Deu, Barcelona, Spain</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Cruz, Ofelia" sort="Cruz, Ofelia" uniqKey="Cruz O" first="Ofelia" last="Cruz">Ofelia Cruz</name>
<affiliation><nlm:aff id="aff24">Institut de Recerca Sant Joan de Deu, Barcelona, Spain</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Mora, Jaume" sort="Mora, Jaume" uniqKey="Mora J" first="Jaume" last="Mora">Jaume Mora</name>
<affiliation><nlm:aff id="aff24">Institut de Recerca Sant Joan de Deu, Barcelona, Spain</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Shats, Ludmila I" sort="Shats, Ludmila I" uniqKey="Shats L" first="Ludmila I." last="Shats">Ludmila I. Shats</name>
<affiliation><nlm:aff id="aff25">Division of Oncology, Pediatric Oncology and Radiotherapy, St Petersburg State Pediatric Medical University, St Petersburg, Russian Federation</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Stavale, Joao N" sort="Stavale, Joao N" uniqKey="Stavale J" first="João N." last="Stavale">João N. Stavale</name>
<affiliation><nlm:aff id="aff26">Department of Pathology, Federal University of São Paulo, São Paulo, São Paulo, Brazil</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Bidinotto, Lucas T" sort="Bidinotto, Lucas T" uniqKey="Bidinotto L" first="Lucas T." last="Bidinotto">Lucas T. Bidinotto</name>
<affiliation><nlm:aff id="aff27">Molecular Oncology Research Centre, Barretos Cancer Hospital, Barretos, São Paulo, Brazil</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Reis, Rui M" sort="Reis, Rui M" uniqKey="Reis R" first="Rui M." last="Reis">Rui M. Reis</name>
<affiliation><nlm:aff id="aff27">Molecular Oncology Research Centre, Barretos Cancer Hospital, Barretos, São Paulo, Brazil</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff28">Life and Health Sciences Research Institute (ICVS), Medical School, University of Minho, Braga, Portugal and ICVS/3B's-PT Government Associate Laboratory, Braga/Guimarães, Portugal</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Entz Werle, Natacha" sort="Entz Werle, Natacha" uniqKey="Entz Werle N" first="Natacha" last="Entz-Werle">Natacha Entz-Werle</name>
<affiliation><nlm:aff id="aff29">Pédiatrie Onco-Hématologie - Pédiatrie III, Centre Hospitalier Régional et Universitaire Hautepierre, Strasbourg, France</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Farrell, Michael" sort="Farrell, Michael" uniqKey="Farrell M" first="Michael" last="Farrell">Michael Farrell</name>
<affiliation><nlm:aff id="aff30">Histopathology Department, Beaumont Hospital, Dublin, Ireland</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Cryan, Jane" sort="Cryan, Jane" uniqKey="Cryan J" first="Jane" last="Cryan">Jane Cryan</name>
<affiliation><nlm:aff id="aff30">Histopathology Department, Beaumont Hospital, Dublin, Ireland</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Crimmins, Darach" sort="Crimmins, Darach" uniqKey="Crimmins D" first="Darach" last="Crimmins">Darach Crimmins</name>
<affiliation><nlm:aff id="aff31">Department of Neurosurgery, Temple Street Children's University Hospital, Dublin, Ireland</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Caird, John" sort="Caird, John" uniqKey="Caird J" first="John" last="Caird">John Caird</name>
<affiliation><nlm:aff id="aff31">Department of Neurosurgery, Temple Street Children's University Hospital, Dublin, Ireland</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Pears, Jane" sort="Pears, Jane" uniqKey="Pears J" first="Jane" last="Pears">Jane Pears</name>
<affiliation><nlm:aff id="aff32">Department of Paediatric Oncology, Our Lady's Children's Hospital, Dublin, Ireland</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Monje, Michelle" sort="Monje, Michelle" uniqKey="Monje M" first="Michelle" last="Monje">Michelle Monje</name>
<affiliation><nlm:aff id="aff3">Department of Neurology, Stanford University School of Medicine, Stanford, CA, USA</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Debily, Marie Anne" sort="Debily, Marie Anne" uniqKey="Debily M" first="Marie-Anne" last="Debily">Marie-Anne Debily</name>
<affiliation><nlm:aff id="aff33">Département de Cancerologie de l'Enfant et de l'Adolescent, Institut Gustav Roussy, Villejuif, France</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Castel, David" sort="Castel, David" uniqKey="Castel D" first="David" last="Castel">David Castel</name>
<affiliation><nlm:aff id="aff33">Département de Cancerologie de l'Enfant et de l'Adolescent, Institut Gustav Roussy, Villejuif, France</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Grill, Jacques" sort="Grill, Jacques" uniqKey="Grill J" first="Jacques" last="Grill">Jacques Grill</name>
<affiliation><nlm:aff id="aff33">Département de Cancerologie de l'Enfant et de l'Adolescent, Institut Gustav Roussy, Villejuif, France</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Hawkins, Cynthia" sort="Hawkins, Cynthia" uniqKey="Hawkins C" first="Cynthia" last="Hawkins">Cynthia Hawkins</name>
<affiliation><nlm:aff id="aff34">Pediatric Laboratory Medicine, Hospital for Sick Children, Toronto, Canada</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Nikbakht, Hamid" sort="Nikbakht, Hamid" uniqKey="Nikbakht H" first="Hamid" last="Nikbakht">Hamid Nikbakht</name>
<affiliation><nlm:aff id="aff35">Department of Pediatrics, McGill University, Montreal, Canada</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Jabado, Nada" sort="Jabado, Nada" uniqKey="Jabado N" first="Nada" last="Jabado">Nada Jabado</name>
<affiliation><nlm:aff id="aff5">The Center for Data Driven Discovery in Biomedicine (D<sup>3</sup>
b), Children's Hospital of Philadelphia, Philadelphia, PA, USA</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Baker, Suzanne J" sort="Baker, Suzanne J" uniqKey="Baker S" first="Suzanne J." last="Baker">Suzanne J. Baker</name>
<affiliation><nlm:aff id="aff36">Department of Developmental Neurobiology, St Jude Children's Research Hospital, Memphis, TN, USA</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Pfister, Stefan M" sort="Pfister, Stefan M" uniqKey="Pfister S" first="Stefan M." last="Pfister">Stefan M. Pfister</name>
<affiliation><nlm:aff id="aff37">Division of Pediatric Neuro-oncology, German Cancer Research Center (DKFZ), Heidelberg, Germany</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff38">Department of Pediatric Hematology and Oncology, Heidelberg University Hospital, Heidelberg, Germany</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff43">Hopp-Children's Cancer Center at the NCT Heidelberg (KiTZ), Heidelberg, Germany</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Jones, David T W" sort="Jones, David T W" uniqKey="Jones D" first="David T. W." last="Jones">David T. W. Jones</name>
<affiliation><nlm:aff id="aff37">Division of Pediatric Neuro-oncology, German Cancer Research Center (DKFZ), Heidelberg, Germany</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff43">Hopp-Children's Cancer Center at the NCT Heidelberg (KiTZ), Heidelberg, Germany</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Fouladi, Maryam" sort="Fouladi, Maryam" uniqKey="Fouladi M" first="Maryam" last="Fouladi">Maryam Fouladi</name>
<affiliation><nlm:aff id="aff39">Department of Pediatrics, Cancer and Blood Diseases Institute, Cincinnati Children's Hospital, Cincinnati, OH, USA</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Von Bueren, Andre O" sort="Von Bueren, Andre O" uniqKey="Von Bueren A" first="André O." last="Von Bueren">André O. Von Bueren</name>
<affiliation><nlm:aff id="aff40">Department of Pediatrics, Division of Pediatric Hematology and Oncology, University Medical Center Goettingen, Goettingen, Germany</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff41">Department of Pediatrics and Adolescent Medicine, Division of Pediatric Hematology and Oncology, University Hospital of Geneva, Geneva, Switzerland</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff42">Department of Pediatrics, CANSEARCH Research Laboratory, Faculty of Medicine, University of Geneva, Geneva, Switzerland</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Baudis, Michael" sort="Baudis, Michael" uniqKey="Baudis M" first="Michael" last="Baudis">Michael Baudis</name>
<affiliation><nlm:aff id="aff8">Institute of Molecular Life Sciences, Swiss Institute of Bioinformatics, University of Zürich, Zürich, Switzerland</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Resnick, Adam" sort="Resnick, Adam" uniqKey="Resnick A" first="Adam" last="Resnick">Adam Resnick</name>
<affiliation><nlm:aff id="aff5">The Center for Data Driven Discovery in Biomedicine (D<sup>3</sup>
b), Children's Hospital of Philadelphia, Philadelphia, PA, USA</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff6">Division of Neurosurgery, Children's Hospital of Philadelphia, Philadelphia, PA, USA</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff7">Division of Oncology, Children's Hospital of Philadelphia, Philadelphia, PA, USA</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Jones, Chris" sort="Jones, Chris" uniqKey="Jones C" first="Chris" last="Jones">Chris Jones</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt><idno type="wicri:source">PMC</idno>
<idno type="pmid">28966033</idno>
<idno type="pmc">5637314</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5637314</idno>
<idno type="RBID">PMC:5637314</idno>
<idno type="doi">10.1016/j.ccell.2017.08.017</idno>
<date when="2017">2017</date>
<idno type="wicri:Area/Pmc/Corpus">002363</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">002363</idno>
</publicationStmt>
<sourceDesc><biblStruct><analytic><title xml:lang="en" level="a" type="main">Integrated Molecular Meta-Analysis of 1,000 Pediatric High-Grade and Diffuse Intrinsic Pontine Glioma</title>
<author><name sortKey="Mackay, Alan" sort="Mackay, Alan" uniqKey="Mackay A" first="Alan" last="Mackay">Alan Mackay</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Burford, Anna" sort="Burford, Anna" uniqKey="Burford A" first="Anna" last="Burford">Anna Burford</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Carvalho, Diana" sort="Carvalho, Diana" uniqKey="Carvalho D" first="Diana" last="Carvalho">Diana Carvalho</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Izquierdo, Elisa" sort="Izquierdo, Elisa" uniqKey="Izquierdo E" first="Elisa" last="Izquierdo">Elisa Izquierdo</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Fazal Salom, Janat" sort="Fazal Salom, Janat" uniqKey="Fazal Salom J" first="Janat" last="Fazal-Salom">Janat Fazal-Salom</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Taylor, Kathryn R" sort="Taylor, Kathryn R" uniqKey="Taylor K" first="Kathryn R." last="Taylor">Kathryn R. Taylor</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff3">Department of Neurology, Stanford University School of Medicine, Stanford, CA, USA</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Bjerke, Lynn" sort="Bjerke, Lynn" uniqKey="Bjerke L" first="Lynn" last="Bjerke">Lynn Bjerke</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Clarke, Matthew" sort="Clarke, Matthew" uniqKey="Clarke M" first="Matthew" last="Clarke">Matthew Clarke</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Vinci, Mara" sort="Vinci, Mara" uniqKey="Vinci M" first="Mara" last="Vinci">Mara Vinci</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Nandhabalan, Meera" sort="Nandhabalan, Meera" uniqKey="Nandhabalan M" first="Meera" last="Nandhabalan">Meera Nandhabalan</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Temelso, Sara" sort="Temelso, Sara" uniqKey="Temelso S" first="Sara" last="Temelso">Sara Temelso</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Popov, Sergey" sort="Popov, Sergey" uniqKey="Popov S" first="Sergey" last="Popov">Sergey Popov</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff4">Department of Cellular Pathology, University Hospital of Wales, Cardiff, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Molinari, Valeria" sort="Molinari, Valeria" uniqKey="Molinari V" first="Valeria" last="Molinari">Valeria Molinari</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Raman, Pichai" sort="Raman, Pichai" uniqKey="Raman P" first="Pichai" last="Raman">Pichai Raman</name>
<affiliation><nlm:aff id="aff5">The Center for Data Driven Discovery in Biomedicine (D<sup>3</sup>
b), Children's Hospital of Philadelphia, Philadelphia, PA, USA</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff6">Division of Neurosurgery, Children's Hospital of Philadelphia, Philadelphia, PA, USA</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Waanders, Angela J" sort="Waanders, Angela J" uniqKey="Waanders A" first="Angela J." last="Waanders">Angela J. Waanders</name>
<affiliation><nlm:aff id="aff5">The Center for Data Driven Discovery in Biomedicine (D<sup>3</sup>
b), Children's Hospital of Philadelphia, Philadelphia, PA, USA</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff7">Division of Oncology, Children's Hospital of Philadelphia, Philadelphia, PA, USA</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Han, Harry J" sort="Han, Harry J" uniqKey="Han H" first="Harry J." last="Han">Harry J. Han</name>
<affiliation><nlm:aff id="aff5">The Center for Data Driven Discovery in Biomedicine (D<sup>3</sup>
b), Children's Hospital of Philadelphia, Philadelphia, PA, USA</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff7">Division of Oncology, Children's Hospital of Philadelphia, Philadelphia, PA, USA</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Gupta, Saumya" sort="Gupta, Saumya" uniqKey="Gupta S" first="Saumya" last="Gupta">Saumya Gupta</name>
<affiliation><nlm:aff id="aff8">Institute of Molecular Life Sciences, Swiss Institute of Bioinformatics, University of Zürich, Zürich, Switzerland</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Marshall, Lynley" sort="Marshall, Lynley" uniqKey="Marshall L" first="Lynley" last="Marshall">Lynley Marshall</name>
<affiliation><nlm:aff id="aff9">Pediatric Oncology Drug Development Team, Children and Young People's Unit, Royal Marsden Hospital, Sutton, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Zacharoulis, Stergios" sort="Zacharoulis, Stergios" uniqKey="Zacharoulis S" first="Stergios" last="Zacharoulis">Stergios Zacharoulis</name>
<affiliation><nlm:aff id="aff9">Pediatric Oncology Drug Development Team, Children and Young People's Unit, Royal Marsden Hospital, Sutton, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Vaidya, Sucheta" sort="Vaidya, Sucheta" uniqKey="Vaidya S" first="Sucheta" last="Vaidya">Sucheta Vaidya</name>
<affiliation><nlm:aff id="aff9">Pediatric Oncology Drug Development Team, Children and Young People's Unit, Royal Marsden Hospital, Sutton, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Mandeville, Henry C" sort="Mandeville, Henry C" uniqKey="Mandeville H" first="Henry C." last="Mandeville">Henry C. Mandeville</name>
<affiliation><nlm:aff id="aff10">Department of Radiotherapy, Royal Marsden Hospital, Sutton, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Bridges, Leslie R" sort="Bridges, Leslie R" uniqKey="Bridges L" first="Leslie R." last="Bridges">Leslie R. Bridges</name>
<affiliation><nlm:aff id="aff11">Department of Cellular Pathology, St George's Hospital NHS Trust, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Martin, Andrew J" sort="Martin, Andrew J" uniqKey="Martin A" first="Andrew J." last="Martin">Andrew J. Martin</name>
<affiliation><nlm:aff id="aff12">Department of Neurosurgery, St George's Hospital NHS Trust, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Al Sarraj, Safa" sort="Al Sarraj, Safa" uniqKey="Al Sarraj S" first="Safa" last="Al-Sarraj">Safa Al-Sarraj</name>
<affiliation><nlm:aff id="aff13">Department of Neuropathology, Kings College Hospital, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Chandler, Christopher" sort="Chandler, Christopher" uniqKey="Chandler C" first="Christopher" last="Chandler">Christopher Chandler</name>
<affiliation><nlm:aff id="aff14">Department of Neurosurgery, Kings College Hospital, London, UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Ng, Ho Keung" sort="Ng, Ho Keung" uniqKey="Ng H" first="Ho-Keung" last="Ng">Ho-Keung Ng</name>
<affiliation><nlm:aff id="aff15">Department of Anatomical and Cellular Pathology, The Chinese University of Hong Kong, Hong Kong, China</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Li, Xingang" sort="Li, Xingang" uniqKey="Li X" first="Xingang" last="Li">Xingang Li</name>
<affiliation><nlm:aff id="aff16">Department of Neurosurgery, Qilu Hospital of Shandong University and Brain Science Research Institute, Shandong University, Jinan, China</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Mu, Kun" sort="Mu, Kun" uniqKey="Mu K" first="Kun" last="Mu">Kun Mu</name>
<affiliation><nlm:aff id="aff17">Department of Pathology, Shandong University School of Medicine, Jinan, China</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Trabelsi, Saoussen" sort="Trabelsi, Saoussen" uniqKey="Trabelsi S" first="Saoussen" last="Trabelsi">Saoussen Trabelsi</name>
<affiliation><nlm:aff id="aff18">Department of Cytogenetics and Reproductive Biology, Farhat Hached Hospital, Sousse, Tunisia</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Brahim, Dorra H Ida Ben" sort="Brahim, Dorra H Ida Ben" uniqKey="Brahim D" first="Dorra H Ida-Ben" last="Brahim">Dorra H Ida-Ben Brahim</name>
<affiliation><nlm:aff id="aff18">Department of Cytogenetics and Reproductive Biology, Farhat Hached Hospital, Sousse, Tunisia</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Kisljakov, Alexei N" sort="Kisljakov, Alexei N" uniqKey="Kisljakov A" first="Alexei N." last="Kisljakov">Alexei N. Kisljakov</name>
<affiliation><nlm:aff id="aff19">Department of Pathology, Morozov Children's Hospital, Moscow, Russian Federation</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Konovalov, Dmitry M" sort="Konovalov, Dmitry M" uniqKey="Konovalov D" first="Dmitry M." last="Konovalov">Dmitry M. Konovalov</name>
<affiliation><nlm:aff id="aff20">Department of Pathology, Dmitrii Rogachev Research and Clinical Centre of Pediatric Hematology, Oncology and Immunology, Moscow, Russian Federation</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Moore, Andrew S" sort="Moore, Andrew S" uniqKey="Moore A" first="Andrew S." last="Moore">Andrew S. Moore</name>
<affiliation><nlm:aff id="aff21">UQ Child Health Research Centre, The University of Queensland, Brisbane, Australia</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff22">Oncology Services Group, Children's Health Queensland Hospital and Health Service, Brisbane, Australia</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff23">The University of Queensland Diamantina Institute, Translational Research Institute, Brisbane, Australia</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Carcaboso, Angel Montero" sort="Carcaboso, Angel Montero" uniqKey="Carcaboso A" first="Angel Montero" last="Carcaboso">Angel Montero Carcaboso</name>
<affiliation><nlm:aff id="aff24">Institut de Recerca Sant Joan de Deu, Barcelona, Spain</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Sunol, Mariona" sort="Sunol, Mariona" uniqKey="Sunol M" first="Mariona" last="Sunol">Mariona Sunol</name>
<affiliation><nlm:aff id="aff24">Institut de Recerca Sant Joan de Deu, Barcelona, Spain</nlm:aff>
</affiliation>
</author>
<author><name sortKey="De Torres, Carmen" sort="De Torres, Carmen" uniqKey="De Torres C" first="Carmen" last="De Torres">Carmen De Torres</name>
<affiliation><nlm:aff id="aff24">Institut de Recerca Sant Joan de Deu, Barcelona, Spain</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Cruz, Ofelia" sort="Cruz, Ofelia" uniqKey="Cruz O" first="Ofelia" last="Cruz">Ofelia Cruz</name>
<affiliation><nlm:aff id="aff24">Institut de Recerca Sant Joan de Deu, Barcelona, Spain</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Mora, Jaume" sort="Mora, Jaume" uniqKey="Mora J" first="Jaume" last="Mora">Jaume Mora</name>
<affiliation><nlm:aff id="aff24">Institut de Recerca Sant Joan de Deu, Barcelona, Spain</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Shats, Ludmila I" sort="Shats, Ludmila I" uniqKey="Shats L" first="Ludmila I." last="Shats">Ludmila I. Shats</name>
<affiliation><nlm:aff id="aff25">Division of Oncology, Pediatric Oncology and Radiotherapy, St Petersburg State Pediatric Medical University, St Petersburg, Russian Federation</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Stavale, Joao N" sort="Stavale, Joao N" uniqKey="Stavale J" first="João N." last="Stavale">João N. Stavale</name>
<affiliation><nlm:aff id="aff26">Department of Pathology, Federal University of São Paulo, São Paulo, São Paulo, Brazil</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Bidinotto, Lucas T" sort="Bidinotto, Lucas T" uniqKey="Bidinotto L" first="Lucas T." last="Bidinotto">Lucas T. Bidinotto</name>
<affiliation><nlm:aff id="aff27">Molecular Oncology Research Centre, Barretos Cancer Hospital, Barretos, São Paulo, Brazil</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Reis, Rui M" sort="Reis, Rui M" uniqKey="Reis R" first="Rui M." last="Reis">Rui M. Reis</name>
<affiliation><nlm:aff id="aff27">Molecular Oncology Research Centre, Barretos Cancer Hospital, Barretos, São Paulo, Brazil</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff28">Life and Health Sciences Research Institute (ICVS), Medical School, University of Minho, Braga, Portugal and ICVS/3B's-PT Government Associate Laboratory, Braga/Guimarães, Portugal</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Entz Werle, Natacha" sort="Entz Werle, Natacha" uniqKey="Entz Werle N" first="Natacha" last="Entz-Werle">Natacha Entz-Werle</name>
<affiliation><nlm:aff id="aff29">Pédiatrie Onco-Hématologie - Pédiatrie III, Centre Hospitalier Régional et Universitaire Hautepierre, Strasbourg, France</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Farrell, Michael" sort="Farrell, Michael" uniqKey="Farrell M" first="Michael" last="Farrell">Michael Farrell</name>
<affiliation><nlm:aff id="aff30">Histopathology Department, Beaumont Hospital, Dublin, Ireland</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Cryan, Jane" sort="Cryan, Jane" uniqKey="Cryan J" first="Jane" last="Cryan">Jane Cryan</name>
<affiliation><nlm:aff id="aff30">Histopathology Department, Beaumont Hospital, Dublin, Ireland</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Crimmins, Darach" sort="Crimmins, Darach" uniqKey="Crimmins D" first="Darach" last="Crimmins">Darach Crimmins</name>
<affiliation><nlm:aff id="aff31">Department of Neurosurgery, Temple Street Children's University Hospital, Dublin, Ireland</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Caird, John" sort="Caird, John" uniqKey="Caird J" first="John" last="Caird">John Caird</name>
<affiliation><nlm:aff id="aff31">Department of Neurosurgery, Temple Street Children's University Hospital, Dublin, Ireland</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Pears, Jane" sort="Pears, Jane" uniqKey="Pears J" first="Jane" last="Pears">Jane Pears</name>
<affiliation><nlm:aff id="aff32">Department of Paediatric Oncology, Our Lady's Children's Hospital, Dublin, Ireland</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Monje, Michelle" sort="Monje, Michelle" uniqKey="Monje M" first="Michelle" last="Monje">Michelle Monje</name>
<affiliation><nlm:aff id="aff3">Department of Neurology, Stanford University School of Medicine, Stanford, CA, USA</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Debily, Marie Anne" sort="Debily, Marie Anne" uniqKey="Debily M" first="Marie-Anne" last="Debily">Marie-Anne Debily</name>
<affiliation><nlm:aff id="aff33">Département de Cancerologie de l'Enfant et de l'Adolescent, Institut Gustav Roussy, Villejuif, France</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Castel, David" sort="Castel, David" uniqKey="Castel D" first="David" last="Castel">David Castel</name>
<affiliation><nlm:aff id="aff33">Département de Cancerologie de l'Enfant et de l'Adolescent, Institut Gustav Roussy, Villejuif, France</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Grill, Jacques" sort="Grill, Jacques" uniqKey="Grill J" first="Jacques" last="Grill">Jacques Grill</name>
<affiliation><nlm:aff id="aff33">Département de Cancerologie de l'Enfant et de l'Adolescent, Institut Gustav Roussy, Villejuif, France</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Hawkins, Cynthia" sort="Hawkins, Cynthia" uniqKey="Hawkins C" first="Cynthia" last="Hawkins">Cynthia Hawkins</name>
<affiliation><nlm:aff id="aff34">Pediatric Laboratory Medicine, Hospital for Sick Children, Toronto, Canada</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Nikbakht, Hamid" sort="Nikbakht, Hamid" uniqKey="Nikbakht H" first="Hamid" last="Nikbakht">Hamid Nikbakht</name>
<affiliation><nlm:aff id="aff35">Department of Pediatrics, McGill University, Montreal, Canada</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Jabado, Nada" sort="Jabado, Nada" uniqKey="Jabado N" first="Nada" last="Jabado">Nada Jabado</name>
<affiliation><nlm:aff id="aff5">The Center for Data Driven Discovery in Biomedicine (D<sup>3</sup>
b), Children's Hospital of Philadelphia, Philadelphia, PA, USA</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Baker, Suzanne J" sort="Baker, Suzanne J" uniqKey="Baker S" first="Suzanne J." last="Baker">Suzanne J. Baker</name>
<affiliation><nlm:aff id="aff36">Department of Developmental Neurobiology, St Jude Children's Research Hospital, Memphis, TN, USA</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Pfister, Stefan M" sort="Pfister, Stefan M" uniqKey="Pfister S" first="Stefan M." last="Pfister">Stefan M. Pfister</name>
<affiliation><nlm:aff id="aff37">Division of Pediatric Neuro-oncology, German Cancer Research Center (DKFZ), Heidelberg, Germany</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff38">Department of Pediatric Hematology and Oncology, Heidelberg University Hospital, Heidelberg, Germany</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff43">Hopp-Children's Cancer Center at the NCT Heidelberg (KiTZ), Heidelberg, Germany</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Jones, David T W" sort="Jones, David T W" uniqKey="Jones D" first="David T. W." last="Jones">David T. W. Jones</name>
<affiliation><nlm:aff id="aff37">Division of Pediatric Neuro-oncology, German Cancer Research Center (DKFZ), Heidelberg, Germany</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff43">Hopp-Children's Cancer Center at the NCT Heidelberg (KiTZ), Heidelberg, Germany</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Fouladi, Maryam" sort="Fouladi, Maryam" uniqKey="Fouladi M" first="Maryam" last="Fouladi">Maryam Fouladi</name>
<affiliation><nlm:aff id="aff39">Department of Pediatrics, Cancer and Blood Diseases Institute, Cincinnati Children's Hospital, Cincinnati, OH, USA</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Von Bueren, Andre O" sort="Von Bueren, Andre O" uniqKey="Von Bueren A" first="André O." last="Von Bueren">André O. Von Bueren</name>
<affiliation><nlm:aff id="aff40">Department of Pediatrics, Division of Pediatric Hematology and Oncology, University Medical Center Goettingen, Goettingen, Germany</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff41">Department of Pediatrics and Adolescent Medicine, Division of Pediatric Hematology and Oncology, University Hospital of Geneva, Geneva, Switzerland</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff42">Department of Pediatrics, CANSEARCH Research Laboratory, Faculty of Medicine, University of Geneva, Geneva, Switzerland</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Baudis, Michael" sort="Baudis, Michael" uniqKey="Baudis M" first="Michael" last="Baudis">Michael Baudis</name>
<affiliation><nlm:aff id="aff8">Institute of Molecular Life Sciences, Swiss Institute of Bioinformatics, University of Zürich, Zürich, Switzerland</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Resnick, Adam" sort="Resnick, Adam" uniqKey="Resnick A" first="Adam" last="Resnick">Adam Resnick</name>
<affiliation><nlm:aff id="aff5">The Center for Data Driven Discovery in Biomedicine (D<sup>3</sup>
b), Children's Hospital of Philadelphia, Philadelphia, PA, USA</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff6">Division of Neurosurgery, Children's Hospital of Philadelphia, Philadelphia, PA, USA</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff7">Division of Oncology, Children's Hospital of Philadelphia, Philadelphia, PA, USA</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Jones, Chris" sort="Jones, Chris" uniqKey="Jones C" first="Chris" last="Jones">Chris Jones</name>
<affiliation><nlm:aff id="aff1">Division of Molecular Pathology, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2">Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</nlm:aff>
</affiliation>
</author>
</analytic>
<series><title level="j">Cancer Cell</title>
<idno type="ISSN">1535-6108</idno>
<idno type="eISSN">1878-3686</idno>
<imprint><date when="2017">2017</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc><textClass></textClass>
</profileDesc>
</teiHeader>
<front><div type="abstract" xml:lang="en"><title>Summary</title>
<p>We collated data from 157 unpublished cases of pediatric high-grade glioma and diffuse intrinsic pontine glioma and 20 publicly available datasets in an integrated analysis of >1,000 cases. We identified co-segregating mutations in histone-mutant subgroups including loss of <italic>FBXW7</italic>
in H3.3G34R/V, <italic>TOP3A</italic>
rearrangements in H3.3K27M, and <italic>BCOR</italic>
mutations in H3.1K27M. Histone wild-type subgroups are refined by the presence of key oncogenic events or methylation profiles more closely resembling lower-grade tumors. Genomic aberrations increase with age, highlighting the infant population as biologically and clinically distinct. Uncommon pathway dysregulation is seen in small subsets of tumors, further defining the molecular diversity of the disease, opening up avenues for biological study and providing a basis for functionally defined future treatment stratification.</p>
</div>
</front>
<back><div1 type="bibliography"><listBibl><biblStruct><analytic><author><name sortKey="Baker, S J" uniqKey="Baker S">S.J. Baker</name>
</author>
<author><name sortKey="Ellison, D W" uniqKey="Ellison D">D.W. Ellison</name>
</author>
<author><name sortKey="Gutmann, D H" uniqKey="Gutmann D">D.H. Gutmann</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Barrow, J" uniqKey="Barrow J">J. Barrow</name>
</author>
<author><name sortKey="Adamowicz Brice, M" uniqKey="Adamowicz Brice M">M. Adamowicz-Brice</name>
</author>
<author><name sortKey="Cartmill, M" uniqKey="Cartmill M">M. Cartmill</name>
</author>
<author><name sortKey="Macarthur, D" uniqKey="Macarthur D">D. MacArthur</name>
</author>
<author><name sortKey="Lowe, J" uniqKey="Lowe J">J. Lowe</name>
</author>
<author><name sortKey="Robson, K" uniqKey="Robson K">K. Robson</name>
</author>
<author><name sortKey="Brundler, M A" uniqKey="Brundler M">M.A. Brundler</name>
</author>
<author><name sortKey="Walker, D A" uniqKey="Walker D">D.A. Walker</name>
</author>
<author><name sortKey="Coyle, B" uniqKey="Coyle B">B. Coyle</name>
</author>
<author><name sortKey="Grundy, R" uniqKey="Grundy R">R. Grundy</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Bax, D A" uniqKey="Bax D">D.A. Bax</name>
</author>
<author><name sortKey="Mackay, A" uniqKey="Mackay A">A. Mackay</name>
</author>
<author><name sortKey="Little, S E" uniqKey="Little S">S.E. Little</name>
</author>
<author><name sortKey="Carvalho, D" uniqKey="Carvalho D">D. Carvalho</name>
</author>
<author><name sortKey="Viana Pereira, M" uniqKey="Viana Pereira M">M. Viana-Pereira</name>
</author>
<author><name sortKey="Tamber, N" uniqKey="Tamber N">N. Tamber</name>
</author>
<author><name sortKey="Grigoriadis, A E" uniqKey="Grigoriadis A">A.E. Grigoriadis</name>
</author>
<author><name sortKey="Ashworth, A" uniqKey="Ashworth A">A. Ashworth</name>
</author>
<author><name sortKey="Reis, R M" uniqKey="Reis R">R.M. Reis</name>
</author>
<author><name sortKey="Ellison, D W" uniqKey="Ellison D">D.W. Ellison</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Bender, S" uniqKey="Bender S">S. Bender</name>
</author>
<author><name sortKey="Tang, Y" uniqKey="Tang Y">Y. Tang</name>
</author>
<author><name sortKey="Lindroth, A M" uniqKey="Lindroth A">A.M. Lindroth</name>
</author>
<author><name sortKey="Hovestadt, V" uniqKey="Hovestadt V">V. Hovestadt</name>
</author>
<author><name sortKey="Jones, D T" uniqKey="Jones D">D.T. Jones</name>
</author>
<author><name sortKey="Kool, M" uniqKey="Kool M">M. Kool</name>
</author>
<author><name sortKey="Zapatka, M" uniqKey="Zapatka M">M. Zapatka</name>
</author>
<author><name sortKey="Northcott, P A" uniqKey="Northcott P">P.A. Northcott</name>
</author>
<author><name sortKey="Sturm, D" uniqKey="Sturm D">D. Sturm</name>
</author>
<author><name sortKey="Wang, W" uniqKey="Wang W">W. Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Bjerke, L" uniqKey="Bjerke L">L. Bjerke</name>
</author>
<author><name sortKey="Mackay, A" uniqKey="Mackay A">A. Mackay</name>
</author>
<author><name sortKey="Nandhabalan, M" uniqKey="Nandhabalan M">M. Nandhabalan</name>
</author>
<author><name sortKey="Burford, A" uniqKey="Burford A">A. Burford</name>
</author>
<author><name sortKey="Jury, A" uniqKey="Jury A">A. Jury</name>
</author>
<author><name sortKey="Popov, S" uniqKey="Popov S">S. Popov</name>
</author>
<author><name sortKey="Bax, D A" uniqKey="Bax D">D.A. Bax</name>
</author>
<author><name sortKey="Carvalho, D" uniqKey="Carvalho D">D. Carvalho</name>
</author>
<author><name sortKey="Taylor, K R" uniqKey="Taylor K">K.R. Taylor</name>
</author>
<author><name sortKey="Vinci, M" uniqKey="Vinci M">M. Vinci</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Bouffet, E" uniqKey="Bouffet E">E. Bouffet</name>
</author>
<author><name sortKey="Larouche, V" uniqKey="Larouche V">V. Larouche</name>
</author>
<author><name sortKey="Campbell, B B" uniqKey="Campbell B">B.B. Campbell</name>
</author>
<author><name sortKey="Merico, D" uniqKey="Merico D">D. Merico</name>
</author>
<author><name sortKey="De Borja, R" uniqKey="De Borja R">R. de Borja</name>
</author>
<author><name sortKey="Aronson, M" uniqKey="Aronson M">M. Aronson</name>
</author>
<author><name sortKey="Durno, C" uniqKey="Durno C">C. Durno</name>
</author>
<author><name sortKey="Krueger, J" uniqKey="Krueger J">J. Krueger</name>
</author>
<author><name sortKey="Cabric, V" uniqKey="Cabric V">V. Cabric</name>
</author>
<author><name sortKey="Ramaswamy, V" uniqKey="Ramaswamy V">V. Ramaswamy</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Buczkowicz, P" uniqKey="Buczkowicz P">P. Buczkowicz</name>
</author>
<author><name sortKey="Hoeman, C" uniqKey="Hoeman C">C. Hoeman</name>
</author>
<author><name sortKey="Rakopoulos, P" uniqKey="Rakopoulos P">P. Rakopoulos</name>
</author>
<author><name sortKey="Pajovic, S" uniqKey="Pajovic S">S. Pajovic</name>
</author>
<author><name sortKey="Letourneau, L" uniqKey="Letourneau L">L. Letourneau</name>
</author>
<author><name sortKey="Dzamba, M" uniqKey="Dzamba M">M. Dzamba</name>
</author>
<author><name sortKey="Morrison, A" uniqKey="Morrison A">A. Morrison</name>
</author>
<author><name sortKey="Lewis, P" uniqKey="Lewis P">P. Lewis</name>
</author>
<author><name sortKey="Bouffet, E" uniqKey="Bouffet E">E. Bouffet</name>
</author>
<author><name sortKey="Bartels, U" uniqKey="Bartels U">U. Bartels</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Cai, H" uniqKey="Cai H">H. Cai</name>
</author>
<author><name sortKey="Kumar, N" uniqKey="Kumar N">N. Kumar</name>
</author>
<author><name sortKey="Baudis, M" uniqKey="Baudis M">M. Baudis</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Cai, H" uniqKey="Cai H">H. Cai</name>
</author>
<author><name sortKey="Kumar, N" uniqKey="Kumar N">N. Kumar</name>
</author>
<author><name sortKey="Ai, N" uniqKey="Ai N">N. Ai</name>
</author>
<author><name sortKey="Gupta, S" uniqKey="Gupta S">S. Gupta</name>
</author>
<author><name sortKey="Rath, P" uniqKey="Rath P">P. Rath</name>
</author>
<author><name sortKey="Baudis, M" uniqKey="Baudis M">M. Baudis</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Carvalho, D" uniqKey="Carvalho D">D. Carvalho</name>
</author>
<author><name sortKey="Mackay, A" uniqKey="Mackay A">A. Mackay</name>
</author>
<author><name sortKey="Bjerke, L" uniqKey="Bjerke L">L. Bjerke</name>
</author>
<author><name sortKey="Grundy, R G" uniqKey="Grundy R">R.G. Grundy</name>
</author>
<author><name sortKey="Lopes, C" uniqKey="Lopes C">C. Lopes</name>
</author>
<author><name sortKey="Reis, R M" uniqKey="Reis R">R.M. Reis</name>
</author>
<author><name sortKey="Jones, C" uniqKey="Jones C">C. Jones</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Castel, D" uniqKey="Castel D">D. Castel</name>
</author>
<author><name sortKey="Philippe, C" uniqKey="Philippe C">C. Philippe</name>
</author>
<author><name sortKey="Calmon, R" uniqKey="Calmon R">R. Calmon</name>
</author>
<author><name sortKey="Le Dret, L" uniqKey="Le Dret L">L. Le Dret</name>
</author>
<author><name sortKey="Truffaux, N" uniqKey="Truffaux N">N. Truffaux</name>
</author>
<author><name sortKey="Boddaert, N" uniqKey="Boddaert N">N. Boddaert</name>
</author>
<author><name sortKey="Pages, M" uniqKey="Pages M">M. Pages</name>
</author>
<author><name sortKey="Taylor, K R" uniqKey="Taylor K">K.R. Taylor</name>
</author>
<author><name sortKey="Saulnier, P" uniqKey="Saulnier P">P. Saulnier</name>
</author>
<author><name sortKey="Lacroix, L" uniqKey="Lacroix L">L. Lacroix</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ceccarelli, M" uniqKey="Ceccarelli M">M. Ceccarelli</name>
</author>
<author><name sortKey="Barthel, F P" uniqKey="Barthel F">F.P. Barthel</name>
</author>
<author><name sortKey="Malta, T M" uniqKey="Malta T">T.M. Malta</name>
</author>
<author><name sortKey="Sabedot, T S" uniqKey="Sabedot T">T.S. Sabedot</name>
</author>
<author><name sortKey="Salama, S R" uniqKey="Salama S">S.R. Salama</name>
</author>
<author><name sortKey="Murray, B A" uniqKey="Murray B">B.A. Murray</name>
</author>
<author><name sortKey="Morozova, O" uniqKey="Morozova O">O. Morozova</name>
</author>
<author><name sortKey="Newton, Y" uniqKey="Newton Y">Y. Newton</name>
</author>
<author><name sortKey="Radenbaugh, A" uniqKey="Radenbaugh A">A. Radenbaugh</name>
</author>
<author><name sortKey="Pagnotta, S M" uniqKey="Pagnotta S">S.M. Pagnotta</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Chan, K M" uniqKey="Chan K">K.M. Chan</name>
</author>
<author><name sortKey="Fang, D" uniqKey="Fang D">D. Fang</name>
</author>
<author><name sortKey="Gan, H" uniqKey="Gan H">H. Gan</name>
</author>
<author><name sortKey="Hashizume, R" uniqKey="Hashizume R">R. Hashizume</name>
</author>
<author><name sortKey="Yu, C" uniqKey="Yu C">C. Yu</name>
</author>
<author><name sortKey="Schroeder, M" uniqKey="Schroeder M">M. Schroeder</name>
</author>
<author><name sortKey="Gupta, N" uniqKey="Gupta N">N. Gupta</name>
</author>
<author><name sortKey="Mueller, S" uniqKey="Mueller S">S. Mueller</name>
</author>
<author><name sortKey="James, C D" uniqKey="James C">C.D. James</name>
</author>
<author><name sortKey="Jenkins, R" uniqKey="Jenkins R">R. Jenkins</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Davis, R J" uniqKey="Davis R">R.J. Davis</name>
</author>
<author><name sortKey="Welcker, M" uniqKey="Welcker M">M. Welcker</name>
</author>
<author><name sortKey="Clurman, B E" uniqKey="Clurman B">B.E. Clurman</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Fontebasso, A M" uniqKey="Fontebasso A">A.M. Fontebasso</name>
</author>
<author><name sortKey="Schwartzentruber, J" uniqKey="Schwartzentruber J">J. Schwartzentruber</name>
</author>
<author><name sortKey="Khuong Quang, D A" uniqKey="Khuong Quang D">D.A. Khuong-Quang</name>
</author>
<author><name sortKey="Liu, X Y" uniqKey="Liu X">X.Y. Liu</name>
</author>
<author><name sortKey="Sturm, D" uniqKey="Sturm D">D. Sturm</name>
</author>
<author><name sortKey="Korshunov, A" uniqKey="Korshunov A">A. Korshunov</name>
</author>
<author><name sortKey="Jones, D T" uniqKey="Jones D">D.T. Jones</name>
</author>
<author><name sortKey="Witt, H" uniqKey="Witt H">H. Witt</name>
</author>
<author><name sortKey="Kool, M" uniqKey="Kool M">M. Kool</name>
</author>
<author><name sortKey="Albrecht, S" uniqKey="Albrecht S">S. Albrecht</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Fontebasso, A M" uniqKey="Fontebasso A">A.M. Fontebasso</name>
</author>
<author><name sortKey="Papillon Cavanagh, S" uniqKey="Papillon Cavanagh S">S. Papillon-Cavanagh</name>
</author>
<author><name sortKey="Schwartzentruber, J" uniqKey="Schwartzentruber J">J. Schwartzentruber</name>
</author>
<author><name sortKey="Nikbakht, H" uniqKey="Nikbakht H">H. Nikbakht</name>
</author>
<author><name sortKey="Gerges, N" uniqKey="Gerges N">N. Gerges</name>
</author>
<author><name sortKey="Fiset, P O" uniqKey="Fiset P">P.O. Fiset</name>
</author>
<author><name sortKey="Bechet, D" uniqKey="Bechet D">D. Bechet</name>
</author>
<author><name sortKey="Faury, D" uniqKey="Faury D">D. Faury</name>
</author>
<author><name sortKey="De Jay, N" uniqKey="De Jay N">N. De Jay</name>
</author>
<author><name sortKey="Ramkissoon, L A" uniqKey="Ramkissoon L">L.A. Ramkissoon</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Funato, K" uniqKey="Funato K">K. Funato</name>
</author>
<author><name sortKey="Major, T" uniqKey="Major T">T. Major</name>
</author>
<author><name sortKey="Lewis, P W" uniqKey="Lewis P">P.W. Lewis</name>
</author>
<author><name sortKey="Allis, C D" uniqKey="Allis C">C.D. Allis</name>
</author>
<author><name sortKey="Tabar, V" uniqKey="Tabar V">V. Tabar</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Grasso, C S" uniqKey="Grasso C">C.S. Grasso</name>
</author>
<author><name sortKey="Tang, Y" uniqKey="Tang Y">Y. Tang</name>
</author>
<author><name sortKey="Truffaux, N" uniqKey="Truffaux N">N. Truffaux</name>
</author>
<author><name sortKey="Berlow, N E" uniqKey="Berlow N">N.E. Berlow</name>
</author>
<author><name sortKey="Liu, L" uniqKey="Liu L">L. Liu</name>
</author>
<author><name sortKey="Debily, M A" uniqKey="Debily M">M.A. Debily</name>
</author>
<author><name sortKey="Quist, M J" uniqKey="Quist M">M.J. Quist</name>
</author>
<author><name sortKey="Davis, L E" uniqKey="Davis L">L.E. Davis</name>
</author>
<author><name sortKey="Huang, E C" uniqKey="Huang E">E.C. Huang</name>
</author>
<author><name sortKey="Woo, P J" uniqKey="Woo P">P.J. Woo</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Hennika, T" uniqKey="Hennika T">T. Hennika</name>
</author>
<author><name sortKey="Hu, G" uniqKey="Hu G">G. Hu</name>
</author>
<author><name sortKey="Olaciregui, N G" uniqKey="Olaciregui N">N.G. Olaciregui</name>
</author>
<author><name sortKey="Barton, K L" uniqKey="Barton K">K.L. Barton</name>
</author>
<author><name sortKey="Ehteda, A" uniqKey="Ehteda A">A. Ehteda</name>
</author>
<author><name sortKey="Chitranjan, A" uniqKey="Chitranjan A">A. Chitranjan</name>
</author>
<author><name sortKey="Chang, C" uniqKey="Chang C">C. Chang</name>
</author>
<author><name sortKey="Gifford, A J" uniqKey="Gifford A">A.J. Gifford</name>
</author>
<author><name sortKey="Tsoli, M" uniqKey="Tsoli M">M. Tsoli</name>
</author>
<author><name sortKey="Ziegler, D S" uniqKey="Ziegler D">D.S. Ziegler</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Jones, C" uniqKey="Jones C">C. Jones</name>
</author>
<author><name sortKey="Baker, S J" uniqKey="Baker S">S.J. Baker</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Jones, C" uniqKey="Jones C">C. Jones</name>
</author>
<author><name sortKey="Perryman, L" uniqKey="Perryman L">L. Perryman</name>
</author>
<author><name sortKey="Hargrave, D" uniqKey="Hargrave D">D. Hargrave</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Jones, C" uniqKey="Jones C">C. Jones</name>
</author>
<author><name sortKey="Karajannis, M A" uniqKey="Karajannis M">M.A. Karajannis</name>
</author>
<author><name sortKey="Jones, D T" uniqKey="Jones D">D.T. Jones</name>
</author>
<author><name sortKey="Kieran, M W" uniqKey="Kieran M">M.W. Kieran</name>
</author>
<author><name sortKey="Monje, M" uniqKey="Monje M">M. Monje</name>
</author>
<author><name sortKey="Baker, S J" uniqKey="Baker S">S.J. Baker</name>
</author>
<author><name sortKey="Becher, O J" uniqKey="Becher O">O.J. Becher</name>
</author>
<author><name sortKey="Cho, Y J" uniqKey="Cho Y">Y.J. Cho</name>
</author>
<author><name sortKey="Gupta, N" uniqKey="Gupta N">N. Gupta</name>
</author>
<author><name sortKey="Hawkins, C" uniqKey="Hawkins C">C. Hawkins</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Khuong Quang, D A" uniqKey="Khuong Quang D">D.A. Khuong-Quang</name>
</author>
<author><name sortKey="Buczkowicz, P" uniqKey="Buczkowicz P">P. Buczkowicz</name>
</author>
<author><name sortKey="Rakopoulos, P" uniqKey="Rakopoulos P">P. Rakopoulos</name>
</author>
<author><name sortKey="Liu, X Y" uniqKey="Liu X">X.Y. Liu</name>
</author>
<author><name sortKey="Fontebasso, A M" uniqKey="Fontebasso A">A.M. Fontebasso</name>
</author>
<author><name sortKey="Bouffet, E" uniqKey="Bouffet E">E. Bouffet</name>
</author>
<author><name sortKey="Bartels, U" uniqKey="Bartels U">U. Bartels</name>
</author>
<author><name sortKey="Albrecht, S" uniqKey="Albrecht S">S. Albrecht</name>
</author>
<author><name sortKey="Schwartzentruber, J" uniqKey="Schwartzentruber J">J. Schwartzentruber</name>
</author>
<author><name sortKey="Letourneau, L" uniqKey="Letourneau L">L. Letourneau</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Korshunov, A" uniqKey="Korshunov A">A. Korshunov</name>
</author>
<author><name sortKey="Ryzhova, M" uniqKey="Ryzhova M">M. Ryzhova</name>
</author>
<author><name sortKey="Hovestadt, V" uniqKey="Hovestadt V">V. Hovestadt</name>
</author>
<author><name sortKey="Bender, S" uniqKey="Bender S">S. Bender</name>
</author>
<author><name sortKey="Sturm, D" uniqKey="Sturm D">D. Sturm</name>
</author>
<author><name sortKey="Capper, D" uniqKey="Capper D">D. Capper</name>
</author>
<author><name sortKey="Meyer, J" uniqKey="Meyer J">J. Meyer</name>
</author>
<author><name sortKey="Schrimpf, D" uniqKey="Schrimpf D">D. Schrimpf</name>
</author>
<author><name sortKey="Kool, M" uniqKey="Kool M">M. Kool</name>
</author>
<author><name sortKey="Northcott, P A" uniqKey="Northcott P">P.A. Northcott</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Korshunov, A" uniqKey="Korshunov A">A. Korshunov</name>
</author>
<author><name sortKey="Schrimpf, D" uniqKey="Schrimpf D">D. Schrimpf</name>
</author>
<author><name sortKey="Ryzhova, M" uniqKey="Ryzhova M">M. Ryzhova</name>
</author>
<author><name sortKey="Sturm, D" uniqKey="Sturm D">D. Sturm</name>
</author>
<author><name sortKey="Chavez, L" uniqKey="Chavez L">L. Chavez</name>
</author>
<author><name sortKey="Hovestadt, V" uniqKey="Hovestadt V">V. Hovestadt</name>
</author>
<author><name sortKey="Sharma, T" uniqKey="Sharma T">T. Sharma</name>
</author>
<author><name sortKey="Habel, A" uniqKey="Habel A">A. Habel</name>
</author>
<author><name sortKey="Burford, A" uniqKey="Burford A">A. Burford</name>
</author>
<author><name sortKey="Jones, C" uniqKey="Jones C">C. Jones</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kramm, C M" uniqKey="Kramm C">C.M. Kramm</name>
</author>
<author><name sortKey="Butenhoff, S" uniqKey="Butenhoff S">S. Butenhoff</name>
</author>
<author><name sortKey="Rausche, U" uniqKey="Rausche U">U. Rausche</name>
</author>
<author><name sortKey="Warmuth Metz, M" uniqKey="Warmuth Metz M">M. Warmuth-Metz</name>
</author>
<author><name sortKey="Kortmann, R D" uniqKey="Kortmann R">R.D. Kortmann</name>
</author>
<author><name sortKey="Pietsch, T" uniqKey="Pietsch T">T. Pietsch</name>
</author>
<author><name sortKey="Gnekow, A" uniqKey="Gnekow A">A. Gnekow</name>
</author>
<author><name sortKey="Jorch, N" uniqKey="Jorch N">N. Jorch</name>
</author>
<author><name sortKey="Janssen, G" uniqKey="Janssen G">G. Janssen</name>
</author>
<author><name sortKey="Berthold, F" uniqKey="Berthold F">F. Berthold</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Louis, D N" uniqKey="Louis D">D.N. Louis</name>
</author>
<author><name sortKey="Perry, A" uniqKey="Perry A">A. Perry</name>
</author>
<author><name sortKey="Reifenberger, G" uniqKey="Reifenberger G">G. Reifenberger</name>
</author>
<author><name sortKey="Von Deimling, A" uniqKey="Von Deimling A">A. von Deimling</name>
</author>
<author><name sortKey="Figarella Branger, D" uniqKey="Figarella Branger D">D. Figarella-Branger</name>
</author>
<author><name sortKey="Cavenee, W K" uniqKey="Cavenee W">W.K. Cavenee</name>
</author>
<author><name sortKey="Ohgaki, H" uniqKey="Ohgaki H">H. Ohgaki</name>
</author>
<author><name sortKey="Wiestler, O D" uniqKey="Wiestler O">O.D. Wiestler</name>
</author>
<author><name sortKey="Kleihues, P" uniqKey="Kleihues P">P. Kleihues</name>
</author>
<author><name sortKey="Ellison, D W" uniqKey="Ellison D">D.W. Ellison</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Nicolaides, T P" uniqKey="Nicolaides T">T.P. Nicolaides</name>
</author>
<author><name sortKey="Li, H" uniqKey="Li H">H. Li</name>
</author>
<author><name sortKey="Solomon, D A" uniqKey="Solomon D">D.A. Solomon</name>
</author>
<author><name sortKey="Hariono, S" uniqKey="Hariono S">S. Hariono</name>
</author>
<author><name sortKey="Hashizume, R" uniqKey="Hashizume R">R. Hashizume</name>
</author>
<author><name sortKey="Barkovich, K" uniqKey="Barkovich K">K. Barkovich</name>
</author>
<author><name sortKey="Baker, S J" uniqKey="Baker S">S.J. Baker</name>
</author>
<author><name sortKey="Paugh, B S" uniqKey="Paugh B">B.S. Paugh</name>
</author>
<author><name sortKey="Jones, C" uniqKey="Jones C">C. Jones</name>
</author>
<author><name sortKey="Forshew, T" uniqKey="Forshew T">T. Forshew</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Northcott, P A" uniqKey="Northcott P">P.A. Northcott</name>
</author>
<author><name sortKey="Lee, C" uniqKey="Lee C">C. Lee</name>
</author>
<author><name sortKey="Zichner, T" uniqKey="Zichner T">T. Zichner</name>
</author>
<author><name sortKey="Stutz, A M" uniqKey="Stutz A">A.M. Stutz</name>
</author>
<author><name sortKey="Erkek, S" uniqKey="Erkek S">S. Erkek</name>
</author>
<author><name sortKey="Kawauchi, D" uniqKey="Kawauchi D">D. Kawauchi</name>
</author>
<author><name sortKey="Shih, D J" uniqKey="Shih D">D.J. Shih</name>
</author>
<author><name sortKey="Hovestadt, V" uniqKey="Hovestadt V">V. Hovestadt</name>
</author>
<author><name sortKey="Zapatka, M" uniqKey="Zapatka M">M. Zapatka</name>
</author>
<author><name sortKey="Sturm, D" uniqKey="Sturm D">D. Sturm</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ostrom, Q T" uniqKey="Ostrom Q">Q.T. Ostrom</name>
</author>
<author><name sortKey="Gittleman, H" uniqKey="Gittleman H">H. Gittleman</name>
</author>
<author><name sortKey="Fulop, J" uniqKey="Fulop J">J. Fulop</name>
</author>
<author><name sortKey="Liu, M" uniqKey="Liu M">M. Liu</name>
</author>
<author><name sortKey="Blanda, R" uniqKey="Blanda R">R. Blanda</name>
</author>
<author><name sortKey="Kromer, C" uniqKey="Kromer C">C. Kromer</name>
</author>
<author><name sortKey="Wolinsky, Y" uniqKey="Wolinsky Y">Y. Wolinsky</name>
</author>
<author><name sortKey="Kruchko, C" uniqKey="Kruchko C">C. Kruchko</name>
</author>
<author><name sortKey="Barnholtz Sloan, J S" uniqKey="Barnholtz Sloan J">J.S. Barnholtz-Sloan</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Paugh, B S" uniqKey="Paugh B">B.S. Paugh</name>
</author>
<author><name sortKey="Qu, C" uniqKey="Qu C">C. Qu</name>
</author>
<author><name sortKey="Jones, C" uniqKey="Jones C">C. Jones</name>
</author>
<author><name sortKey="Liu, Z" uniqKey="Liu Z">Z. Liu</name>
</author>
<author><name sortKey="Adamowicz Brice, M" uniqKey="Adamowicz Brice M">M. Adamowicz-Brice</name>
</author>
<author><name sortKey="Zhang, J" uniqKey="Zhang J">J. Zhang</name>
</author>
<author><name sortKey="Bax, D A" uniqKey="Bax D">D.A. Bax</name>
</author>
<author><name sortKey="Coyle, B" uniqKey="Coyle B">B. Coyle</name>
</author>
<author><name sortKey="Barrow, J" uniqKey="Barrow J">J. Barrow</name>
</author>
<author><name sortKey="Hargrave, D" uniqKey="Hargrave D">D. Hargrave</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Paugh, B S" uniqKey="Paugh B">B.S. Paugh</name>
</author>
<author><name sortKey="Broniscer, A" uniqKey="Broniscer A">A. Broniscer</name>
</author>
<author><name sortKey="Qu, C" uniqKey="Qu C">C. Qu</name>
</author>
<author><name sortKey="Miller, C P" uniqKey="Miller C">C.P. Miller</name>
</author>
<author><name sortKey="Zhang, J" uniqKey="Zhang J">J. Zhang</name>
</author>
<author><name sortKey="Tatevossian, R G" uniqKey="Tatevossian R">R.G. Tatevossian</name>
</author>
<author><name sortKey="Olson, J M" uniqKey="Olson J">J.M. Olson</name>
</author>
<author><name sortKey="Geyer, J R" uniqKey="Geyer J">J.R. Geyer</name>
</author>
<author><name sortKey="Chi, S N" uniqKey="Chi S">S.N. Chi</name>
</author>
<author><name sortKey="Da Silva, N S" uniqKey="Da Silva N">N.S. da Silva</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Paugh, B S" uniqKey="Paugh B">B.S. Paugh</name>
</author>
<author><name sortKey="Zhu, X" uniqKey="Zhu X">X. Zhu</name>
</author>
<author><name sortKey="Qu, C" uniqKey="Qu C">C. Qu</name>
</author>
<author><name sortKey="Endersby, R" uniqKey="Endersby R">R. Endersby</name>
</author>
<author><name sortKey="Diaz, A K" uniqKey="Diaz A">A.K. Diaz</name>
</author>
<author><name sortKey="Zhang, J" uniqKey="Zhang J">J. Zhang</name>
</author>
<author><name sortKey="Bax, D A" uniqKey="Bax D">D.A. Bax</name>
</author>
<author><name sortKey="Carvalho, D" uniqKey="Carvalho D">D. Carvalho</name>
</author>
<author><name sortKey="Reis, R M" uniqKey="Reis R">R.M. Reis</name>
</author>
<author><name sortKey="Onar Thomas, A" uniqKey="Onar Thomas A">A. Onar-Thomas</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Puget, S" uniqKey="Puget S">S. Puget</name>
</author>
<author><name sortKey="Philippe, C" uniqKey="Philippe C">C. Philippe</name>
</author>
<author><name sortKey="Bax, D A" uniqKey="Bax D">D.A. Bax</name>
</author>
<author><name sortKey="Job, B" uniqKey="Job B">B. Job</name>
</author>
<author><name sortKey="Varlet, P" uniqKey="Varlet P">P. Varlet</name>
</author>
<author><name sortKey="Junier, M P" uniqKey="Junier M">M.P. Junier</name>
</author>
<author><name sortKey="Andreiuolo, F" uniqKey="Andreiuolo F">F. Andreiuolo</name>
</author>
<author><name sortKey="Carvalho, D" uniqKey="Carvalho D">D. Carvalho</name>
</author>
<author><name sortKey="Reis, R" uniqKey="Reis R">R. Reis</name>
</author>
<author><name sortKey="Guerrini Rousseau, L" uniqKey="Guerrini Rousseau L">L. Guerrini-Rousseau</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Qin, E Y" uniqKey="Qin E">E.Y. Qin</name>
</author>
<author><name sortKey="Cooper, D D" uniqKey="Cooper D">D.D. Cooper</name>
</author>
<author><name sortKey="Abbott, K L" uniqKey="Abbott K">K.L. Abbott</name>
</author>
<author><name sortKey="Lennon, J" uniqKey="Lennon J">J. Lennon</name>
</author>
<author><name sortKey="Nagaraja, S" uniqKey="Nagaraja S">S. Nagaraja</name>
</author>
<author><name sortKey="Mackay, A" uniqKey="Mackay A">A. Mackay</name>
</author>
<author><name sortKey="Jones, C" uniqKey="Jones C">C. Jones</name>
</author>
<author><name sortKey="Vogel, H" uniqKey="Vogel H">H. Vogel</name>
</author>
<author><name sortKey="Jackson, P K" uniqKey="Jackson P">P.K. Jackson</name>
</author>
<author><name sortKey="Monje, M" uniqKey="Monje M">M. Monje</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Richards, M W" uniqKey="Richards M">M.W. Richards</name>
</author>
<author><name sortKey="Burgess, S G" uniqKey="Burgess S">S.G. Burgess</name>
</author>
<author><name sortKey="Poon, E" uniqKey="Poon E">E. Poon</name>
</author>
<author><name sortKey="Carstensen, A" uniqKey="Carstensen A">A. Carstensen</name>
</author>
<author><name sortKey="Eilers, M" uniqKey="Eilers M">M. Eilers</name>
</author>
<author><name sortKey="Chesler, L" uniqKey="Chesler L">L. Chesler</name>
</author>
<author><name sortKey="Bayliss, R" uniqKey="Bayliss R">R. Bayliss</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Schiffman, J D" uniqKey="Schiffman J">J.D. Schiffman</name>
</author>
<author><name sortKey="Hodgson, J G" uniqKey="Hodgson J">J.G. Hodgson</name>
</author>
<author><name sortKey="Vandenberg, S R" uniqKey="Vandenberg S">S.R. VandenBerg</name>
</author>
<author><name sortKey="Flaherty, P" uniqKey="Flaherty P">P. Flaherty</name>
</author>
<author><name sortKey="Polley, M Y" uniqKey="Polley M">M.Y. Polley</name>
</author>
<author><name sortKey="Yu, M" uniqKey="Yu M">M. Yu</name>
</author>
<author><name sortKey="Fisher, P G" uniqKey="Fisher P">P.G. Fisher</name>
</author>
<author><name sortKey="Rowitch, D H" uniqKey="Rowitch D">D.H. Rowitch</name>
</author>
<author><name sortKey="Ford, J M" uniqKey="Ford J">J.M. Ford</name>
</author>
<author><name sortKey="Berger, M S" uniqKey="Berger M">M.S. Berger</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Schwartzentruber, J" uniqKey="Schwartzentruber J">J. Schwartzentruber</name>
</author>
<author><name sortKey="Korshunov, A" uniqKey="Korshunov A">A. Korshunov</name>
</author>
<author><name sortKey="Liu, X Y" uniqKey="Liu X">X.Y. Liu</name>
</author>
<author><name sortKey="Jones, D T" uniqKey="Jones D">D.T. Jones</name>
</author>
<author><name sortKey="Pfaff, E" uniqKey="Pfaff E">E. Pfaff</name>
</author>
<author><name sortKey="Jacob, K" uniqKey="Jacob K">K. Jacob</name>
</author>
<author><name sortKey="Sturm, D" uniqKey="Sturm D">D. Sturm</name>
</author>
<author><name sortKey="Fontebasso, A M" uniqKey="Fontebasso A">A.M. Fontebasso</name>
</author>
<author><name sortKey="Quang, D A" uniqKey="Quang D">D.A. Quang</name>
</author>
<author><name sortKey="Tonjes, M" uniqKey="Tonjes M">M. Tonjes</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Shlien, A" uniqKey="Shlien A">A. Shlien</name>
</author>
<author><name sortKey="Campbell, B B" uniqKey="Campbell B">B.B. Campbell</name>
</author>
<author><name sortKey="De Borja, R" uniqKey="De Borja R">R. de Borja</name>
</author>
<author><name sortKey="Alexandrov, L B" uniqKey="Alexandrov L">L.B. Alexandrov</name>
</author>
<author><name sortKey="Merico, D" uniqKey="Merico D">D. Merico</name>
</author>
<author><name sortKey="Wedge, D" uniqKey="Wedge D">D. Wedge</name>
</author>
<author><name sortKey="Van Loo, P" uniqKey="Van Loo P">P. Van Loo</name>
</author>
<author><name sortKey="Tarpey, P S" uniqKey="Tarpey P">P.S. Tarpey</name>
</author>
<author><name sortKey="Coupland, P" uniqKey="Coupland P">P. Coupland</name>
</author>
<author><name sortKey="Behjati, S" uniqKey="Behjati S">S. Behjati</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Sturm, D" uniqKey="Sturm D">D. Sturm</name>
</author>
<author><name sortKey="Witt, H" uniqKey="Witt H">H. Witt</name>
</author>
<author><name sortKey="Hovestadt, V" uniqKey="Hovestadt V">V. Hovestadt</name>
</author>
<author><name sortKey="Khuong Quang, D A" uniqKey="Khuong Quang D">D.A. Khuong-Quang</name>
</author>
<author><name sortKey="Jones, D T" uniqKey="Jones D">D.T. Jones</name>
</author>
<author><name sortKey="Konermann, C" uniqKey="Konermann C">C. Konermann</name>
</author>
<author><name sortKey="Pfaff, E" uniqKey="Pfaff E">E. Pfaff</name>
</author>
<author><name sortKey="Tonjes, M" uniqKey="Tonjes M">M. Tonjes</name>
</author>
<author><name sortKey="Sill, M" uniqKey="Sill M">M. Sill</name>
</author>
<author><name sortKey="Bender, S" uniqKey="Bender S">S. Bender</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Sturm, D" uniqKey="Sturm D">D. Sturm</name>
</author>
<author><name sortKey="Bender, S" uniqKey="Bender S">S. Bender</name>
</author>
<author><name sortKey="Jones, D T" uniqKey="Jones D">D.T. Jones</name>
</author>
<author><name sortKey="Lichter, P" uniqKey="Lichter P">P. Lichter</name>
</author>
<author><name sortKey="Grill, J" uniqKey="Grill J">J. Grill</name>
</author>
<author><name sortKey="Becher, O" uniqKey="Becher O">O. Becher</name>
</author>
<author><name sortKey="Hawkins, C" uniqKey="Hawkins C">C. Hawkins</name>
</author>
<author><name sortKey="Majewski, J" uniqKey="Majewski J">J. Majewski</name>
</author>
<author><name sortKey="Jones, C" uniqKey="Jones C">C. Jones</name>
</author>
<author><name sortKey="Costello, J F" uniqKey="Costello J">J.F. Costello</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Taylor, K R" uniqKey="Taylor K">K.R. Taylor</name>
</author>
<author><name sortKey="Mackay, A" uniqKey="Mackay A">A. Mackay</name>
</author>
<author><name sortKey="Truffaux, N" uniqKey="Truffaux N">N. Truffaux</name>
</author>
<author><name sortKey="Butterfield, Y S" uniqKey="Butterfield Y">Y.S. Butterfield</name>
</author>
<author><name sortKey="Morozova, O" uniqKey="Morozova O">O. Morozova</name>
</author>
<author><name sortKey="Philippe, C" uniqKey="Philippe C">C. Philippe</name>
</author>
<author><name sortKey="Castel, D" uniqKey="Castel D">D. Castel</name>
</author>
<author><name sortKey="Grasso, C S" uniqKey="Grasso C">C.S. Grasso</name>
</author>
<author><name sortKey="Vinci, M" uniqKey="Vinci M">M. Vinci</name>
</author>
<author><name sortKey="Carvalho, D" uniqKey="Carvalho D">D. Carvalho</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Taylor, K R" uniqKey="Taylor K">K.R. Taylor</name>
</author>
<author><name sortKey="Vinci, M" uniqKey="Vinci M">M. Vinci</name>
</author>
<author><name sortKey="Bullock, A N" uniqKey="Bullock A">A.N. Bullock</name>
</author>
<author><name sortKey="Jones, C" uniqKey="Jones C">C. Jones</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Temime Smaali, N" uniqKey="Temime Smaali N">N. Temime-Smaali</name>
</author>
<author><name sortKey="Guittat, L" uniqKey="Guittat L">L. Guittat</name>
</author>
<author><name sortKey="Wenner, T" uniqKey="Wenner T">T. Wenner</name>
</author>
<author><name sortKey="Bayart, E" uniqKey="Bayart E">E. Bayart</name>
</author>
<author><name sortKey="Douarre, C" uniqKey="Douarre C">C. Douarre</name>
</author>
<author><name sortKey="Gomez, D" uniqKey="Gomez D">D. Gomez</name>
</author>
<author><name sortKey="Giraud Panis, M J" uniqKey="Giraud Panis M">M.J. Giraud-Panis</name>
</author>
<author><name sortKey="Londono Vallejo, A" uniqKey="Londono Vallejo A">A. Londono-Vallejo</name>
</author>
<author><name sortKey="Gilson, E" uniqKey="Gilson E">E. Gilson</name>
</author>
<author><name sortKey="Amor Gueret, M" uniqKey="Amor Gueret M">M. Amor-Gueret</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Temime Smaali, N" uniqKey="Temime Smaali N">N. Temime-Smaali</name>
</author>
<author><name sortKey="Guittat, L" uniqKey="Guittat L">L. Guittat</name>
</author>
<author><name sortKey="Sidibe, A" uniqKey="Sidibe A">A. Sidibe</name>
</author>
<author><name sortKey="Shin Ya, K" uniqKey="Shin Ya K">K. Shin-ya</name>
</author>
<author><name sortKey="Trentesaux, C" uniqKey="Trentesaux C">C. Trentesaux</name>
</author>
<author><name sortKey="Riou, J F" uniqKey="Riou J">J.F. Riou</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Tiberi, L" uniqKey="Tiberi L">L. Tiberi</name>
</author>
<author><name sortKey="Bonnefont, J" uniqKey="Bonnefont J">J. Bonnefont</name>
</author>
<author><name sortKey="Van Den Ameele, J" uniqKey="Van Den Ameele J">J. van den Ameele</name>
</author>
<author><name sortKey="Le Bon, S D" uniqKey="Le Bon S">S.D. Le Bon</name>
</author>
<author><name sortKey="Herpoel, A" uniqKey="Herpoel A">A. Herpoel</name>
</author>
<author><name sortKey="Bilheu, A" uniqKey="Bilheu A">A. Bilheu</name>
</author>
<author><name sortKey="Baron, B W" uniqKey="Baron B">B.W. Baron</name>
</author>
<author><name sortKey="Vanderhaeghen, P" uniqKey="Vanderhaeghen P">P. Vanderhaeghen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Venkatesh, H S" uniqKey="Venkatesh H">H.S. Venkatesh</name>
</author>
<author><name sortKey="Johung, T B" uniqKey="Johung T">T.B. Johung</name>
</author>
<author><name sortKey="Caretti, V" uniqKey="Caretti V">V. Caretti</name>
</author>
<author><name sortKey="Noll, A" uniqKey="Noll A">A. Noll</name>
</author>
<author><name sortKey="Tang, Y" uniqKey="Tang Y">Y. Tang</name>
</author>
<author><name sortKey="Nagaraja, S" uniqKey="Nagaraja S">S. Nagaraja</name>
</author>
<author><name sortKey="Gibson, E M" uniqKey="Gibson E">E.M. Gibson</name>
</author>
<author><name sortKey="Mount, C W" uniqKey="Mount C">C.W. Mount</name>
</author>
<author><name sortKey="Polepalli, J" uniqKey="Polepalli J">J. Polepalli</name>
</author>
<author><name sortKey="Mitra, S S" uniqKey="Mitra S">S.S. Mitra</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Welcker, M" uniqKey="Welcker M">M. Welcker</name>
</author>
<author><name sortKey="Orian, A" uniqKey="Orian A">A. Orian</name>
</author>
<author><name sortKey="Jin, J" uniqKey="Jin J">J. Jin</name>
</author>
<author><name sortKey="Grim, J E" uniqKey="Grim J">J.E. Grim</name>
</author>
<author><name sortKey="Harper, J W" uniqKey="Harper J">J.W. Harper</name>
</author>
<author><name sortKey="Eisenman, R N" uniqKey="Eisenman R">R.N. Eisenman</name>
</author>
<author><name sortKey="Clurman, B E" uniqKey="Clurman B">B.E. Clurman</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wu, L" uniqKey="Wu L">L. Wu</name>
</author>
<author><name sortKey="Davies, S L" uniqKey="Davies S">S.L. Davies</name>
</author>
<author><name sortKey="North, P S" uniqKey="North P">P.S. North</name>
</author>
<author><name sortKey="Goulaouic, H" uniqKey="Goulaouic H">H. Goulaouic</name>
</author>
<author><name sortKey="Riou, J F" uniqKey="Riou J">J.F. Riou</name>
</author>
<author><name sortKey="Turley, H" uniqKey="Turley H">H. Turley</name>
</author>
<author><name sortKey="Gatter, K C" uniqKey="Gatter K">K.C. Gatter</name>
</author>
<author><name sortKey="Hickson, I D" uniqKey="Hickson I">I.D. Hickson</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wu, G" uniqKey="Wu G">G. Wu</name>
</author>
<author><name sortKey="Broniscer, A" uniqKey="Broniscer A">A. Broniscer</name>
</author>
<author><name sortKey="Mceachron, T A" uniqKey="Mceachron T">T.A. McEachron</name>
</author>
<author><name sortKey="Lu, C" uniqKey="Lu C">C. Lu</name>
</author>
<author><name sortKey="Paugh, B S" uniqKey="Paugh B">B.S. Paugh</name>
</author>
<author><name sortKey="Becksfort, J" uniqKey="Becksfort J">J. Becksfort</name>
</author>
<author><name sortKey="Qu, C" uniqKey="Qu C">C. Qu</name>
</author>
<author><name sortKey="Ding, L" uniqKey="Ding L">L. Ding</name>
</author>
<author><name sortKey="Huether, R" uniqKey="Huether R">R. Huether</name>
</author>
<author><name sortKey="Parker, M" uniqKey="Parker M">M. Parker</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wu, G" uniqKey="Wu G">G. Wu</name>
</author>
<author><name sortKey="Diaz, A K" uniqKey="Diaz A">A.K. Diaz</name>
</author>
<author><name sortKey="Paugh, B S" uniqKey="Paugh B">B.S. Paugh</name>
</author>
<author><name sortKey="Rankin, S L" uniqKey="Rankin S">S.L. Rankin</name>
</author>
<author><name sortKey="Ju, B" uniqKey="Ju B">B. Ju</name>
</author>
<author><name sortKey="Li, Y" uniqKey="Li Y">Y. Li</name>
</author>
<author><name sortKey="Zhu, X" uniqKey="Zhu X">X. Zhu</name>
</author>
<author><name sortKey="Qu, C" uniqKey="Qu C">C. Qu</name>
</author>
<author><name sortKey="Chen, X" uniqKey="Chen X">X. Chen</name>
</author>
<author><name sortKey="Zhang, J" uniqKey="Zhang J">J. Zhang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Yada, M" uniqKey="Yada M">M. Yada</name>
</author>
<author><name sortKey="Hatakeyama, S" uniqKey="Hatakeyama S">S. Hatakeyama</name>
</author>
<author><name sortKey="Kamura, T" uniqKey="Kamura T">T. Kamura</name>
</author>
<author><name sortKey="Nishiyama, M" uniqKey="Nishiyama M">M. Nishiyama</name>
</author>
<author><name sortKey="Tsunematsu, R" uniqKey="Tsunematsu R">R. Tsunematsu</name>
</author>
<author><name sortKey="Imaki, H" uniqKey="Imaki H">H. Imaki</name>
</author>
<author><name sortKey="Ishida, N" uniqKey="Ishida N">N. Ishida</name>
</author>
<author><name sortKey="Okumura, F" uniqKey="Okumura F">F. Okumura</name>
</author>
<author><name sortKey="Nakayama, K" uniqKey="Nakayama K">K. Nakayama</name>
</author>
<author><name sortKey="Nakayama, K I" uniqKey="Nakayama K">K.I. Nakayama</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Yang, J" uniqKey="Yang J">J. Yang</name>
</author>
<author><name sortKey="Bachrati, C Z" uniqKey="Bachrati C">C.Z. Bachrati</name>
</author>
<author><name sortKey="Ou, J" uniqKey="Ou J">J. Ou</name>
</author>
<author><name sortKey="Hickson, I D" uniqKey="Hickson I">I.D. Hickson</name>
</author>
<author><name sortKey="Brown, G W" uniqKey="Brown G">G.W. Brown</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Zarghooni, M" uniqKey="Zarghooni M">M. Zarghooni</name>
</author>
<author><name sortKey="Bartels, U" uniqKey="Bartels U">U. Bartels</name>
</author>
<author><name sortKey="Lee, E" uniqKey="Lee E">E. Lee</name>
</author>
<author><name sortKey="Buczkowicz, P" uniqKey="Buczkowicz P">P. Buczkowicz</name>
</author>
<author><name sortKey="Morrison, A" uniqKey="Morrison A">A. Morrison</name>
</author>
<author><name sortKey="Huang, A" uniqKey="Huang A">A. Huang</name>
</author>
<author><name sortKey="Bouffet, E" uniqKey="Bouffet E">E. Bouffet</name>
</author>
<author><name sortKey="Hawkins, C" uniqKey="Hawkins C">C. Hawkins</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article"><pmc-dir>properties open_access</pmc-dir>
<front><journal-meta><journal-id journal-id-type="nlm-ta">Cancer Cell</journal-id>
<journal-id journal-id-type="iso-abbrev">Cancer Cell</journal-id>
<journal-title-group><journal-title>Cancer Cell</journal-title>
</journal-title-group>
<issn pub-type="ppub">1535-6108</issn>
<issn pub-type="epub">1878-3686</issn>
<publisher><publisher-name>Cell Press</publisher-name>
</publisher>
</journal-meta>
<article-meta><article-id pub-id-type="pmid">28966033</article-id>
<article-id pub-id-type="pmc">5637314</article-id>
<article-id pub-id-type="publisher-id">S1535-6108(17)30362-8</article-id>
<article-id pub-id-type="doi">10.1016/j.ccell.2017.08.017</article-id>
<article-categories><subj-group subj-group-type="heading"><subject>Article</subject>
</subj-group>
</article-categories>
<title-group><article-title>Integrated Molecular Meta-Analysis of 1,000 Pediatric High-Grade and Diffuse Intrinsic Pontine Glioma</article-title>
</title-group>
<contrib-group><contrib contrib-type="author"><name><surname>Mackay</surname>
<given-names>Alan</given-names>
</name>
<xref rid="aff1" ref-type="aff">1</xref>
<xref rid="aff2" ref-type="aff">2</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Burford</surname>
<given-names>Anna</given-names>
</name>
<xref rid="aff1" ref-type="aff">1</xref>
<xref rid="aff2" ref-type="aff">2</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Carvalho</surname>
<given-names>Diana</given-names>
</name>
<xref rid="aff1" ref-type="aff">1</xref>
<xref rid="aff2" ref-type="aff">2</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Izquierdo</surname>
<given-names>Elisa</given-names>
</name>
<xref rid="aff1" ref-type="aff">1</xref>
<xref rid="aff2" ref-type="aff">2</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Fazal-Salom</surname>
<given-names>Janat</given-names>
</name>
<xref rid="aff1" ref-type="aff">1</xref>
<xref rid="aff2" ref-type="aff">2</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Taylor</surname>
<given-names>Kathryn R.</given-names>
</name>
<xref rid="aff1" ref-type="aff">1</xref>
<xref rid="aff2" ref-type="aff">2</xref>
<xref rid="aff3" ref-type="aff">3</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Bjerke</surname>
<given-names>Lynn</given-names>
</name>
<xref rid="aff1" ref-type="aff">1</xref>
<xref rid="aff2" ref-type="aff">2</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Clarke</surname>
<given-names>Matthew</given-names>
</name>
<xref rid="aff1" ref-type="aff">1</xref>
<xref rid="aff2" ref-type="aff">2</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Vinci</surname>
<given-names>Mara</given-names>
</name>
<xref rid="aff1" ref-type="aff">1</xref>
<xref rid="aff2" ref-type="aff">2</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Nandhabalan</surname>
<given-names>Meera</given-names>
</name>
<xref rid="aff1" ref-type="aff">1</xref>
<xref rid="aff2" ref-type="aff">2</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Temelso</surname>
<given-names>Sara</given-names>
</name>
<xref rid="aff1" ref-type="aff">1</xref>
<xref rid="aff2" ref-type="aff">2</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Popov</surname>
<given-names>Sergey</given-names>
</name>
<xref rid="aff1" ref-type="aff">1</xref>
<xref rid="aff2" ref-type="aff">2</xref>
<xref rid="aff4" ref-type="aff">4</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Molinari</surname>
<given-names>Valeria</given-names>
</name>
<xref rid="aff1" ref-type="aff">1</xref>
<xref rid="aff2" ref-type="aff">2</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Raman</surname>
<given-names>Pichai</given-names>
</name>
<xref rid="aff5" ref-type="aff">5</xref>
<xref rid="aff6" ref-type="aff">6</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Waanders</surname>
<given-names>Angela J.</given-names>
</name>
<xref rid="aff5" ref-type="aff">5</xref>
<xref rid="aff7" ref-type="aff">7</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Han</surname>
<given-names>Harry J.</given-names>
</name>
<xref rid="aff5" ref-type="aff">5</xref>
<xref rid="aff7" ref-type="aff">7</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Gupta</surname>
<given-names>Saumya</given-names>
</name>
<xref rid="aff8" ref-type="aff">8</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Marshall</surname>
<given-names>Lynley</given-names>
</name>
<xref rid="aff9" ref-type="aff">9</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Zacharoulis</surname>
<given-names>Stergios</given-names>
</name>
<xref rid="aff9" ref-type="aff">9</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Vaidya</surname>
<given-names>Sucheta</given-names>
</name>
<xref rid="aff9" ref-type="aff">9</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Mandeville</surname>
<given-names>Henry C.</given-names>
</name>
<xref rid="aff10" ref-type="aff">10</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Bridges</surname>
<given-names>Leslie R.</given-names>
</name>
<xref rid="aff11" ref-type="aff">11</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Martin</surname>
<given-names>Andrew J.</given-names>
</name>
<xref rid="aff12" ref-type="aff">12</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Al-Sarraj</surname>
<given-names>Safa</given-names>
</name>
<xref rid="aff13" ref-type="aff">13</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Chandler</surname>
<given-names>Christopher</given-names>
</name>
<xref rid="aff14" ref-type="aff">14</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Ng</surname>
<given-names>Ho-Keung</given-names>
</name>
<xref rid="aff15" ref-type="aff">15</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Li</surname>
<given-names>Xingang</given-names>
</name>
<xref rid="aff16" ref-type="aff">16</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Mu</surname>
<given-names>Kun</given-names>
</name>
<xref rid="aff17" ref-type="aff">17</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Trabelsi</surname>
<given-names>Saoussen</given-names>
</name>
<xref rid="aff18" ref-type="aff">18</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Brahim</surname>
<given-names>Dorra H’mida-Ben</given-names>
</name>
<xref rid="aff18" ref-type="aff">18</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Kisljakov</surname>
<given-names>Alexei N.</given-names>
</name>
<xref rid="aff19" ref-type="aff">19</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Konovalov</surname>
<given-names>Dmitry M.</given-names>
</name>
<xref rid="aff20" ref-type="aff">20</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Moore</surname>
<given-names>Andrew S.</given-names>
</name>
<xref rid="aff21" ref-type="aff">21</xref>
<xref rid="aff22" ref-type="aff">22</xref>
<xref rid="aff23" ref-type="aff">23</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Carcaboso</surname>
<given-names>Angel Montero</given-names>
</name>
<xref rid="aff24" ref-type="aff">24</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Sunol</surname>
<given-names>Mariona</given-names>
</name>
<xref rid="aff24" ref-type="aff">24</xref>
</contrib>
<contrib contrib-type="author"><name><surname>de Torres</surname>
<given-names>Carmen</given-names>
</name>
<xref rid="aff24" ref-type="aff">24</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Cruz</surname>
<given-names>Ofelia</given-names>
</name>
<xref rid="aff24" ref-type="aff">24</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Mora</surname>
<given-names>Jaume</given-names>
</name>
<xref rid="aff24" ref-type="aff">24</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Shats</surname>
<given-names>Ludmila I.</given-names>
</name>
<xref rid="aff25" ref-type="aff">25</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Stavale</surname>
<given-names>João N.</given-names>
</name>
<xref rid="aff26" ref-type="aff">26</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Bidinotto</surname>
<given-names>Lucas T.</given-names>
</name>
<xref rid="aff27" ref-type="aff">27</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Reis</surname>
<given-names>Rui M.</given-names>
</name>
<xref rid="aff27" ref-type="aff">27</xref>
<xref rid="aff28" ref-type="aff">28</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Entz-Werle</surname>
<given-names>Natacha</given-names>
</name>
<xref rid="aff29" ref-type="aff">29</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Farrell</surname>
<given-names>Michael</given-names>
</name>
<xref rid="aff30" ref-type="aff">30</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Cryan</surname>
<given-names>Jane</given-names>
</name>
<xref rid="aff30" ref-type="aff">30</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Crimmins</surname>
<given-names>Darach</given-names>
</name>
<xref rid="aff31" ref-type="aff">31</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Caird</surname>
<given-names>John</given-names>
</name>
<xref rid="aff31" ref-type="aff">31</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Pears</surname>
<given-names>Jane</given-names>
</name>
<xref rid="aff32" ref-type="aff">32</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Monje</surname>
<given-names>Michelle</given-names>
</name>
<xref rid="aff3" ref-type="aff">3</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Debily</surname>
<given-names>Marie-Anne</given-names>
</name>
<xref rid="aff33" ref-type="aff">33</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Castel</surname>
<given-names>David</given-names>
</name>
<xref rid="aff33" ref-type="aff">33</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Grill</surname>
<given-names>Jacques</given-names>
</name>
<xref rid="aff33" ref-type="aff">33</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Hawkins</surname>
<given-names>Cynthia</given-names>
</name>
<xref rid="aff34" ref-type="aff">34</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Nikbakht</surname>
<given-names>Hamid</given-names>
</name>
<xref rid="aff35" ref-type="aff">35</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Jabado</surname>
<given-names>Nada</given-names>
</name>
<xref rid="aff5" ref-type="aff">5</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Baker</surname>
<given-names>Suzanne J.</given-names>
</name>
<xref rid="aff36" ref-type="aff">36</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Pfister</surname>
<given-names>Stefan M.</given-names>
</name>
<xref rid="aff37" ref-type="aff">37</xref>
<xref rid="aff38" ref-type="aff">38</xref>
<xref rid="aff43" ref-type="aff">43</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Jones</surname>
<given-names>David T.W.</given-names>
</name>
<xref rid="aff37" ref-type="aff">37</xref>
<xref rid="aff43" ref-type="aff">43</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Fouladi</surname>
<given-names>Maryam</given-names>
</name>
<xref rid="aff39" ref-type="aff">39</xref>
</contrib>
<contrib contrib-type="author"><name><surname>von Bueren</surname>
<given-names>André O.</given-names>
</name>
<xref rid="aff40" ref-type="aff">40</xref>
<xref rid="aff41" ref-type="aff">41</xref>
<xref rid="aff42" ref-type="aff">42</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Baudis</surname>
<given-names>Michael</given-names>
</name>
<xref rid="aff8" ref-type="aff">8</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Resnick</surname>
<given-names>Adam</given-names>
</name>
<xref rid="aff5" ref-type="aff">5</xref>
<xref rid="aff6" ref-type="aff">6</xref>
<xref rid="aff7" ref-type="aff">7</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Jones</surname>
<given-names>Chris</given-names>
</name>
<email>chris.jones@icr.ac.uk</email>
<xref rid="aff1" ref-type="aff">1</xref>
<xref rid="aff2" ref-type="aff">2</xref>
<xref rid="fn1" ref-type="fn">44</xref>
<xref rid="cor1" ref-type="corresp">∗</xref>
</contrib>
</contrib-group>
<aff id="aff1"><label>1</label>
Division of Molecular Pathology, The Institute of Cancer Research, London, UK</aff>
<aff id="aff2"><label>2</label>
Division of Cancer Therapeutics, The Institute of Cancer Research, London, UK</aff>
<aff id="aff3"><label>3</label>
Department of Neurology, Stanford University School of Medicine, Stanford, CA, USA</aff>
<aff id="aff4"><label>4</label>
Department of Cellular Pathology, University Hospital of Wales, Cardiff, UK</aff>
<aff id="aff5"><label>5</label>
The Center for Data Driven Discovery in Biomedicine (D<sup>3</sup>
b), Children's Hospital of Philadelphia, Philadelphia, PA, USA</aff>
<aff id="aff6"><label>6</label>
Division of Neurosurgery, Children's Hospital of Philadelphia, Philadelphia, PA, USA</aff>
<aff id="aff7"><label>7</label>
Division of Oncology, Children's Hospital of Philadelphia, Philadelphia, PA, USA</aff>
<aff id="aff8"><label>8</label>
Institute of Molecular Life Sciences, Swiss Institute of Bioinformatics, University of Zürich, Zürich, Switzerland</aff>
<aff id="aff9"><label>9</label>
Pediatric Oncology Drug Development Team, Children and Young People's Unit, Royal Marsden Hospital, Sutton, UK</aff>
<aff id="aff10"><label>10</label>
Department of Radiotherapy, Royal Marsden Hospital, Sutton, UK</aff>
<aff id="aff11"><label>11</label>
Department of Cellular Pathology, St George's Hospital NHS Trust, London, UK</aff>
<aff id="aff12"><label>12</label>
Department of Neurosurgery, St George's Hospital NHS Trust, London, UK</aff>
<aff id="aff13"><label>13</label>
Department of Neuropathology, Kings College Hospital, London, UK</aff>
<aff id="aff14"><label>14</label>
Department of Neurosurgery, Kings College Hospital, London, UK</aff>
<aff id="aff15"><label>15</label>
Department of Anatomical and Cellular Pathology, The Chinese University of Hong Kong, Hong Kong, China</aff>
<aff id="aff16"><label>16</label>
Department of Neurosurgery, Qilu Hospital of Shandong University and Brain Science Research Institute, Shandong University, Jinan, China</aff>
<aff id="aff17"><label>17</label>
Department of Pathology, Shandong University School of Medicine, Jinan, China</aff>
<aff id="aff18"><label>18</label>
Department of Cytogenetics and Reproductive Biology, Farhat Hached Hospital, Sousse, Tunisia</aff>
<aff id="aff19"><label>19</label>
Department of Pathology, Morozov Children's Hospital, Moscow, Russian Federation</aff>
<aff id="aff20"><label>20</label>
Department of Pathology, Dmitrii Rogachev Research and Clinical Centre of Pediatric Hematology, Oncology and Immunology, Moscow, Russian Federation</aff>
<aff id="aff21"><label>21</label>
UQ Child Health Research Centre, The University of Queensland, Brisbane, Australia</aff>
<aff id="aff22"><label>22</label>
Oncology Services Group, Children's Health Queensland Hospital and Health Service, Brisbane, Australia</aff>
<aff id="aff23"><label>23</label>
The University of Queensland Diamantina Institute, Translational Research Institute, Brisbane, Australia</aff>
<aff id="aff24"><label>24</label>
Institut de Recerca Sant Joan de Deu, Barcelona, Spain</aff>
<aff id="aff25"><label>25</label>
Division of Oncology, Pediatric Oncology and Radiotherapy, St Petersburg State Pediatric Medical University, St Petersburg, Russian Federation</aff>
<aff id="aff26"><label>26</label>
Department of Pathology, Federal University of São Paulo, São Paulo, São Paulo, Brazil</aff>
<aff id="aff27"><label>27</label>
Molecular Oncology Research Centre, Barretos Cancer Hospital, Barretos, São Paulo, Brazil</aff>
<aff id="aff28"><label>28</label>
Life and Health Sciences Research Institute (ICVS), Medical School, University of Minho, Braga, Portugal and ICVS/3B's-PT Government Associate Laboratory, Braga/Guimarães, Portugal</aff>
<aff id="aff29"><label>29</label>
Pédiatrie Onco-Hématologie - Pédiatrie III, Centre Hospitalier Régional et Universitaire Hautepierre, Strasbourg, France</aff>
<aff id="aff30"><label>30</label>
Histopathology Department, Beaumont Hospital, Dublin, Ireland</aff>
<aff id="aff31"><label>31</label>
Department of Neurosurgery, Temple Street Children's University Hospital, Dublin, Ireland</aff>
<aff id="aff32"><label>32</label>
Department of Paediatric Oncology, Our Lady's Children's Hospital, Dublin, Ireland</aff>
<aff id="aff33"><label>33</label>
Département de Cancerologie de l'Enfant et de l'Adolescent, Institut Gustav Roussy, Villejuif, France</aff>
<aff id="aff34"><label>34</label>
Pediatric Laboratory Medicine, Hospital for Sick Children, Toronto, Canada</aff>
<aff id="aff35"><label>35</label>
Department of Pediatrics, McGill University, Montreal, Canada</aff>
<aff id="aff36"><label>36</label>
Department of Developmental Neurobiology, St Jude Children's Research Hospital, Memphis, TN, USA</aff>
<aff id="aff37"><label>37</label>
Division of Pediatric Neuro-oncology, German Cancer Research Center (DKFZ), Heidelberg, Germany</aff>
<aff id="aff38"><label>38</label>
Department of Pediatric Hematology and Oncology, Heidelberg University Hospital, Heidelberg, Germany</aff>
<aff id="aff39"><label>39</label>
Department of Pediatrics, Cancer and Blood Diseases Institute, Cincinnati Children's Hospital, Cincinnati, OH, USA</aff>
<aff id="aff40"><label>40</label>
Department of Pediatrics, Division of Pediatric Hematology and Oncology, University Medical Center Goettingen, Goettingen, Germany</aff>
<aff id="aff41"><label>41</label>
Department of Pediatrics and Adolescent Medicine, Division of Pediatric Hematology and Oncology, University Hospital of Geneva, Geneva, Switzerland</aff>
<aff id="aff42"><label>42</label>
Department of Pediatrics, CANSEARCH Research Laboratory, Faculty of Medicine, University of Geneva, Geneva, Switzerland</aff>
<aff id="aff43"><label>43</label>
Hopp-Children's Cancer Center at the NCT Heidelberg (KiTZ), Heidelberg, Germany</aff>
<author-notes><corresp id="cor1"><label>∗</label>
Corresponding author <email>chris.jones@icr.ac.uk</email>
</corresp>
<fn id="fn1"><label>44</label>
<p id="ntpara0010">Lead Contact</p>
</fn>
</author-notes>
<pub-date pub-type="pmc-release"><day>09</day>
<month>10</month>
<year>2017</year>
</pub-date>
<pmc-comment> PMC Release delay is 0 months and 0 days and was based on .</pmc-comment>
<pub-date pub-type="ppub"><day>09</day>
<month>10</month>
<year>2017</year>
</pub-date>
<volume>32</volume>
<issue>4</issue>
<fpage>520</fpage>
<lpage>537.e5</lpage>
<history><date date-type="received"><day>5</day>
<month>5</month>
<year>2017</year>
</date>
<date date-type="rev-recd"><day>14</day>
<month>7</month>
<year>2017</year>
</date>
<date date-type="accepted"><day>29</day>
<month>8</month>
<year>2017</year>
</date>
</history>
<permissions><copyright-statement>© 2017 The Authors</copyright-statement>
<copyright-year>2017</copyright-year>
<license license-type="CC BY" xlink:href="http://creativecommons.org/licenses/by/4.0/"><license-p>This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).</license-p>
</license>
</permissions>
<abstract id="abs0010"><title>Summary</title>
<p>We collated data from 157 unpublished cases of pediatric high-grade glioma and diffuse intrinsic pontine glioma and 20 publicly available datasets in an integrated analysis of >1,000 cases. We identified co-segregating mutations in histone-mutant subgroups including loss of <italic>FBXW7</italic>
in H3.3G34R/V, <italic>TOP3A</italic>
rearrangements in H3.3K27M, and <italic>BCOR</italic>
mutations in H3.1K27M. Histone wild-type subgroups are refined by the presence of key oncogenic events or methylation profiles more closely resembling lower-grade tumors. Genomic aberrations increase with age, highlighting the infant population as biologically and clinically distinct. Uncommon pathway dysregulation is seen in small subsets of tumors, further defining the molecular diversity of the disease, opening up avenues for biological study and providing a basis for functionally defined future treatment stratification.</p>
</abstract>
<abstract abstract-type="graphical" id="abs0015"><title>Graphical Abstract</title>
<fig id="undfig1" position="anchor"><graphic xlink:href="fx1"></graphic>
</fig>
</abstract>
<abstract abstract-type="author-highlights" id="abs0020"><title>Highlights</title>
<p><list list-type="simple"><list-item id="u0010"><label>•</label>
<p>Pediatric HGG and DIPG comprise a diverse set of clinical and biological subgroups</p>
</list-item>
<list-item id="u0015"><label>•</label>
<p>Somatic coding mutations per tumor range from none to among the highest seen in human cancer</p>
</list-item>
<list-item id="u0020"><label>•</label>
<p>Histone mutations co-segregate with distinct alterations and downstream pathways</p>
</list-item>
<list-item id="u0025"><label>•</label>
<p>H3/IDH1 WT tumors may resemble low-grade lesions and have targetable alterations</p>
</list-item>
</list>
</p>
</abstract>
<abstract abstract-type="teaser" id="abs0025"><p>Mackay et al. perform an integrated analysis of >1,000 cases of pediatric high-grade glioma and diffuse intrinsic pontine glioma. They identify co-segregating mutations in histone-mutant subgroups and show that histone wild-type subgroups are molecularly more similar to lower-grade tumors.</p>
</abstract>
<kwd-group id="kwrds0010"><title>Keywords</title>
<kwd>genome</kwd>
<kwd>exome</kwd>
<kwd>methylation</kwd>
<kwd>histone</kwd>
<kwd>glioblastoma</kwd>
<kwd>DIPG</kwd>
</kwd-group>
</article-meta>
<notes><p id="misc0010">Published: September 28, 2017</p>
</notes>
</front>
<body><sec id="sec1"><title>Significance</title>
<p><bold>High-grade and diffuse intrinsic pontine glioma in children are rare, incurable brain tumors with differing biology to adult cancers. An integrated genomic, epigenomic and transcriptomic analysis of >1,000 cases across all anatomical compartments of the CNS defines robust clinicopathological and molecular subgroups with distinct biological drivers. As modern classification schemes begin to recognize the diversity of this disease in the pediatric population, we provide a framework for meaningful further subcategorization and identify subgroup-restricted therapeutic targets.</bold>
</p>
</sec>
<sec id="sec2"><title>Introduction</title>
<p>Pediatric glioblastoma (pGBM) and diffuse intrinsic pontine glioma (DIPG) are high-grade glial tumors of children with a median overall survival of 9–15 months, a figure that has remained unmoved for decades (<xref rid="bib22" ref-type="bibr">Jones et al., 2012</xref>
). Although relatively rare in this age group (1.78 per 100,000 population), taken together, gliomas are nonetheless the most common malignant brain tumors in children, and represent the greatest cause of cancer-related deaths under the age of 19 years (<xref rid="bib31" ref-type="bibr">Ostrom et al., 2015</xref>
). Unlike histologically similar lesions in adults, which tend to be restricted to the cerebral hemispheres, diffuse high-grade gliomas in childhood (pHGG) can occur throughout the CNS, with around half occurring in midline locations, in particular the thalamus and the pons (<xref rid="bib21" ref-type="bibr">Jones and Baker, 2014</xref>
), where the lack of available surgical options confers an especially poor prognosis (<xref rid="bib27" ref-type="bibr">Kramm et al., 2011</xref>
). Numerous clinical trials of chemotherapeutics and targeted agents extrapolated from adult GBM studies have failed to show a survival benefit, and more rationally derived approaches based upon an understanding of the childhood diseases are urgently needed (<xref rid="bib23" ref-type="bibr">Jones et al., 2016</xref>
).</p>
<p>It has become increasingly apparent that pHGG differ from their adult counterparts, with molecular profiling studies carried out over the last 6–7 years having incrementally identified key genetic and epigenetic differences in pHGG associated with distinct ages of onset, anatomical distribution, clinical outcome, and histopathological and radiological features (<xref rid="bib21" ref-type="bibr">Jones and Baker, 2014</xref>
, <xref rid="bib41" ref-type="bibr">Sturm et al., 2014</xref>
). In particular, the identification of unique recurrent mutations in genes encoding histones H3.3 and H3.1 (<xref rid="bib38" ref-type="bibr">Schwartzentruber et al., 2012</xref>
, <xref rid="bib50" ref-type="bibr">Wu et al., 2012</xref>
) have demonstrated the distinctiveness of the pediatric disease, with the G34R/V and K27M variants appearing to represent different clinicopathological and biological subgroups. This has been recognized by the World Health Organization (WHO) classification of CNS tumors, with the latest version including the novel entity, <italic>diffuse midline glioma with H3K27 mutation</italic>
(<xref rid="bib28" ref-type="bibr">Louis et al., 2016</xref>
). Further refinements incorporating other clearly delineated subsets of the disease in future iterations appear likely and might prove clinically useful.</p>
<p>In addition to these uniquely defining histone mutations, detailed molecular profiling has served to identify numerous targets for therapeutic interventions. These include known oncogenes in adult glioma and other tumors with an elevated frequency in the childhood setting (e.g., <italic>PDGFRA</italic>
) (<xref rid="bib34" ref-type="bibr">Paugh et al., 2013</xref>
, <xref rid="bib35" ref-type="bibr">Puget et al., 2012</xref>
) or certain rare histological variants (e.g., <italic>BRAF</italic>
V600E) (<xref rid="bib29" ref-type="bibr">Nicolaides et al., 2011</xref>
, <xref rid="bib37" ref-type="bibr">Schiffman et al., 2010</xref>
), as well as others seemingly unique to DIPG (e.g., <italic>ACVR1</italic>
) (<xref rid="bib7" ref-type="bibr">Buczkowicz et al., 2014</xref>
, <xref rid="bib16" ref-type="bibr">Fontebasso et al., 2014</xref>
, <xref rid="bib42" ref-type="bibr">Taylor et al., 2014a</xref>
, <xref rid="bib51" ref-type="bibr">Wu et al., 2014</xref>
). Future trials will need to exploit these targets, but also incorporate innovative designs that allow for selection of the patient populations within the wide spectrum of disease who are most likely to benefit from any novel agent (<xref rid="bib23" ref-type="bibr">Jones et al., 2016</xref>
).</p>
<p>Despite these advances, driven by the efforts of several international collaborative groups to collect and profile these rare tumors, individual publications remain necessarily modestly sized, involving a range of different platforms and analytical techniques. This leaves certain subgroups poorly represented across studies, widely differing individual gene frequencies in different cohorts, and an inability to draw robust conclusions across the whole spectrum of the disease. We have gathered together publicly available data, supplemented with 157 new cases, in order to provide a statistically robust, manually annotated resource cohort of >1,000 such tumors for interrogation.</p>
</sec>
<sec id="sec3"><title>Results</title>
<sec id="sec3.1"><title>Sample Cohort</title>
<p>In total, we obtained data from clinically annotated high-grade glioma (WHO, 2007, grade III or IV) or DIPG (radiologically diagnosed, grades II–IV) in 1,067 unique cases (<xref rid="mmc1" ref-type="supplementary-material">Figure S1</xref>
A). These were predominantly from children but also included young adults, in order to capture more <italic>H3F3A</italic>
G34R/V mutations, as well as to explore an otherwise under-studied population. There was a median age at diagnosis of 9.8 years, and 982 cases aged 21 years or younger (<xref rid="mmc2" ref-type="supplementary-material">Table S1</xref>
). These included 910 taken from 20 published series (<xref rid="bib2" ref-type="bibr">Barrow et al., 2011</xref>
, <xref rid="bib3" ref-type="bibr">Bax et al., 2010</xref>
, <xref rid="bib7" ref-type="bibr">Buczkowicz et al., 2014</xref>
, <xref rid="bib10" ref-type="bibr">Carvalho et al., 2014</xref>
, <xref rid="bib11" ref-type="bibr">Castel et al., 2015</xref>
, <xref rid="bib15" ref-type="bibr">Fontebasso et al., 2013</xref>
, <xref rid="bib16" ref-type="bibr">Fontebasso et al., 2014</xref>
, <xref rid="bib18" ref-type="bibr">Grasso et al., 2015</xref>
, <xref rid="bib20" ref-type="bibr">International Cancer Genome Consortium PedBrain Tumor Project, 2016</xref>
, <xref rid="bib24" ref-type="bibr">Khuong-Quang et al., 2012</xref>
, <xref rid="bib25" ref-type="bibr">Korshunov et al., 2015</xref>
, <xref rid="bib32" ref-type="bibr">Paugh et al., 2010</xref>
, <xref rid="bib33" ref-type="bibr">Paugh et al., 2011</xref>
, <xref rid="bib35" ref-type="bibr">Puget et al., 2012</xref>
, <xref rid="bib38" ref-type="bibr">Schwartzentruber et al., 2012</xref>
, <xref rid="bib40" ref-type="bibr">Sturm et al., 2012</xref>
, <xref rid="bib42" ref-type="bibr">Taylor et al., 2014a</xref>
, <xref rid="bib50" ref-type="bibr">Wu et al., 2012</xref>
, <xref rid="bib51" ref-type="bibr">Wu et al., 2014</xref>
, <xref rid="bib54" ref-type="bibr">Zarghooni et al., 2010</xref>
) and 157 unpublished cases. The vast majority of samples were obtained pre-treatment (biopsy or resection, n = 913), as opposed to post-therapy (relapse or autopsy, n = 146). Samples were classified as occurring within the cerebral hemispheres (n = 482), brainstem (n = 323 in pons, of which 322 were DIPG; three additional cases were in the midbrain and one in the medulla) or other non-brainstem midline locations (n = 224, predominantly thalamus, but also cerebellum, spinal cord, ventricles, and others; referred to as “midline” for simplicity throughout) (<xref rid="fig1" ref-type="fig">Figure 1</xref>
A). There was a significant association of anatomical location with age of diagnosis, with medians of 13.0 years for hemispheric, 10.0 years for midline, and 6.5 years for DIPG, respectively (p < 0.0001, ANOVA; all pairwise comparisons adjusted p < 0.0001, t test) (<xref rid="fig1" ref-type="fig">Figure 1</xref>
B), in addition to clinical outcome, with a median overall survival of 18.0 months for hemispheric tumors (2 year overall survival 32%), 13.5 months for midline (2 year overall survival 21.4%), and 10.8 months for DIPG (2 year overall survival 5.2%; p < 0.0001 for all pairwise comparisons, log rank test) (<xref rid="fig1" ref-type="fig">Figure 1</xref>
C). Children 3 years of age and younger had a markedly improved clinical outcome (p = 0.0028, log rank test), although this benefit was largely restricted to children 1 year and under (n = 40, 2 year survival 61%, p < 0.0001, log rank test), with this association significant in all anatomical locations (p = 0.0402, hemispheric; p < 0.0001, midline; p = 0.00286, pons, log rank test). There were, however, proportionally fewer midline and pontine tumors in <1-year-olds compared with 1- to 3-year-olds (12/40, 30.0% versus 46/85, 45.9%, p = 0.0131 Fisher’s exact test) (<xref rid="mmc1" ref-type="supplementary-material">Figures S1</xref>
B and S1C).<fig id="fig1"><label>Figure 1</label>
<caption><p>Clinicopathological and Molecular Subgroups of pHGG/DIPG</p>
<p>(A) Anatomical location of all high-grade glioma cases included in this study, taken from original publications (n = 1,033). Left, sagittal section showing internal structures; right, external view highlighting cerebral lobes. Hemispheric, dark red; non-brainstem midline structures, red; pons, pink. Radius of circle is proportional to the number of cases. Lighter shaded circles represent a non-specific designation of hemispheric, midline, or brainstem.</p>
<p>(B) Boxplot showing age at diagnosis of included cases, separated by anatomical location (n = 1,011). The thick line within the box is the median, the lower and upper limits of the boxes represent the first and third quartiles, and the whiskers 1.5× the interquartile range. <sup>∗∗∗</sup>
Adjusted p < 0.0001 for all pairwise comparisons, t test.</p>
<p>(C) Kaplan-Meier plot of overall survival of cases separated by anatomical location, p value calculated by the log rank test (n = 811).</p>
<p>(D) Anatomical location of all cases separated by histone mutation (top, n = 441) and histone WT (bottom, n = 314). Left, sagittal section showing internal structures; right, external view highlighting cerebral lobes. Blue, H3.3G34R/V; green, H3.3K27M; dark green, H3.1K27M. Radius of circle is proportional to the number of cases. Lighter shaded circles represent a non-specific designation of hemispheric, midline, or brainstem.</p>
<p>(E) Boxplot showing age at diagnosis of included cases, separated by histone mutation (n = 753). The thick line within the box is the median, the lower and upper limits of the boxes represent the first and third quartiles, and the whiskers 1.5× the interquartile range. <sup>∗∗∗</sup>
Adjusted p < 0.0001 for all pairwise comparisons, t test.</p>
<p>(F) Kaplan-Meier plot of overall survival of cases separated by histone mutation, p value calculated by the log rank test (n = 693). See also <xref rid="mmc1" ref-type="supplementary-material">Figure S1</xref>
and <xref rid="mmc2" ref-type="supplementary-material">Table S1</xref>
.</p>
</caption>
<graphic xlink:href="gr1"></graphic>
</fig>
</p>
</sec>
<sec id="sec3.2"><title>Molecular Subgrouping</title>
<p>Hotspot mutation data for the genes encoding histone H3 were available or newly generated for 903 cases. At minimum, this included Sanger sequencing for <italic>H3F3A</italic>
(H3.3) and <italic>HIST1H3B</italic>
(H3.1); however, the absence of wider screening or next-generation sequencing data for 310 cases annotated as H3 wild-type (WT) means we cannot rule out rare variants in other H3.1 or H3.2 genes in those cases. In total, the cohort comprised 67 H3.3G34R/V (n = 63 G34R, n = 4 G34V), 316 H3.3K27M, 66 H3.1/3.2K27M (n = 62 <italic>HIST1H3B</italic>
, n = 2 <italic>HIST1H3C</italic>
, n = 2 <italic>HIST2H3C</italic>
), and 454 WT. There were profound distinctions in anatomical location (p < 0.0001, Fisher’s exact test) (<xref rid="fig1" ref-type="fig">Figure 1</xref>
D), age at diagnosis (p < 0.0001, ANOVA; all pairwise comparisons adjusted p < 0.0001, t test) (<xref rid="fig1" ref-type="fig">Figure 1</xref>
E), and overall survival (p < 0.0001, log rank test) (<xref rid="fig1" ref-type="fig">Figure 1</xref>
F). H3.3G34R/V tumors were almost entirely restricted to the cerebral hemispheres (accounting for 16.2% total in this location, particularly parietal and temporal lobes), were found predominantly in adolescents and young adults (median 15.0 years), and had a longer overall survival compared with other H3 mutant groups (median 18.0 months, 2 year overall survival 27.3%, p < 0.0001 versus H3.3K27M, p = 0.00209 versus H3.1H27M, log rank test). H3.3K27M were spread throughout the midline and pons, where they account for 63.0% DIPG and 59.7% non-brainstem midline tumors. In all locations (including ten cases reported to present in the cortex), these mutations conferred a significantly shorter time to death from disease (overall median 11 months, 2 year overall survival 4.7%) (<xref rid="mmc1" ref-type="supplementary-material">Figures S1</xref>
D–S1F). H3.1/3.2K27M were highly specific to the pons (21.4% total) where they represent a younger age group (median 5.0 years) with a significantly longer overall survival (median 15.0 months) than H3.3K27M (p = 0.00017, log rank test) (<xref rid="mmc1" ref-type="supplementary-material">Figure S1</xref>
F). In multivariate analysis incorporating the histone mutations alongside age, WHO grade, and gender, K27M mutations in both H3.3 and H3.1 are independently associated with shorter survival (p < 0.0001, Cox proportional hazards model).</p>
<p><italic>BRAF</italic>
V600E status was available for 535 cases, with mutant cases (n = 32, 6.0%) present only in midline and hemispheric locations, and conferring a significantly improved prognosis (2 year survival 67%, p < 0.0001, log rank test) (<xref rid="mmc1" ref-type="supplementary-material">Figures S1</xref>
G–S1I). There was additional annotation for <italic>IDH1</italic>
R132 mutation status in 640 cases (n = 40, 6.25%), representing a forebrain-restricted, significantly older group of patients (median 17.0 years, p < 0.0001, t test) with longer overall survival (2 year survival 59%, p < 0.0001, log rank test) (<xref rid="mmc1" ref-type="supplementary-material">Figures S1</xref>
J–S1L).</p>
<p>For 441 cases, Illumina 450k methylation BeadArray data was available, which provides robust classification into clinically meaningful epigenetic subgroups marked by recurrent genetic alterations (<xref rid="bib25" ref-type="bibr">Korshunov et al., 2015</xref>
, <xref rid="bib26" ref-type="bibr">Korshunov et al., 2017</xref>
). We used the Heidelberg brain tumor classifier to assign tumors into following subgroups: H3G34R/V (n = 51), H3K27M (n = 119), HGG WT (n = 156), IDH1 (n = 36), low-grade glioma (LGG)-like (n = 27), pleomorphic xanthoastrocytoma (PXA)-like (n = 43), and “other” (n = 9) (<xref rid="mmc1" ref-type="supplementary-material">Figure S2</xref>
A), visualized by hierarchical clustering (<xref rid="fig2" ref-type="fig">Figure 2</xref>
A) (<xref rid="mmc3" ref-type="supplementary-material">Table S2</xref>
). As reported previously, these subgroups have profound differences in anatomical location (<xref rid="fig2" ref-type="fig">Figure 2</xref>
B), age at diagnosis (p < 0.00001 ANOVA) (<xref rid="fig2" ref-type="fig">Figure 2</xref>
C), and overall survival (p < 0.0001, log rank test) (<xref rid="fig2" ref-type="fig">Figure 2</xref>
D), with LGG-like group representing a younger cohort (median 4.0 years, 10/16 infant cases under 1 year, p < 0.0001 Fisher’s exact test) with excellent prognosis (2 year survival 74%, p < 0.0001 versus WT, log rank test), while the PXA-like group are enriched for <italic>BRAF</italic>
V600E mutations (19/34, 56%) and carry an intermediate risk (median 38 months, 2 year survival 56%, p = 0.00423 versus WT, log rank test). After removing the PXA- and LGG-like groups, the remaining histone H3/IDH1 WT tumors had a 2 year survival of 23.5% (median overall survival 17.2 months). <italic>MGMT</italic>
promoter methylation was significantly enriched in the H3G34R/V (65.1%, globally hypomethylated) and IDH1 (78.1%, globally hypermethylated) groups, and largely absent from H3K27M tumors (4.5%, all tests versus rest, p < 0.0001 Fisher’s exact test) (<xref rid="mmc1" ref-type="supplementary-material">Figure S2</xref>
B). Total methylation was lowest in H3G34R/V (median beta value 0.452), and highest in the IDH subgroup (median beta value 0.520), as reported previously (<xref rid="bib40" ref-type="bibr">Sturm et al., 2012</xref>
); however it was also found to be significantly elevated in PXA-like tumors (median beta value 0.501, p < 0.0001 t test) (<xref rid="mmc1" ref-type="supplementary-material">Figure S2</xref>
C).<fig id="fig2"><label>Figure 2</label>
<caption><p>Methylation-based Subclassification of pHGG/DIPG</p>
<p>(A) Unsupervised hierarchical clustering and heatmap representation of β values for 441 samples profiled on the Illumina 450k BeadArray platform (red, high; blue, low). Samples are arranged in columns clustered by most variable 1,381 classifier probes. Age at diagnosis is provided below. Clinicopathological and molecular annotations are provided as bars according to the included key.</p>
<p>(B) Anatomical location of methylation-defined PXA-like (n = 43) and LGG-like (n = 27) cases. Left, sagittal section showing internal structures; right, external view highlighting cerebral lobes. Dark gold, PXA-like; tan, LGG-like. Radius of circle is proportional to the number of cases. Lighter shaded circles represent a non-specific designation of hemispheric, midline, or brainstem.</p>
<p>(C) Boxplot showing age at diagnosis of included cases, separated by simplified methylation subclass (n = 440). The thick line within the box is the median, the lower and upper limits of the boxes represent the first and third quartiles, and the whiskers 1.5× the interquartile range. <sup>∗∗∗</sup>
Adjusted p < 0.0001 for all H3 G34R/V pairwise comparisons, t test; <sup>∗∗</sup>
adjusted p < 0.01 for LGG-like versus WT, t test.</p>
<p>(D) Kaplan-Meier plot of overall survival of cases separated by simplified methylation subclass, p value calculated by the log rank test (n = 307). See also <xref rid="mmc1" ref-type="supplementary-material">Figure S2</xref>
and <xref rid="mmc3" ref-type="supplementary-material">Table S2</xref>
.</p>
</caption>
<graphic xlink:href="gr2"></graphic>
</fig>
</p>
</sec>
<sec id="sec3.3"><title>DNA Copy Number</title>
<p>High-quality DNA copy-number profiles were obtained from 834 unique cases of pHGG/DIPG, taken from BAC and oligonucleotide arrays (n = 112), SNP arrays (n = 128), 450k methylation arrays (n = 428), and whole-genome or exome sequencing (n = 325) (<xref rid="mmc4" ref-type="supplementary-material">Table S3</xref>
). Clustering on the basis of segmented log<sub>2</sub>
ratios highlighted some of the defining chromosomal features of the pediatric disease, including recurrent gains of chromosome 1q, and losses of chromosomes 13q and 14q (<xref rid="fig3" ref-type="fig">Figure 3</xref>
A). There are also a significant proportion of tumors (n = 147, 17.6%) with few if any DNA copy-number changes, with no bias toward lower-resolution platforms (p = 0.134, Fisher’s exact test), and the presence of other molecular markers obviating concerns of a substantial normal tissue contamination. These cases were found throughout the CNS, were younger at diagnosis (7.0 versus 10.3 years, p < 0.0001, t test) and had a longer overall survival (median 18.0 versus 14.0 months, p = 0.0107 log rank test) (<xref rid="mmc1" ref-type="supplementary-material">Figure S3</xref>
A). Common large-scale chromosomal alterations with prognostic significance included loss of 17p (n = 156), which targets <italic>TP53</italic>
at 17p13.1 and confers a shorter overall survival in tumors of all locations and all subgroups (<xref rid="mmc1" ref-type="supplementary-material">Figure S3</xref>
B), and gains of 9q (n = 108), more broadly encompassing a region of structural rearrangement on 9q34 in medulloblastoma (<xref rid="bib30" ref-type="bibr">Northcott et al., 2014</xref>
), and correlating with shorter overall survival in multiple pHGG/DIPG subgroups (<xref rid="mmc1" ref-type="supplementary-material">Figure S3</xref>
C).<fig id="fig3"><label>Figure 3</label>
<caption><p>DNA Copy-Number Aberrations in pHGG/DIPG</p>
<p>(A) Heatmap representation of segmented DNA copy number for 834 pHGG/DIPG profiled across one or more of seven different platforms (dark red, amplification; red, gain; dark blue, deletion; blue, loss). Samples are arranged in columns clustered by gene-level data across the whole genome. Age at diagnosis is provided below. Clinicopathological and molecular annotations are provided as bars according to the included key.</p>
<p>(B and C) Barplot of all recurrent focal amplifications (B) and deletions (C) across all 834 cases, in order of frequency, and colored independently by both anatomical location and histone mutation. See also <xref rid="mmc1" ref-type="supplementary-material">Figure S3</xref>
and <xref rid="mmc4" ref-type="supplementary-material">Table S3</xref>
.</p>
</caption>
<graphic xlink:href="gr3"></graphic>
</fig>
</p>
<p>We used GISTIC (genomic identification of significant targets in cancer) in order to determine subgroup-specific copy-number drivers based on focality, amplitude, and recurrence of alterations. The most common focal events were the previously described high-level amplifications (<xref rid="fig3" ref-type="fig">Figure 3</xref>
B) at 4q12 (<italic>PDGFRA/KIT/KDR</italic>
, n = 77), 2p24.3 (<italic>MYCN/ID2,</italic>
n = 42), chromosome 7 (7p11.2 (<italic>EGFR,</italic>
n = 32), 7q21.2 (<italic>CDK6,</italic>
n = 14), and 7q31.2 (<italic>MET,</italic>
n = 19)) (<xref rid="mmc1" ref-type="supplementary-material">Figures S3</xref>
D–S3F), as well as focal deletions (<xref rid="fig3" ref-type="fig">Figure 3</xref>
C) at 9p21.3 (<italic>CDKN2A/CDKN2B,</italic>
n = 102) (<xref rid="mmc1" ref-type="supplementary-material">Figure S3</xref>
G). Amplifications conferred a shorter overall survival, and <italic>CDKN2A/CDKN2B</italic>
deletion a better prognosis, either across the whole cohort or selected subgroups (<xref rid="mmc1" ref-type="supplementary-material">Figures S3</xref>
B–S3G). In addition, the aggregated data identified less-frequent alterations, recurrent across multiple studies, identifying pHGG/DIPG candidates including <italic>NFIB</italic>
(nuclear factor I B, 9p23-p22.3, n = 4), <italic>GAB2</italic>
(GRB2-associated binding protein 2, 11q14.1, n = 4), <italic>SMARCE1</italic>
(SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1, 17q21.2, n = 4), and others (<xref rid="fig3" ref-type="fig">Figures 3</xref>
B and 3C).</p>
</sec>
<sec id="sec3.4"><title>Subgroup-Specific Alterations</title>
<p>When <italic>IDH1</italic>
-mutant tumors were removed and the cohort restricted to those cases for which histone H3 status was available, we were able to investigate subgroup-specific DNA copy-number changes in 705 pHGG/DIPG (<xref rid="fig4" ref-type="fig">Figure 4</xref>
A). Applying GISTIC within these case sets revealed specific focal events enriched within individual subgroups, including <italic>AKT1</italic>
amplifications in H3.3G34R/V, <italic>MYC</italic>
and <italic>CCND2</italic>
amplification in H3.3K27M, and <italic>MYCN/ID2</italic>
, <italic>MDM4/PIK3C2B</italic>
, and <italic>KRAS</italic>
amplification in H3 WT (<xref rid="fig4" ref-type="fig">Figure 4</xref>
B) (<xref rid="mmc5" ref-type="supplementary-material">Table S4</xref>
). These latter events were generally restricted to hemispheric tumors, while <italic>MYCN/ID2</italic>
were enriched in H3 WT DIPG (<xref rid="mmc1" ref-type="supplementary-material">Figure S4</xref>
A). H3.1K27M tumors generally lacked amplifications/deletions, but were instead characterized by frequent gains of 1q and the whole of chromosome 2, and the loss of 16q (<xref rid="fig4" ref-type="fig">Figure 4</xref>
C). PXA-like tumors had frequent <italic>CDKN2A/B</italic>
deletions and a unique loss at 1q, associated with shorter overall survival within this group (<xref rid="mmc1" ref-type="supplementary-material">Figure S4</xref>
B).<fig id="fig4"><label>Figure 4</label>
<caption><p>Subgroup-specific Copy-Number Changes in pHGG/DIPG</p>
<p>(A) Heatmap representation of segmented DNA copy number for 705 pHGG/DIPG separated for known histone mutation subgroup (dark red, amplification; red, gain; dark blue, deletion; blue, loss). Samples are arranged in columns clustered by gene-level data across the whole genome. Clinicopathological and molecular annotations are provided as bars according to the included key.</p>
<p>(B) GISTIC analysis of focal amplifications and deletions for histone mutation subgroups. Log<sub>10</sub>
values are plotted across the genome for both amplifications (dark red) and deletions (dark blue), with significantly enriched events labeled by likely driver genes. Subgroup-specific genes are highlighted by the appropriate color.</p>
<p>(C) Barplot of frequency of whole chromosomal arm gains (red) and losses (blue) for each subgroup. Significantly enriched alterations (p < 0.0001, Fisher’s exact test) are labeled, with subgroup-specific arm changes highlighted by the appropriate color. See also <xref rid="mmc1" ref-type="supplementary-material">Figure S4</xref>
and <xref rid="mmc5" ref-type="supplementary-material">Table S4</xref>
.</p>
</caption>
<graphic xlink:href="gr4"></graphic>
</fig>
</p>
<p>Whole-arm losses were also enriched in H3.3G34R/V tumors, specifically 3q, 4q, 5q, and 18q, where smallest regions of overlap were in some instances able to narrow the common region to a handful of candidate genes (<xref rid="mmc1" ref-type="supplementary-material">Figure S4</xref>
C). On chromosome 4q this appeared to target <italic>FBXW7</italic>
at 4q31.3, also aligning with the GISTIC data (<xref rid="fig5" ref-type="fig">Figure 5</xref>
A). Across three independent platforms, gene expression over the whole arm was significantly lower when 4q was lost (Agilent, p = 0.00231; Affymetrix, p = 0.000102; RNA sequencing (RNA-seq), p = 0.0398; Wilcoxon signed-rank test) (<xref rid="mmc1" ref-type="supplementary-material">Figure S5</xref>
A). (<xref rid="mmc6" ref-type="supplementary-material">Table S5</xref>
). There were also four patients with three different somatic coding mutations identified (below), two truncating and one missense, three of which were in hemispheric tumors, and two with <italic>H3F3A</italic>
G34R (<xref rid="fig5" ref-type="fig">Figure 5</xref>
B). In cases with 4q loss, median <italic>FBXW7</italic>
gene expression was reduced compared with those with normal copy number (Agilent, p = 0.029; Affymetrix, p = 0.015; RNA-seq, p = 0.4; Mann-Whitney U test) (<xref rid="fig5" ref-type="fig">Figure 5</xref>
C).<fig id="fig5"><label>Figure 5</label>
<caption><p>Alterations Targeting <italic>FBXW7</italic>
in H3.3G34R/V pHGG and <italic>TOP3A</italic>
in H3.3K27M DIPG</p>
<p>(A) Segmented exon-level DNA copy-number heatmaps for 4q loss in H3.3G34R/V tumors (dark red, amplification; red, gain; dark blue, deletion; blue, loss; n = 28). An ideogram of chromosome 4 is provided indicating enlarged genome browser view and genes within common regions targeted across samples (gray). Clinicopathological and molecular annotations are provided as bars according to the included key.</p>
<p>(B) Cartoon representation of amino acid position for four somatic mutations found in <italic>FBXW7</italic>
, colored by annotated functional domains and numbers provided for recurrent variants.</p>
<p>(C) Boxplots representing gene expression differences between <italic>FBXW7</italic>
lost/mutated cases (blue) and those with normal copy/WT (gray) in three independent gene expression platform datasets. The thick line within the box is the median, the lower and upper limits of the boxes represent the first and third quartiles, and the whiskers 1.5× the interquartile range.</p>
<p>(D) Segmented exon-level DNA copy-number heatmaps for 17p11.2 amplification in predominantly H3.3K27M DIPG (dark red, amplification; red, gain; dark blue, deletion; blue, loss; n = 17). Chromosome 17 ideogram is provided indicating enlarged genome browser view and genes within common regions targeted across samples (gray). Clinicopathological and molecular annotations are provided as bars according to the included key.</p>
<p>(E) Sequencing coverage (top) and log<sub>2</sub>
ratio plot (bottom) for chromosomes 7, 17, and 20 for two cases, showing complex intra- or inter-chromosomal rearrangements leading to specific copy-number amplification of <italic>TOP3A</italic>
.</p>
<p>(F) Boxplots representing gene expression differences between <italic>TOP3A</italic>
amplified cases (red) and those with normal copy (gray) in three independent gene expression platform datasets. The thick line within the box is the median, the lower and upper limits of the boxes represent the first and third quartiles, and the whiskers 1.5× the interquartile range. See also <xref rid="mmc1" ref-type="supplementary-material">Figure S5</xref>
and <xref rid="mmc6" ref-type="supplementary-material">Table S5</xref>
.</p>
</caption>
<graphic xlink:href="gr5"></graphic>
</fig>
</p>
<p>Within H3.3K27M tumors, we identified a recurrent amplification at 17p11.2 (n = 17; 170 kb to 11.96 Mb), across multiple platforms and significantly enriched in DIPGs, which appears to target <italic>TOP3A</italic>
within these tumors (<xref rid="fig5" ref-type="fig">Figure 5</xref>
D). Where available (n = 6) (<xref rid="mmc1" ref-type="supplementary-material">Figure S5</xref>
B), whole-genome sequencing data reveals this occurs via complex intra- and inter-chromosomal rearrangements (<xref rid="fig5" ref-type="fig">Figure 5</xref>
E) leading to increased mRNA expression of <italic>TOP3A</italic>
in amplified versus non-amplified cases in Agilent (n = 1), and Affymetrix and RNA-seq (p = 0.011 and p = 0.016, respectively, Mann-Whitney U test) data (<xref rid="fig5" ref-type="fig">Figure 5</xref>
F) (<xref rid="mmc6" ref-type="supplementary-material">Table S5</xref>
). In an integrated dataset, <italic>TOP3A</italic>
was the most differentially expressed gene in the region in amplified cases (adjusted p = 0.00856 Mann-Whitney U test). We further identified a single somatic missense mutation (C658Y) in an additional case of DIPG, and, taken together, <italic>TOP3A</italic>
alterations were mutually exclusive with <italic>ATRX</italic>
deletion/mutations found in H3.3K27M DIPG (0/13).</p>
</sec>
<sec id="sec3.5"><title>Whole-Genome and Exome Sequencing</title>
<p>Out of 372 sequenced cases (n = 118 whole genome, n = 247 exome, 7 both), we were able to retrieve raw data from 351 for integration of somatic variant calling (<xref rid="mmc7" ref-type="supplementary-material">Table S6</xref>
) and DNA copy-number changes. Of these, RNA-seq data was available for 47, allowing for candidate fusion gene nomination in 150 cases (RNA-seq or whole-genome sequencing restricted to high-confidence nominations in relevant pathway-associated genes, <xref rid="mmc7" ref-type="supplementary-material">Table S6</xref>
). Taking a conservative approach to variant calling given the disparate sequencing coverage (median 88×, range 16–295×), capture platforms, and availability of germline data, we report a median number of somatic single nucleotide variants (SNVs) and insertion/deletions (InDels) of 12, with 97% cases in the range 0–305. DNA copy neutral cases had significantly fewer somatic mutations (median 8.37 versus 21.32 SNVs/InDels per case), with those copy neutral cases also having no detectable mutations falling into the youngest age group (median = 3.9 years). There was only a modestly elevated mutation rate between samples taken post- compared with pre-treatment (1.5-fold, p = 0.056, t test) (<xref rid="mmc1" ref-type="supplementary-material">Figure S6</xref>
A). However, 11 cases had a vastly increased mutational burden, described as a hypermutator phenotype (median 13,735 SNVs/InDels, range 852–38,250), with distinctive mutational spectra from non-hypermutated pHGG/DIPG (<xref rid="bib39" ref-type="bibr">Shlien et al., 2015</xref>
), including three cases with plausible somatic activating <italic>POLE</italic>
mutations (<xref rid="mmc1" ref-type="supplementary-material">Figure S6</xref>
B). <italic>IDH1</italic>
-mutant cases were again excluded (n = 14), with genetic profiles identical to that described in adults for astrocytic tumors (13/14 <italic>TP53</italic>
, 7/14 <italic>ATRX</italic>
mutations), and oligodendroglial tumors (1p19q co-deletion, <italic>TERT</italic>
promoter, <italic>CIC</italic>
, <italic>FUBP1</italic>
mutations) entirely absent (<xref rid="mmc1" ref-type="supplementary-material">Figure S6</xref>
C). We were thus left with an integrated dataset of 326 pHGG/DIPG, providing robust annotation of the most frequently altered genes across histone H3 subgroups and anatomical locations (<xref rid="fig6" ref-type="fig">Figure 6</xref>
A). As well as known associations such as hemispheric H3.3G34R/V and <italic>TP53/ATRX</italic>
(18/20, 90%; p = 0.0001), midline H3.3K27M and <italic>FGFR1</italic>
(8/39, 20.5%; p = 0.212, not significant), pontine H3.1K27M and <italic>ACVR1</italic>
(28/33, 84.8%; p < 0.0001), and PXA-like GBM with <italic>BRAF</italic>
V600E (17/28, 60.7%; p < 0.0001), we also identified previously unrecognized co-segregating mutations including H3.3G34R/V and <italic>ARID1B</italic>
(2/20, 10%; p = 0.0720), H3.3K27M DIPG and <italic>ATM</italic>
and <italic>ASXL1</italic>
(5/93, 10.7%; p = 0.0473), and H3.1K27M and <italic>BCOR</italic>
(6/37, 16.2%; p = 0.0022, all Fisher’s exact test) (<xref rid="mmc1" ref-type="supplementary-material">Figure S6</xref>
D). We also identified recurrent events in genes such as <italic>PTPN23</italic>
(protein tyrosine phosphatase, non-receptor type 23, n = 5), <italic>SOX10</italic>
(SRY-box 10, n = 5)<italic>, SRCAP</italic>
(Snf2-related CREBBP activator protein, n = 5), <italic>DEPDC5</italic>
(DEP domain-contain 5, member of GATOR complex, n = 4), <italic>SGK223</italic>
(PEAK1-related kinase activating pseudokinase, n = 4), and others (<xref rid="fig6" ref-type="fig">Figure 6</xref>
B).<fig id="fig6"><label>Figure 6</label>
<caption><p>Somatic Mutations in pHGG/DIPG</p>
<p>(A) Oncoprint representation of an integrated annotation of somatic mutations and DNA copy-number changes for the 30 most frequently altered genes in 326 pHGG/DIPG (n ≥ 6, frequency barplot on the right). Selected common fusion events are also shown where available. Samples are arranged in columns with genes labeled along rows. Age at diagnosis is provided below. Underneath, barplots are provided on a log<sub>10</sub>
scale for numbers of copy-number aberrations and somatic mutations per case. Clinicopathological and molecular annotations are provided as bars according to the included key.</p>
<p>(B) Barplot of all recurrent somatic mutations across all 326 cases, in order of frequency, and colored independently by both anatomical location and histone mutation. See also <xref rid="mmc1" ref-type="supplementary-material">Figure S6</xref>
and <xref rid="mmc7" ref-type="supplementary-material">Table S6</xref>
.</p>
</caption>
<graphic xlink:href="gr6"></graphic>
</fig>
</p>
</sec>
<sec id="sec3.6"><title>Integrated Pathway Analysis</title>
<p>Many of the rare variants we identified (<xref rid="mmc1" ref-type="supplementary-material">Figure S6</xref>
E) were found in genes associated with intracellular signaling pathways and processes more commonly targeted by high-frequency events, often in a mutually exclusive manner. In total, 297/326 (91.1%) of cases were found to harbor genetic alterations in one or more of nine key biological processes (<xref rid="fig7" ref-type="fig">Figure 7</xref>
A). These included well-recognized pathways such as DNA repair (198/326, 60.7%), largely driven by <italic>TP53</italic>
mutations (n = 160), but also by common mutually exclusive (p < 0.0001, Fisher’s exact test) activating truncating alterations in <italic>PPM1D</italic>
(n = 18), as well as heterozygous mutations in a diverse set of genes including those involved in homologous recombination (<italic>ATM, BRCA2, BLM, ATR, PALB2, RAD50,</italic>
and <italic>RAD51C</italic>
) and numerous Fancomi anemia genes (<italic>BRIP1, FANCM, FANCA,</italic>
and <italic>FANCG</italic>
), among others (<xref rid="mmc1" ref-type="supplementary-material">Figure S7</xref>
A). Although <italic>TP53</italic>
is almost always found in concert with H3.3G34R/V in the cerebral hemispheres, these additional DNA repair pathway mutations were enriched in H3.3K27M DIPG (36/68, 52.9%). Also co-segregating with H3.3G34R/V and <italic>TP53</italic>
is <italic>ATRX</italic>
, although mutations/deletions of the latter gene are also frequently found in conjunction with H3.3K27M (28/54, 51.8%). <italic>ATRX</italic>
accounts for a large proportion of the cases harboring mutations in genes coding for chromatin modifiers (54/118, 45.8%); however, there is a diverse set of readers, writers, and erasers also targeted at lower frequency, especially in DIPG, including the previously mentioned <italic>BCOR</italic>
(n = 14) and <italic>ASXL1</italic>
(n = 6) in addition to <italic>SETD2</italic>
(n = 8)<italic>, KDM6B</italic>
(n = 6), <italic>SETD1B</italic>
(n = 5), and <italic>ARID1B</italic>
(n = 5) among many others (<xref rid="mmc1" ref-type="supplementary-material">Figure S7</xref>
B).<fig id="fig7"><label>Figure 7</label>
<caption><p>Integrated Pathway Analysis of pHGG/DIPG</p>
<p>(A) Oncoprint-style representation of an integrated annotation of somatic mutations and DNA copy-number changes in one or more of nine commonly targeted pathways in 326 pHGG/DIPG (n ≥ 6, frequency barplot on the right). Samples are arranged in columns with pathways labeled along rows. Clinicopathological and molecular annotations are provided as bars according to the included key.</p>
<p>(B) Pathway enrichment analysis of pHGG/DIPG subgroups. Distinct pathways and biological processes between the subgroups are colored appropriately (FDR q < 0.01). Nodes represent enriched gene sets, which are grouped and annotated by their similarity according to related gene sets. Node size is proportional to the total number of genes within each gene set. The illustrated network map was simplified by manual curation to remove general and uninformative sub-networks. See also <xref rid="mmc1" ref-type="supplementary-material">Figure S7</xref>
and <xref rid="mmc8" ref-type="supplementary-material">Table S7</xref>
.</p>
</caption>
<graphic xlink:href="gr7"></graphic>
</fig>
</p>
<p>While <italic>CDKN2A/CDKN2B</italic>
deletions were almost entirely absent from DIPG (1/154, 0.65%), dysregulation of the G<sub>1</sub>
/S cell-cycle checkpoint was common throughout anatomical locations and subgroups (82/326, 25.2%), with amplifications of <italic>CCND2</italic>
and deletions of <italic>CDKN2C</italic>
predominating in the pons (n = 5/7 and 5/5 DIPG, respectively), in contrast to recurrent homozygous <italic>RB1</italic>
deletions and <italic>CDK6</italic>
amplifications (n = 6/7 and 4/6 hemispheric) (<xref rid="mmc1" ref-type="supplementary-material">Figure S4</xref>
A) (<xref rid="mmc1" ref-type="supplementary-material">Figure S7</xref>
C).</p>
<p>Subgroup-specific dysregulation was also observed when considering discrete components of the RTK-PI3K-MAPK pathway. In total, 201/326 (61.7%) cases harbored alterations in any given node; however, for H3.3G34R/V this was predominantly at the RTK level (11/20, n = 9 <italic>PDGFRA</italic>
) (<xref rid="mmc1" ref-type="supplementary-material">Figure S7</xref>
D), whereas H3.1K27M cases were enriched for PI3K/mTOR alterations (17/37, n = 9 <italic>PIK3CA,</italic>
n = 5 <italic>PIK3R1</italic>
) (<xref rid="mmc1" ref-type="supplementary-material">Figure S7</xref>
E), and H3 WT cases harbored the highest frequency of MAPK alterations (mainly <italic>BRAF</italic>
V600E in PXA-like, n = 5/10 plus one <italic>NF1</italic>
) (<xref rid="mmc1" ref-type="supplementary-material">Figure S7</xref>
F). <italic>NRTK1-NRTK3</italic>
fusions were enriched in the infant group (4/6 fusions under 1 year old, median age 3.25 versus 8.5 years, p = 0.00033, t test) (<xref rid="mmc1" ref-type="supplementary-material">Figure S7</xref>
D). We further identified mutations in genes regulating mTOR signaling, including <italic>TSC2</italic>
(n = 3), <italic>RPTOR,</italic>
and <italic>MTOR</italic>
itself (both n = 2), as well as a diverse series of SNVs and fusion candidates in MAPKs across all subgroups and locations (<italic>MAP2K7</italic>
, <italic>MAP3K15</italic>
, <italic>MAP3K4</italic>
and others) (<xref rid="mmc1" ref-type="supplementary-material">Figure S7</xref>
F).</p>
<p>BMP signaling was significantly enriched in H3.1K27M DIPG due to the strong correlation with <italic>ACVR1</italic>
mutations; however, alterations in other pathway members such as amplification of <italic>ID2</italic>
(n = 10) or <italic>ID3</italic>
(n = 3) and mutations in <italic>BMP3</italic>
(n = 5), <italic>BMP2K</italic>
(n = 3), and others across locations and subgroups, extends the proportion of tumors for which this pathway may be relevant (62/326, 18.7%) (<xref rid="mmc1" ref-type="supplementary-material">Figure S7</xref>
G). There was also a subset of cases harboring alterations in members of the WNT signaling pathway (16/326, 4.9%), including <italic>AMER1, APC</italic>
(both n = 3), and <italic>WNT8A</italic>
, <italic>WNT9A, PLAGL2</italic>
, and <italic>TCF7L2</italic>
(all n = 2) (<xref rid="mmc1" ref-type="supplementary-material">Figure S7</xref>
H).</p>
<p>Uniquely, the accumulated data uncovered a series of additional processes involved in maintenance of DNA replication, genome integrity, or transcriptional fidelity, targeted by infrequent but mutually exclusive alterations in pHGG and DIPG. These included mutations in splicing factors (<italic>SF3A1, SF3A2, SF3A3, SF3B1, SF3B2,</italic>
and <italic>SF3B3,</italic>
total n = 10), sister chromatid segregation (<italic>STAG2, STAG3</italic>
, and <italic>ESPL</italic>
1, total n = 9), pre-miRNA processing (<italic>DICER</italic>
and <italic>DROSHA</italic>
, total n = 4), DNA polymerases (<italic>POLK, POLQ,</italic>
and <italic>POLR1B,</italic>
total n = 4), as well as genes involved in centromere (<italic>CENPB</italic>
, n = 3) and telomere maintenance (<italic>PML</italic>
, n = 2; <italic>TERT</italic>
, n = 7) (<xref rid="mmc1" ref-type="supplementary-material">Figure S7</xref>
I). <italic>TERT</italic>
promoter mutations were found in 5/326 (1.5%) cases; however, alternative lengthening of telomeres (ALT) status was only available for 26 cases, although the 5 ALT-positive samples (19.2%) were mutually exclusive with <italic>TERT</italic>
alterations.</p>
<p>We incorporated the integrated dataset into a pathway enrichment analysis (significant gene sets, false discovery rate [FDR] < 0.05, visualized as interaction networks by Cytoscape Enrichment Map) in order to gain additional insight into dysregulated biological processes. In addition to the subgroup-specific differential targeting of distinct nodes within common signaling pathways already described (e.g., RTK, PI3K/mTOR, and MAPK), additional dysregulated processes across the diversity of the disease were identified (<xref rid="fig7" ref-type="fig">Figure 7</xref>
B). This revealed the perhaps not unexpected dysregulation of numerous developmental and CNS-associated gene sets (various immature organ systems, neuronal communication), but also previously unrecognized areas such as nuclear transport, cell migration, and the immune response (<xref rid="mmc8" ref-type="supplementary-material">Table S7</xref>
), which may provide further insight into disease biology as well as represent potential therapeutic strategies targeting key regulators of tumor phenotype. Indeed, neuronal communication with pGBM and DIPG cells is a recently demonstrated microenvironmental driver of pediatric glioma growth (<xref rid="bib55" ref-type="bibr">Qin et al., 2017</xref>
, <xref rid="bib47" ref-type="bibr">Venkatesh et al., 2015</xref>
).</p>
</sec>
<sec id="sec3.7"><title>Histone H3/IDH1 WT Subgroups</title>
<p>Finally, we wanted to explore those cases absent of any histone H3 or <italic>IDH1</italic>
mutations in more depth. Using a t statistic-based stochastic neighbor embedding projection of the 450k methylation data, we identified three distinct clusters of tumors separate from the G34, K27, and IDH1 groups (<xref rid="fig8" ref-type="fig">Figure 8</xref>
A). Consensus clustering of the H3/IDH1 WT cases alone confirmed the presence of three robust subgroups (<xref rid="fig8" ref-type="fig">Figure 8</xref>
B), which were also recapitulated by unsupervised hierarchical clustering of the 10,000 probe classifier subset (<xref rid="fig8" ref-type="fig">Figure 8</xref>
C). These groups included a largely hemispheric set of tumors containing, but not restricted to, the PXA- and LGG-like subgroups (WT-A). These tumors were driven by <italic>BRAF</italic>
V600E, <italic>NF1</italic>
mutations, or fusions in RTKs including <italic>MET</italic>
, <italic>FGFR2</italic>
, and <italic>NTRK2,3</italic>
(<xref rid="fig8" ref-type="fig">Figure 8</xref>
D). Although including many younger patients, the ages varied widely (<xref rid="fig8" ref-type="fig">Figure 8</xref>
E). Regardless, this group had the best overall survival (median = 63 months, p < 0.0001 versus rest, log rank test) (<xref rid="fig8" ref-type="fig">Figure 8</xref>
F), with the non-PXA/LGG-like tumors within this group themselves having an extended median survival time of 38 months (p = 0.00928 versus other H3/IDH1 WTs, log rank test). Taking an integrated gene expression profiling dataset (<xref rid="mmc1" ref-type="supplementary-material">Figures S8</xref>
A–S8E), these tumors were found to have upregulation of gene signatures associated with cytokine signaling and cell junction organization (<xref rid="mmc1" ref-type="supplementary-material">Figures S8</xref>
F and S8G). A second group of tumors (WT-B) were found in all anatomical compartments, and were distinguished by chromosome 2 gains (<xref rid="fig8" ref-type="fig">Figure 8</xref>
C) and, most notably, by high-level amplifications in <italic>EGFR</italic>
, <italic>CDK6</italic>
, and <italic>MYCN</italic>
(p = 0.00033, p = 0.0299, p = 0.00037, respectively, Fisher’s exact test), with an imperfect overlay to the classifier “GBM_pedRTK” and “GBM_MYCN” groups (<xref rid="fig8" ref-type="fig">Figure 8</xref>
D). This group had strong upregulation of MYC target genes, and had the poorest overall survival (median = 14 months) (<xref rid="fig8" ref-type="fig">Figure 8</xref>
F). The remaining cases encompassed a methylation classifier group described as “HGG_MID,” although in fact were split 80:20 hemispheric:midline (WT-C) (<xref rid="fig8" ref-type="fig">Figure 8</xref>
C). This group was enriched for chromosome 1p and 20q loss, 17q gain (p = 0.00595, p = 0.0286, p = 0.0478, respectively, Fisher’s exact test) (<xref rid="fig8" ref-type="fig">Figure 8</xref>
C), harbored <italic>PDGFRA</italic>
and <italic>MET</italic>
amplifications (p = 0.0159, Fisher’s exact test) (<xref rid="fig8" ref-type="fig">Figure 8</xref>
D), and was strongly associated with the adult GBM-defined “Proneural” gene signature. These patients had a median survival of 18 months.<fig id="fig8"><label>Figure 8</label>
<caption><p>Integrated Analysis of H3/IDH1 WT pHGG/DIPG</p>
<p>(A) t Statistic-based stochastic neighbor embedding (t-SNE) projection of the combined 450k methylation dataset (n = 441). The first three projections are plotted in the x, y, and z axes, with samples represented by dots colored by histone H3G34 (blue), H3K27 (green), IDH1 (red), PXA-like (dark gold), LGG-like (tan), and “others” (gray).</p>
<p>(B) K means consensus clustering on the H3/IDH1 WT cases highlights three stable clusters (left, black/brown [WT-A], gray/pink [WT-B], and dark cyan [WT-C]) as the most robust subdivision of the data (right, area under the curve analysis for different cluster numbers).</p>
<p>(C) Unsupervised hierarchical clustering and attendant heatmap of the H3/IDH1 WT cases (n = 219). Samples are arranged in columns clustered by the most variable 1,521 classifier probes. Age at diagnosis is provided below. Clinicopathological and molecular annotations are provided as bars according to the included key.</p>
<p>(D) Oncoprint representation of an integrated annotation of somatic mutations and DNA copy-number changes for the H3/IDH1 WT cases (n = 50). Samples are arranged in columns with genes labeled along rows. Age at diagnosis is provided below. Clinicopathological and molecular annotations are provided as bars according to the included key.</p>
<p>(E) Boxplot showing age at diagnosis of H3/IDH1 WT subgroups, separated by anatomical location (n = 190). The thick line within the box is the median, the lower and upper limits of the boxes represent the first and third quartiles, and the whiskers 1.5× the interquartile range.</p>
<p>(F) Kaplan-Meier plot of overall survival of H3/IDH1 WT subgroups separated by anatomical location, p value calculated by the log rank test (n = 150). See also <xref rid="mmc1" ref-type="supplementary-material">Figure S8</xref>
and <xref rid="mmc9" ref-type="supplementary-material">Table S8</xref>
.</p>
</caption>
<graphic xlink:href="gr8"></graphic>
</fig>
</p>
<p>Although there remain tumors without detectable genetic alterations, we are nonetheless able to assign clinically meaningful subgroups with plausible driver alterations to the vast majority of pediatric HGG/DIPG.</p>
</sec>
</sec>
<sec id="sec4"><title>Discussion</title>
<p>Integrated molecular profiling has revolutionized the study of diffusely infiltrating high-grade glial tumors in children, providing evidence for unique mechanisms of molecular pathogenesis reflecting their distinct developmental origins (<xref rid="bib1" ref-type="bibr">Baker et al., 2015</xref>
, <xref rid="bib21" ref-type="bibr">Jones and Baker, 2014</xref>
). Although they are relatively rare, the present study accumulates 1,067 unique cases, a number similar to the aggregated analysis of the The Cancer Genome Atlas adult LGG/GBM cohorts (n = 1122, with grade III included in the “lower-grade” series) (<xref rid="bib12" ref-type="bibr">Ceccarelli et al., 2016</xref>
). Although there are clearly the usual caveats with such retrospective analyses of inconsistently annotated and treated cases, the cohort appears to represent a clinically useful approximation of the diversity of the pHGG/DIPG population.</p>
<p>In adults, the key distinction is between <italic>IDH1</italic>
mutant (G-CIMP/<italic>ATRX</italic>
/<italic>TP53</italic>
or 1p19q co-deleted/<italic>TERT</italic>
promoter mutated) and WT (classical, mesenchymal, PA-like) (<xref rid="bib12" ref-type="bibr">Ceccarelli et al., 2016</xref>
), whereas in the childhood setting <italic>IDH1</italic>
mutations were restricted to a small proportion (6.25%) of tumors mostly in adolescents (representing the tail end of an overwhelmingly adult disease), and harbored only rare examples of the common alterations seen in WT adult GBM (e.g., 4.9% <italic>EGFR</italic>
mutation/amplification). Instead, most prominent among the differences between pediatric and adult studies is the frequency of hotspot mutations in genes encoding histone H3 variants: 2/820 (0.2%) in adults (<xref rid="bib12" ref-type="bibr">Ceccarelli et al., 2016</xref>
) versus 449/893 (50.3%) in the present pHGG/DIPG series.</p>
<p>The importance of recurrent H3 mutations in the childhood setting has become increasingly clear since their unexpected discovery in 2012 (<xref rid="bib38" ref-type="bibr">Schwartzentruber et al., 2012</xref>
, <xref rid="bib50" ref-type="bibr">Wu et al., 2012</xref>
), with clear clinicopathological differences associated with distinct variants (<xref rid="bib21" ref-type="bibr">Jones and Baker, 2014</xref>
, <xref rid="bib23" ref-type="bibr">Jones et al., 2016</xref>
, <xref rid="bib41" ref-type="bibr">Sturm et al., 2014</xref>
), and fundamental insights into mechanisms of epigenetically linked tumorigenesis (<xref rid="bib4" ref-type="bibr">Bender et al., 2013</xref>
, <xref rid="bib5" ref-type="bibr">Bjerke et al., 2013</xref>
, <xref rid="bib13" ref-type="bibr">Chan et al., 2013</xref>
, <xref rid="bib17" ref-type="bibr">Funato et al., 2014</xref>
). Despite this, precisely how we can target these mutations clinically remains elusive (<xref rid="bib18" ref-type="bibr">Grasso et al., 2015</xref>
, <xref rid="bib19" ref-type="bibr">Hennika et al., 2017</xref>
). Data from such a large series of tumors demonstrates the robustness of the histone-defined subgroups in terms of anatomical location, age of incidence, clinical outcome, methylation and gene expression profiles, copy-number changes, co-segregating somatic mutations, and pathway dysregulation. As most of the non-histone molecular alterations previously reported in pHGG/DIPG have been relatively infrequent, it is only through this accumulated dataset that we have been able to uncover subgroup-specific genes/processes that may play a role as diagnostic, prognostic, or predictive markers or drug targets in these diseases.</p>
<p>H3.3G34R/V-mutant tumors are restricted to the cerebral hemispheres and co-segregate with <italic>ATRX</italic>
and <italic>TP53</italic>
mutations; they are also the only pediatric subgroup to harbor frequent <italic>MGMT</italic>
promoter methylation (<xref rid="bib25" ref-type="bibr">Korshunov et al., 2015</xref>
). Copy-number profiling of 63 cases highlighted a significant enrichment of chromosomal arm losses at 3q, 4q, 5q, and 18q, further refined by smallest region of overlap and GISTIC analyses. At 4q31.3, this identified <italic>FBXW7</italic>
as a candidate gene target of the loss. <italic>FBXW7</italic>
encodes a member of the F box protein family and is frequently deleted/mutated in cancer, supporting its tumor-suppressive function (<xref rid="bib14" ref-type="bibr">Davis et al., 2014</xref>
); notably in relation to H3.3G34R/V it has been reported to play a role in MYC/MYCN stabilization through its action as a component of the SCF-like ubiquitin ligase complex that targets MYC/MYCN for proteasomal degradation (<xref rid="bib48" ref-type="bibr">Welcker et al., 2004</xref>
, <xref rid="bib52" ref-type="bibr">Yada et al., 2004</xref>
). With MYCN upregulated in H3.3G34R/V tumors through differential H3K36me3 binding (<xref rid="bib5" ref-type="bibr">Bjerke et al., 2013</xref>
), this observation adds to the mechanisms by which Myc proteins exert their influence in this subgroup, and provide further rationale for the observed effects of disrupting these interactions, such as with Aurora kinase A inhibitors which target the direct interaction between the catalytic domain of Aurora A and a site flanking Myc Box I that also binds SCF/FbxW7 (<xref rid="bib36" ref-type="bibr">Richards et al., 2016</xref>
).</p>
<p>H3.3K27M tumors are found in two-thirds of DIPG and non-brainstem midline pHGG alike, where they are associated with a shorter overall survival in both locations, as well as in the small number of cases reported in the cortex. Although presumably reflecting a common or overlapping origin, the pattern of co-segregating mutations differ, e.g., <italic>PDGFRA</italic>
alterations predominating in the pons, and <italic>FGFR1</italic>
variants being largely restricted to the thalamus (<xref rid="bib16" ref-type="bibr">Fontebasso et al., 2014</xref>
). Our analysis of more than 300 cases further identifies differential amplification of <italic>CCND2</italic>
(DIPG) and <italic>CDK4</italic>
(non-brainstem midline), and, most strikingly, an amplification at 17p11.2 involving <italic>TOP3A</italic>
in H3.3K27M DIPG. This complex rearrangement often involves loss of the more distal part of 17p involving <italic>TP53</italic>
, along with intra- or inter-chromosomal translocations to deliver an increase in <italic>TOP3A</italic>
copy number and gene expression. <italic>TOP3A</italic>
encodes DNA topoisomerase III alpha, which forms a complex with BLM (<xref rid="bib49" ref-type="bibr">Wu et al., 2000</xref>
), has an important role in homologous recombination (<xref rid="bib53" ref-type="bibr">Yang et al., 2010</xref>
), and has been implicated in maintenance of the ALT phenotype (<xref rid="bib45" ref-type="bibr">Temime-Smaali et al., 2009</xref>
). Notably, <italic>TOP3A</italic>
amplification/mutation was found to be mutually exclusive with <italic>ATRX</italic>
mutation in H3.3K27M DIPG, with depletion by small interfering RNA reducing ALT cell survival (<xref rid="bib44" ref-type="bibr">Temime-Smaali et al., 2008</xref>
), and therefore represents a potential therapeutic target in this subgroup.</p>
<p>H3.1K27M tumors by contrast are restricted to the pons, patients are younger and with a slightly longer survival (<xref rid="bib11" ref-type="bibr">Castel et al., 2015</xref>
), and are largely defined at the copy-number level by whole chromosomal arm gains and losses (<xref rid="bib42" ref-type="bibr">Taylor et al., 2014a</xref>
). They have the well-recognized association with <italic>ACVR1</italic>
mutation (<xref rid="bib43" ref-type="bibr">Taylor et al., 2014b</xref>
); however, we also identify an enrichment of downstream PI3K pathway mutations (<italic>PIK3CA</italic>
and <italic>PIK3R1</italic>
) in comparison with the largely upstream RTK alterations present in H3.3K27M DIPGs, important in designing stratified trials and combinatorial therapies. Further association with mutations of the BCL6 repressor gene <italic>BCOR</italic>
, commonly altered in medulloblastomas, neuroepithelial tumors, and sarcomas, highlights a further avenue for interventional study through its regulation of the SHH pathway (<xref rid="bib46" ref-type="bibr">Tiberi et al., 2014</xref>
).</p>
<p>In H3/IDH1 WT cases, methylation profiling refines the heterogeneous collection of tumors, particularly identifying two predominantly hemispheric intermediate risk subgroups that classify alongside other entities (PXA- and LGG-like) in a larger series of better outcome tumors (WT-A). These had already been strongly linked with dysregulation of the MAPK pathway (<italic>BRAF</italic>
V600E) (<xref rid="bib25" ref-type="bibr">Korshunov et al., 2015</xref>
) along with <italic>CDKN2A/CDKN2B</italic>
deletion (<xref rid="bib29" ref-type="bibr">Nicolaides et al., 2011</xref>
). However, with molecular markers such as losses at 1q and 17p appearing to confer a worse outcome there may be more than one subgroup within this entity, and a co-clustering group of H3/IDH1 WT tumors appeared distinctly driven by somatic <italic>NF1</italic>
mutation. The LGG-like tumors generally occur in very young patients, where the appearance of few genetic alterations and a significantly better prognosis is shared by the majority of infant HGG. Gene fusion events, including those targeting <italic>NTRKs1-NTRK3</italic>
, are common in this age range. Notably this enhanced survival is restricted to patients diagnosed under 12 months of age, and is not recapitulated in the 1–3 year age group, although this is the common clinical definition of “infants” in many centers.</p>
<p>Excluding these morphologically high-grade but biologically and clinically low-grade tumors, the remaining H3/IDH1 WT cases can be further split into two poor-outcome groups driven by <italic>EGFR</italic>
/<italic>MYCN</italic>
/<italic>CDK6</italic>
(WT-B) or <italic>PDGFRA</italic>
/<italic>MET</italic>
(WT-C) or amplifications. These groups overlap with other methylation-based classification groups (PDGFRA versus EGFR versus MYCN (<xref rid="bib26" ref-type="bibr">Korshunov et al., 2017</xref>
); “GBM_pedRTK” versus “GBM_MYCN” versus “HGG_MID” (<ext-link ext-link-type="uri" xlink:href="http://molecularneuropathology.org/mnp" id="intref0010">molecularneuropathology.org/mnp</ext-link>
), however, are uniquely defined here spanning anatomical locations and integrated with sequencing data. Further exploration of these heterogeneous subgroups in order to refine integrated molecular diagnostics to prioritize patient subpopulations for stratified treatment remains a priority.</p>
<p>The remarkable biological diversity spanning pediatric malignant glioma is finally demonstrated by the <5% tumors with a hypermutator phenotype, some of the greatest mutational burdens in all human cancer, and candidates for immune checkpoint inhibitors (<xref rid="bib6" ref-type="bibr">Bouffet et al., 2016</xref>
). Previously unrecognized processes altered in small subsets of tumors identified through this meta-analysis, such as the splicing machinery, miRNA regulation, and the WNT pathway offer further areas for exploration. The thorough cataloging of dysregulated molecular pathways across the whole spectrum of pediatric diffusely infiltrating gliomas in the present study provides the basis for novel therapeutic development.</p>
</sec>
<sec id="sec5"><title>STAR★Methods</title>
<sec id="sec5.1"><title>Key Resources Table</title>
<p><table-wrap id="undtbl1" position="float"><table frame="hsides" rules="groups"><thead><tr><th>REAGENT or RESOURCE</th>
<th>SOURCE</th>
<th>IDENTIFIER</th>
</tr>
</thead>
<tbody><tr><td colspan="3"><bold>Critical Commercial Assays</bold>
</td>
</tr>
<tr><td colspan="3"><hr></hr>
</td>
</tr>
<tr><td>DNeasy blood & tissue kit</td>
<td>Qiagen</td>
<td>69504</td>
</tr>
<tr><td>QIAmp DNA FFPE tissue kit</td>
<td>Qiagen</td>
<td>56404</td>
</tr>
<tr><td>RNeasy mini kit</td>
<td>Qiagen</td>
<td>74104</td>
</tr>
<tr><td>QIAquick PCR purification kit</td>
<td>Qiagen</td>
<td>28104</td>
</tr>
<tr><td>BigDye terminator v3.1 mix</td>
<td>Thermo Fisher</td>
<td>4337455</td>
</tr>
<tr><td>SureSelect Human All Exon capture set V4<break></break>
SureSelect Human All Exon capture set V5</td>
<td>Agilent</td>
<td>5190-4666<break></break>
5190-6208</td>
</tr>
<tr><td>SureSelect RNA Capture, 0.5-2.9Mb</td>
<td>Agilent</td>
<td>5190-4944</td>
</tr>
<tr><td colspan="3"><hr></hr>
</td>
</tr>
<tr><td colspan="3"><bold>Deposited Data</bold>
</td>
</tr>
<tr><td colspan="3"><hr></hr>
</td>
</tr>
<tr><td>Exome and RNA sequencing of new samples</td>
<td>This paper</td>
<td>EGA: EGAS00001002314</td>
</tr>
<tr><td>Illumina methylation BeadChip profiling of new samples</td>
<td>This paper</td>
<td>ArrayExpress:<break></break>
<ext-link ext-link-type="uri" xlink:href="array-express:E-MTAB-5528" id="intref0015">E-MTAB-5528</ext-link>
</td>
</tr>
<tr><td>Sequencing and methylation data</td>
<td>This paper</td>
<td>cavatica.org</td>
</tr>
<tr><td colspan="3"><hr></hr>
</td>
</tr>
<tr><td colspan="3"><bold>Oligonucleotides</bold>
</td>
</tr>
<tr><td colspan="3"><hr></hr>
</td>
</tr>
<tr><td>Primer: H3F3A_forward<break></break>
TGGCTCGTACAAAGCAGACT</td>
<td>This paper</td>
<td>N/A</td>
</tr>
<tr><td>Primer: H3F3A_reverse<break></break>
ATATGGATACATACAAGAGAGACT</td>
<td>This paper</td>
<td>N/A</td>
</tr>
<tr><td>Primer: HIST1H3B_forward<break></break>
GGGCAGGAGCCTCTCTTAAT</td>
<td>This paper</td>
<td>N/A</td>
</tr>
<tr><td>Primer: HIST1H3B _ reverse<break></break>
ACCAAGTAGGCCTCACAAGC</td>
<td>This paper</td>
<td>N/A</td>
</tr>
<tr><td colspan="3"><hr></hr>
</td>
</tr>
<tr><td colspan="3"><bold>Software and Algorithms</bold>
</td>
</tr>
<tr><td colspan="3"><hr></hr>
</td>
</tr>
<tr><td>Mutation Surveyor</td>
<td>SoftGenetics</td>
<td><ext-link ext-link-type="uri" xlink:href="http://softgenetics.com/mutationSurveyor.php" id="intref0020">softgenetics.com/mutationSurveyor.php</ext-link>
</td>
</tr>
<tr><td>4Peaks</td>
<td>Nucleobytes</td>
<td><ext-link ext-link-type="uri" xlink:href="http://nucleobytes.com/4peaks/" id="intref0025">http://nucleobytes.com/4peaks/</ext-link>
</td>
</tr>
<tr><td>limma</td>
<td>BioConductor</td>
<td><ext-link ext-link-type="uri" xlink:href="http://bioconductor.org/packages/release/bioc/html/limma.html" id="intref0030">bioconductor.org/packages/release/bioc/html/limma.html</ext-link>
</td>
</tr>
<tr><td>marray</td>
<td>BioConductor</td>
<td><ext-link ext-link-type="uri" xlink:href="http://bioconductor.org/packages/release/bioc/html/marray.html" id="intref0035">bioconductor.org/packages/release/bioc/html/marray.html</ext-link>
</td>
</tr>
<tr><td>aroma.affymetrix</td>
<td>The Comprehensive R Archive Network</td>
<td><ext-link ext-link-type="uri" xlink:href="http://cran.rstudio.com/web/packages/aroma.affymetrix/index.html" id="intref0040">cran.rstudio.com/web/packages/aroma.affymetrix/index.html</ext-link>
</td>
</tr>
<tr><td>aroma.cn</td>
<td>The Comprehensive R Archive Network</td>
<td><ext-link ext-link-type="uri" xlink:href="http://cran.r-project.org/web/packages/aroma.cn/index.html" id="intref0045">cran.r-project.org/web/packages/aroma.cn/index.html</ext-link>
</td>
</tr>
<tr><td>minfi</td>
<td>BioConductor</td>
<td><ext-link ext-link-type="uri" xlink:href="http://bioconductor.org/packages/release/bioc/html/minfi.html" id="intref0050">bioconductor.org/packages/release/bioc/html/minfi.html</ext-link>
</td>
</tr>
<tr><td>conumee</td>
<td>BioConductor</td>
<td><ext-link ext-link-type="uri" xlink:href="http://bioconductor.org/packages/release/bioc/html/conumee.html" id="intref0055">bioconductor.org/packages/release/bioc/html/conumee.html</ext-link>
</td>
</tr>
<tr><td>BEDtools</td>
<td>University of Utah</td>
<td><ext-link ext-link-type="uri" xlink:href="http://github.com/arq5x/bedtools2" id="intref0060">github.com/arq5x/bedtools2</ext-link>
</td>
</tr>
<tr><td>DNAcopy</td>
<td>BioConductor</td>
<td><ext-link ext-link-type="uri" xlink:href="http://bioconductor.org/packages/release/bioc/html/DNAcopy.html" id="intref0065">bioconductor.org/packages/release/bioc/html/DNAcopy.html</ext-link>
</td>
</tr>
<tr><td>gviz</td>
<td>BioConductor</td>
<td><ext-link ext-link-type="uri" xlink:href="http://bioconductor.org/packages/release/bioc/html/Gviz.html" id="intref0070">bioconductor.org/packages/release/bioc/html/Gviz.html</ext-link>
</td>
</tr>
<tr><td>GISTIC</td>
<td>Broad Institute</td>
<td><ext-link ext-link-type="uri" xlink:href="http://oftware.broadinstitute.org/software/cprg/?q=node/31" id="intref0075">oftware.broadinstitute.org/software/cprg/?q=node/31</ext-link>
</td>
</tr>
<tr><td>CopyNumber450kData</td>
<td>BioConductor</td>
<td><ext-link ext-link-type="uri" xlink:href="http://bioconductor.org/packages/release/data/experiment/html/CopyNumber450kData.html" id="intref0080">bioconductor.org/packages/release/data/experiment/html/CopyNumber450kData.html</ext-link>
</td>
</tr>
<tr><td>MNP</td>
<td>DKFZ Heidelberg</td>
<td><ext-link ext-link-type="uri" xlink:href="http://molecularneuropathology.org/mnp" id="intref0085">molecularneuropathology.org/mnp</ext-link>
</td>
</tr>
<tr><td>tSNE</td>
<td>The Comprehensive R Archive Network</td>
<td><ext-link ext-link-type="uri" xlink:href="http://cran.r-project.org/web/packages/Rtsne/index.html" id="intref0090">cran.r-project.org/web/packages/Rtsne/index.html</ext-link>
</td>
</tr>
<tr><td>rgl</td>
<td>The Comprehensive R Archive Network</td>
<td><ext-link ext-link-type="uri" xlink:href="http://cran.r-project.org/web/packages/rgl/index.html" id="intref0095">cran.r-project.org/web/packages/rgl/index.html</ext-link>
</td>
</tr>
<tr><td>affy</td>
<td>BioConductor</td>
<td><ext-link ext-link-type="uri" xlink:href="http://bioconductor.org/packages/release/bioc/html/affy.html" id="intref0100">bioconductor.org/packages/release/bioc/html/affy.html</ext-link>
</td>
</tr>
<tr><td>Bowtie2</td>
<td>Johns Hopkins University</td>
<td><ext-link ext-link-type="uri" xlink:href="http://bowtie-bio.sourceforge.net/bowtie2/index.shtml" id="intref0105">bowtie-bio.sourceforge.net/bowtie2/index.shtml</ext-link>
</td>
</tr>
<tr><td>TopHat</td>
<td>Johns Hopkins University</td>
<td><ext-link ext-link-type="uri" xlink:href="http://ccb.jhu.edu/software/tophat/index.shtml" id="intref0110">ccb.jhu.edu/software/tophat/index.shtml</ext-link>
</td>
</tr>
<tr><td>cufflinks</td>
<td>University of Washington</td>
<td><ext-link ext-link-type="uri" xlink:href="http://ole-trapnell-lab.github.io/cufflinks/cufflinks/" id="intref0115">ole-trapnell-lab.github.io/cufflinks/cufflinks/</ext-link>
</td>
</tr>
<tr><td>DESeq2</td>
<td>BioConductor</td>
<td><ext-link ext-link-type="uri" xlink:href="http://bioconductor.org/packages/release/bioc/html/DESeq2.html" id="intref0120">bioconductor.org/packages/release/bioc/html/DESeq2.html</ext-link>
</td>
</tr>
<tr><td>Gene Set Enrichment Analysis</td>
<td>Broad Institute</td>
<td><ext-link ext-link-type="uri" xlink:href="http://software.broadinstitute.org/gsea" id="intref0125">http://software.broadinstitute.org/gsea</ext-link>
</td>
</tr>
<tr><td>bwa</td>
<td>Sanger Institute</td>
<td><ext-link ext-link-type="uri" xlink:href="http://bio-bwa.sourceforge.net/" id="intref0130">http://bio-bwa.sourceforge.net/</ext-link>
</td>
</tr>
<tr><td>Genome Analysis Toolkit</td>
<td>Broad Institute</td>
<td><ext-link ext-link-type="uri" xlink:href="http://oftware.broadinstitute.org/gatk/" id="intref0135">oftware.broadinstitute.org/gatk/</ext-link>
</td>
</tr>
<tr><td>Variant Effect predictor</td>
<td>Ensembl tools</td>
<td><ext-link ext-link-type="uri" xlink:href="http://ensembl.org/info/docs/variation/vep" id="intref0140">ensembl.org/info/docs/variation/vep</ext-link>
</td>
</tr>
<tr><td>ANNOVAR</td>
<td>Children’s Hospital of Philadelphia</td>
<td><ext-link ext-link-type="uri" xlink:href="http://annovar.openbioinformatics.org/en/latest/" id="intref0145">annovar.openbioinformatics.org/en/latest/</ext-link>
</td>
</tr>
<tr><td>ExAc</td>
<td>Broad Institute</td>
<td><ext-link ext-link-type="uri" xlink:href="http://exac.broadinstitute.org/" id="intref0150">exac.broadinstitute.org/</ext-link>
</td>
</tr>
<tr><td>BCBio</td>
<td>Harvard TH Chan</td>
<td><ext-link ext-link-type="uri" xlink:href="http://bcb.io/" id="intref0155">bcb.io/</ext-link>
</td>
</tr>
<tr><td>SIFT</td>
<td>J Craig Venter Institute</td>
<td><ext-link ext-link-type="uri" xlink:href="http://sift.jcvi.org" id="intref0160">sift.jcvi.org</ext-link>
</td>
</tr>
<tr><td>PolyPhen</td>
<td>Harvard</td>
<td><ext-link ext-link-type="uri" xlink:href="http://genetics.bwh.harvard.edu/pph2" id="intref0165">genetics.bwh.harvard.edu/pph2</ext-link>
</td>
</tr>
<tr><td>ChimeraScan</td>
<td>University of Michigan</td>
<td><ext-link ext-link-type="uri" xlink:href="http://omictools.com/chimerascan-tool" id="intref0170">omictools.com/chimerascan-tool</ext-link>
</td>
</tr>
<tr><td>Breakdancer</td>
<td>Washington University of St Louis</td>
<td><ext-link ext-link-type="uri" xlink:href="http://breakdancer.sourceforge.net" id="intref0175">breakdancer.sourceforge.net</ext-link>
</td>
</tr>
<tr><td>ASCAT</td>
<td>Francis Crick Institute</td>
<td><ext-link ext-link-type="uri" xlink:href="http://rick.ac.uk/peter-van-loo/software/ASCAT" id="intref0180">rick.ac.uk/peter-van-loo/software/ASCAT</ext-link>
</td>
</tr>
<tr><td>Oncoprinter</td>
<td>Memorial Sloan Kettering</td>
<td><ext-link ext-link-type="uri" xlink:href="http://cbioportal.org/oncoprinter.jsp" id="intref0185">cbioportal.org/oncoprinter.jsp</ext-link>
</td>
</tr>
<tr><td>ProteinPaint</td>
<td>St Jude</td>
<td><ext-link ext-link-type="uri" xlink:href="http://pecan.stjude.org/#/proteinpaint" id="intref0190">pecan.stjude.org/#/proteinpaint</ext-link>
</td>
</tr>
<tr><td>Circos</td>
<td>Michael Smith Genome Sciences Center</td>
<td><ext-link ext-link-type="uri" xlink:href="http://circos.ca" id="intref0195">circos.ca</ext-link>
</td>
</tr>
<tr><td>MSigDB</td>
<td>Broad Institute</td>
<td><ext-link ext-link-type="uri" xlink:href="http://software.broadinstitute.org/gsea/msigdb" id="intref0200">http://software.broadinstitute.org/gsea/msigdb</ext-link>
</td>
</tr>
<tr><td>CytoScape</td>
<td>National Institute of General Medical Sciences</td>
<td><ext-link ext-link-type="uri" xlink:href="http://cytoscape.org" id="intref0205">cytoscape.org</ext-link>
</td>
</tr>
<tr><td>R</td>
<td>The Comprehensive R Archive Network</td>
<td><ext-link ext-link-type="uri" xlink:href="http://r-project.org" id="intref0210">r-project.org</ext-link>
</td>
</tr>
<tr><td colspan="3"><hr></hr>
</td>
</tr>
<tr><td colspan="3"><bold>Other</bold>
</td>
</tr>
<tr><td colspan="3"><hr></hr>
</td>
</tr>
<tr><td>Processed DNA copy number profiles</td>
<td>This paper and cited sources</td>
<td><ext-link ext-link-type="uri" xlink:href="http://dipg.progenetix.org" id="intref0215">dipg.progenetix.org</ext-link>
<break></break>
<ext-link ext-link-type="uri" xlink:href="http://arraymap.org" id="intref0220">arraymap.org</ext-link>
</td>
</tr>
<tr><td>Integrated mutation, copy number, expression and methylation data</td>
<td>This paper and cited sources</td>
<td><ext-link ext-link-type="uri" xlink:href="http://pedcbioportal.org" id="intref0225">pedcbioportal.org</ext-link>
</td>
</tr>
</tbody>
</table>
</table-wrap>
</p>
</sec>
<sec id="sec5.2"><title>Contact for Reagent and Resource Sharing</title>
<p>Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Chris Jones (<ext-link ext-link-type="uri" xlink:href="mailto:chris.jones@icr.ac.uk" id="intref0230">chris.jones@icr.ac.uk</ext-link>
).</p>
</sec>
<sec id="sec5.3"><title>Experimental Model and Subject Details</title>
<sec id="sec5.3.1"><title>Patient Samples</title>
<p>All new patient material was collected after informed consent and subject to local research ethics committee approval. We collated and profiled 157 unpublished cases of HGG in children and young adults up to the age of 30 years at diagnosis obtained from the Royal Marsden, St Georges and Kings College Hospitals, (n=39, all London, UK), Chinese University of Hong Kong (n=24, Hong Kong, China), Qilu University Hospital (n=23, Jinan, China), Farhad Hatched Hospital (n=14, Sousse, Tunisia), Federal University of São Paolo (n=14, São Paulo, Brazil), Morozov Children’s and Dmitri Rogachev Hospitals (n=12, Moscow, Russia), Queensland Children’s Tumor Bank (n=8, Brisbane, Australia), Hospital San Joan de Déu (n=8, Barcelona, Spain), City Hospital #31 (n=6, St Petersburg, Russia), Barretos Cancer Hospital (n=4, Barretos, Brazil), Centre Hospitalier Régional et Universitaire Hautepierre (n=3, Strasbourg, France), and Our Lady Children’s Hospital Crumlin (n=2, Dublin, Ireland). A full description of the samples included are provided in <xref rid="mmc2" ref-type="supplementary-material">Table S1</xref>
.</p>
</sec>
</sec>
<sec id="sec5.4"><title>Method Details</title>
<sec id="sec5.4.1"><title>Nucleic Acid Extraction</title>
<p>DNA was extracted from frozen tissue by homogenisation prior to following the DNeasy Blood & Tissue kit protocol (Qiagen, Crawley, UK). DNA was extracted from formalin-fixed, paraffin-embedded (FFPE) pathology blocks after manual macrodissection using the QIAamp DNA FFPE tissue kit protocol (Qiagen). Matched normal DNA was extracted from blood samples using the DNeasy Blood & Tissue kit (Qiagen, Crawley, UK). Concentrations were measured using a Qubit fluorometer (Life Technologies, Paisley, UK). RNA was extracted by following the RNeasy Mini Kit protocol (Qiagen), and quantified on a 2100 Bioanalyzer (Agilent Technologies).</p>
</sec>
<sec id="sec5.4.2"><title>Sanger Sequencing of <italic>H3F3A / HIST1H3B</italic>
</title>
<p>PCR for <italic>H3F3A</italic>
and <italic>HIST1H3B</italic>
was carried out using primers obtained from Life Technologies (Paisley, UK). Products were purified using the QIAquick PCR purification kit (Qiagen), subjected to bidirectional sequencing using BigDye Terminator mix 3.1 (Applied Biosystems, Foster City, CA, USA), with capillary sequencing was done on an ABI 3100 genetic analyzer (Applied Biosystems, Foster City, CA, USA). Sequences were analysed using Mutation Surveyor (SoftGenetics, PN, USA) and manually with 4Peaks (Nucleobytes, Aalsmeer, Netherlands).</p>
</sec>
<sec id="sec5.4.3"><title>Methylation Profiling</title>
<p>50-500 ng DNA was bisulphite-modified and analyzed for genome-wide methylation patterns using the Illumina HumanMethylation450 BeadArray (450k) platform at either the DKFZ or the University College London Genomics Centre, according the manufacturer’s instructions. All samples were checked for expected and unexpected genotype matches by pairwise correlation of the 65 genotyping probes on the 450k array.</p>
</sec>
<sec id="sec5.4.4"><title>Exome and RNA Sequencing</title>
<p>50-500 ng DNA was sequenced at the Tumor Profiling Unit, ICR, London, UK using the SureSelect Human All Exon capture sets V4 or V5 (Agilent, Santa Clara, CA, USA), and paired-end-sequenced on an Illumina HiSeq2000 (Illumina, San Diego, CA, USA) with a 100 bp read length. Coverage ranged from 29-295x (median=105x). RNA was sequenced at the ICR Tumor Profiling Unit after SureSelect RNA capture on an Illumina HiSeq2500 with a 125 bp read length.</p>
</sec>
</sec>
<sec id="sec5.5"><title>Quantification and Statistical Analysis</title>
<sec id="sec5.5.1"><title>Published Data Sources</title>
<p>These data were combined with those obtained directly from the authors or from public data repositories representing 20 published studies (<xref rid="bib2" ref-type="bibr">Barrow et al., 2011</xref>
, <xref rid="bib3" ref-type="bibr">Bax et al., 2010</xref>
, <xref rid="bib7" ref-type="bibr">Buczkowicz et al., 2014</xref>
, <xref rid="bib10" ref-type="bibr">Carvalho et al., 2014</xref>
, <xref rid="bib11" ref-type="bibr">Castel et al., 2015</xref>
, <xref rid="bib15" ref-type="bibr">Fontebasso et al., 2013</xref>
, <xref rid="bib16" ref-type="bibr">Fontebasso et al., 2014</xref>
, <xref rid="bib18" ref-type="bibr">Grasso et al., 2015</xref>
, <xref rid="bib20" ref-type="bibr">International Cancer Genome Consortium PedBrain Tumor Project, 2016</xref>
, <xref rid="bib24" ref-type="bibr">Khuong-Quang et al., 2012</xref>
, <xref rid="bib25" ref-type="bibr">Korshunov et al., 2015</xref>
, <xref rid="bib32" ref-type="bibr">Paugh et al., 2010</xref>
, <xref rid="bib33" ref-type="bibr">Paugh et al., 2011</xref>
, <xref rid="bib35" ref-type="bibr">Puget et al., 2012</xref>
, <xref rid="bib38" ref-type="bibr">Schwartzentruber et al., 2012</xref>
, <xref rid="bib40" ref-type="bibr">Sturm et al., 2012</xref>
, <xref rid="bib42" ref-type="bibr">Taylor et al., 2014a</xref>
, <xref rid="bib50" ref-type="bibr">Wu et al., 2012</xref>
, <xref rid="bib51" ref-type="bibr">Wu et al., 2014</xref>
, <xref rid="bib54" ref-type="bibr">Zarghooni et al., 2010</xref>
) with the following accession numbers: EGA - EGAS00001000226, EGAS0000100192, EGAS00001000575, EGAS00001000720, EGAS00001001139; the Gene Expression Omnibus (<ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov/geo/" id="intref0235">www.ncbi.nlm.nih.gov/geo/</ext-link>
) - <ext-link ext-link-type="uri" xlink:href="ncbi-geo:GSE19578" id="intref0240">GSE19578</ext-link>
, <ext-link ext-link-type="uri" xlink:href="ncbi-geo:GSE26576" id="intref0245">GSE26576</ext-link>
, <ext-link ext-link-type="uri" xlink:href="ncbi-geo:GSE21420" id="intref0250">GSE21420</ext-link>
, <ext-link ext-link-type="uri" xlink:href="ncbi-geo:GSE34824" id="intref0255">GSE34824</ext-link>
, <ext-link ext-link-type="uri" xlink:href="ncbi-geo:GSE36245" id="intref0260">GSE36245</ext-link>
, <ext-link ext-link-type="uri" xlink:href="ncbi-geo:GSE36278" id="intref0265">GSE36278</ext-link>
<ext-link ext-link-type="uri" xlink:href="ncbi-geo:GSE50022" id="intref0270">GSE50022</ext-link>
, <ext-link ext-link-type="uri" xlink:href="ncbi-geo:GSE50021" id="intref0275">GSE50021</ext-link>
, <ext-link ext-link-type="uri" xlink:href="ncbi-geo:GSE50024" id="intref0280">GSE50024</ext-link>
, <ext-link ext-link-type="uri" xlink:href="ncbi-geo:GSE55712" id="intref0285">GSE55712</ext-link>
; ArrayExpress - <ext-link ext-link-type="uri" xlink:href="array-express:E-TABM-857" id="intref0290">E-TABM-857</ext-link>
, <ext-link ext-link-type="uri" xlink:href="array-express:E-TABM-1107" id="intref0295">E-TABM-1107</ext-link>
. The full cohort included a total of 1254 molecular profiles from 955 samples across 12 platforms, which after quality control and manual annotation to remove duplicates, and supplemented with targeted sequencing of an additional 158 cases, resulted in a total dataset comprised of 1067 individual patients. The full dataset comprises genomic profiles from DNA copy number arrays (Agilent 44K, n=127; Affymetrix 500K, n=100; Affymetrix SNP6.0, n=78; 32k BAC, n=61), Illumina 450k methylation arrays (n=441), whole exome (n=254), genome (n=125), targeted (n=212) and RNA sequencing (n=82), as well as gene expression from Affymetrix U133Plus2 (n=102) and Agilent WG2.5 (n=67) platforms.</p>
</sec>
<sec id="sec5.5.2"><title>DNA Copy Number</title>
<p>DNA copy number data was obtained as array CGH (Agilent 44k and 32K BAC), SNP arrays (Affymetrix 500k and SNP6.0), 450k methylation arrays (Illumina) and/or sequencing data (whole genome and exome). Two color aCGH data was read and normalized using the R packages limma and marray. Log intensity data from Affymetrix SNP arrays was derived using the aroma.affymetrix and aroma.cn package. Combined log<sub>2</sub>
intensity data from Illumina 450K methylation arrays was processed using the R packages minfi and conumee. For sequenced samples, coverage of aligned reads was binned into known genes and exons with BEDTools and log<sub>2</sub>
ratios of median coverage in tumor and normal sequences were processed with in-house scripts. To combine copy number platforms, median log<sub>2</sub>
ratios were recovered within all known genes and exons and normalized such that the median displacement of X in male:female comparisons was rescaled to an average of -1. Exon-level median log ratios and smoothed values were then combined across platforms and thresholded to call gains and losses above and below log<sub>2</sub>
ratios of ±0.3 with a contig of ∼1MB and amplifications and deletions above and below a threshold of ±1.5 with a minimum of 3 contiguous exons.</p>
<p>CBS binary segmentation from the DNAcopy package was applied to each dataset to provide smoothed log<sub>2</sub>
ratios. Genes within common CNVs in normal individuals were excluded from further analysis with reference to the CNV map of the human genome. DNA copy number data was clustered based upon categorical states (deep deletion, loss, no change, gain and amplification) based upon the Euclidean distance method with a Ward algorithm. Gains and losses in chromosomal arms were called based upon contiguous regions covering more than one third of the exonic regions within each arm. For regions of focal copy number change cases carrying copy number alterations were ranked according to the length of the largest CNA in each case and are plotted as heatmaps aligned to precise genomic coordinates alongside genomic tracks based upon hg19 made with the R package gviz. Minimal regions of copy number alteration were assigned based on the frequency of categorical states within each region. Focal amplifications and deletions were identified in CBS segmented data using the GISTIC algorithm in MATLAB on the exon-level data, with thresholds for gain and loss of 0.3 and gene-level filters to remove regions of common copy number variation in normal individuals based on the CNV map of the human genome.</p>
</sec>
<sec id="sec5.5.3"><title>DNA Methylation</title>
<p>Methylation data from the Illumina Infinium HumanMethylation450 BeadChip was preprocessed using the minfi package in R. DNA copy number was recovered from combined intensities using the conumee package with reference to methylation profiles from normal individuals provided in the CopyNumber450kData package. We have used the Heidelberg brain tumor classifier (<ext-link ext-link-type="uri" xlink:href="http://molecularneuropathology.org" id="intref0300">molecularneuropathology.org</ext-link>
) to assign subtype scores for each tumor compared to 91 different brain tumor entities using a training set built from more than 2000 tumors implemented in the MNP R package. Simplified methylation subgroup assignments were then made to incorporate cases carrying G34R/V or K27M mutations in H3 histones, IDH1 mutation at R132, low grade glioma-like profiles (predominantly diffuse infantile ganglioglioma and pilocytic astrocytoma) and those similar to pleomorphic xanthoastrocytoma (PXA). Wild-type HGG encompassed many other methylation subgroups and were simply assigned by exclusion with the groups above. Clustering of beta values from methylation arrays was performed using the 10K probeset from the Heidelberg classifier based upon Euclidean distance with a ward algorithm. Methylation heatmaps show only the most variable probes of the classifier between simplified methylation subgroups. Overall methylation was calculated as the mean of the 10K classifier probeset for each subgroup and MGMT promoter methylation was calculated based upon the MGMT-SPT27 model implemented in the MNP package. t- stochastic neighbor embedding (tSNE) was used to project the methylation clustering in three dimensions using the Rtsne package. A Pearson correlation matrix of the 10K probeset was subjected to tSNE using a theta value of zero over 10,000 iterations as previously described and plotted using the rgl package.</p>
</sec>
<sec id="sec5.5.4"><title>mRNA Expression</title>
<p>Gene expression data was obtained from Agilent WG2.5, Affymetrix U133Plus2.0 or RNA sequencing platforms. Gene expression was processed from two color Agilent microarrays using the R packages marray and limma and from single channel Affymetrix arrays using the affy package. Differential expression was assigned for microarray data using the limma package based upon a false discovery rate of 5%. RNASeq was aligned with Bowtie2 and TopHat and summarized as gene level fragments per kilobase per million reads sequenced using BEDTools and cufflinks/cuffnorm. Following rlog transformation and normalization, differential expression was assigned with DESeq.2. Known Ensembl genes were further filtered to remove low abundance genes in all three datasets whose maximal expression was within the lowest 20% of all expression values based upon probe intensities or read depth. Replicate probes/features for each gene were removed by selecting those with the greatest median absolute deviation (MAD) in each dataset. Following centering within each dataset, log-transformed expression measures were combined and further normalized using pairwise loess normalization. Gene Set Enrichment Analysis was performed using the GSEA java application based upon pairwise comparisons of the major subgroups in the merged dataset. Heatmaps of gene expression across chromosomal arms were made using centered expression values rescaled across each chromosomal arm based upon the median absolute deviation of each probe. Differential expression analysis of <italic>TOP3A</italic>
and <italic>FBXW7</italic>
was based on a Mann-Whitney U test of centred expression values between cases with and without losses and amplifications respectively in each case.</p>
</sec>
<sec id="sec5.5.5"><title>Sequence Analysis</title>
<p>Sequencing data was available as whole genome and/or whole exome (predominantly using Agilent’s SureSelect whole exome capture sets v4 and v5) Short read sequences from whole exome or whole genome sequencing were aligned to the hg19 assembly of the human genome using bwa. Following duplicate removal with Picard tools variants were called using the Genome Analysis toolkit according to standard Best Practices (Broad) including local re-alignment around Indels, downsampling and variant calling with the Unified Genotyper. Variants were annotated with the variant Effect predictor v74 from Ensembl tools and ANNOVAR to include annotations for variant allele frequency in 1000 genomes dbSNP v132 and the ExAc database as well as functional annotation tools SIFT and Polyphen). Depth of coverage varied from 16-295x (median 88x), with the greatest variation unsurprisingly in the exome data (whole genome range 50-150x, median=85x). Somatic variants were identified in regions covered by at least 10 reads in normal and tumor sequences carrying at least 3 variant reads in the tumor and less than 2 in normal sequences. Hotspot <italic>TERT</italic>
promoter mutations C228T and C250T were incidentally captured by the various exome platforms as they are located only 114 and 146 bp upstream of the translation start site, and were called even if only covered by a few reads. Mutation signatures were ascertained by grouping somatic substitutions on the basis of their 3′ and 5′ bases into 96 possible trinucleotide categories.</p>
</sec>
<sec id="sec5.5.6"><title>Candidate Fusion Gene Nomination</title>
<p>Structural variants were called from whole genome data using Breakdancer (<ext-link ext-link-type="uri" xlink:href="http://breakdancer.sourceforge.net" id="intref0305">breakdancer.sourceforge.net</ext-link>
) filtered to remove commonly multi-mapped regions to identify somatic breakpoints separated by a minimum of 10 kbp involving at least one Ensembl gene. Fusion transcripts were detected from RNAseq data using chimerascan version 0.4.5a filtered to remove common false positives. To minimize unverified false positives, reporting of nominated fusions was restricted to genes within the core functional pathways and processes identified through integrated DNA copy number and somatic variant calling.</p>
</sec>
<sec id="sec5.5.7"><title>Inferred Tumor Purity</title>
<p>We used determined the somatic allele-specific copy number profiles using read depth from whole genome / exome sequencing, and used ASCAT (rick.ac.uk/peter-van-loo/software/ASCAT) to provide for an estimate of the non-neoplastic cell contamination of the sample as well as the overall ploidy of the tumor. Values ranged from 36-100%, with a median of 83%.</p>
</sec>
<sec id="sec5.5.8"><title>Integrated Analysis of Driver Events</title>
<p>Somatic non-synonymous coding mutations were filtered to remove common passenger mutations, polymorphisms and false positives in exome sequencing. Data were integrated with focal DNA copy number calls by GISTIC to provide gene-level binary alteration calls which were further selected for putative drive status on the basis of functional annotation. Oncoprint representations of integrated mutations, gene-level copy number alterations and fusion events were made using the online tool available at cBioportal (<ext-link ext-link-type="uri" xlink:href="http://cbioportal.org" id="intref0310">cbioportal.org</ext-link>
). For the most commonly mutated genes mutations were mapped to the canonical transcript and plotted according to their predicted protein position using the Protein Painter (<ext-link ext-link-type="uri" xlink:href="http://pecan.stjude.org" id="intref0315">pecan.stjude.org</ext-link>
). Integrated views of copy number alterations, structural variants and somatic mutations were made using CIRCOS (circos.ca) and rearrangements within <italic>TOP3</italic>
A amplified regions in whole genome sequenced cases were identified using Breakdancer and aligned with copy number breakpoints in R.</p>
</sec>
<sec id="sec5.5.9"><title>Pathway Analysis</title>
<p>Pathway assignments were made for all genes carrying copy number alterations, structural variations or somatic mutations based on pathways in the MSigDB molecular signatures databases (Broad) as well as Gene Ontologies for Biological Processes and Molecular Functions (Gene Ontology consortium) and canonical pathways from KEGG, NetPath and Reactome. Genes within known CNVs and common false positives in exomic sequencing were excluded with reference to large scale genome profiling studies (CNVmap, ExAc, BCBio) Pathway analysis of genes carrying mutations, gene fusions and copy number aberrations was based on the pathways defined by these combined databases and subjected to enrichment analysis using the EnrichmentMap module within CytoScape.</p>
</sec>
<sec id="sec5.5.10"><title>Statistical Analysis</title>
<p>Statistical analysis was carried out using R 3.3.1 (<ext-link ext-link-type="uri" xlink:href="http://www.r-project.org" id="intref0320">www.r-project.org</ext-link>
). Categorical comparisons of counts were carried out using Fishers exact test, comparisons between groups of continuous variables employed Student’s t-test, Wilcoxon signed –rank test, ANOVA or Mann-Whitney U test. Differences in survival were analysed by the Kaplan-Meier method and significance determined by the log-rank test. All tests were two-sided and a p value of less than 0.05 was considered significant. Multiple testing was accounted for using false discovery rate q values or the Bonferroni adjustment.</p>
</sec>
</sec>
<sec id="sec5.6"><title>Data and Software Availability</title>
<p>All newly generated data have been deposited in the European Genome-phenome Archive (<ext-link ext-link-type="uri" xlink:href="http://www.ebi.ac.uk/ega" id="intref0325">www.ebi.ac.uk/ega</ext-link>
) with accession number EGAS00001002314 (sequencing) or ArrayExpress (<ext-link ext-link-type="uri" xlink:href="http://www.ebi.ac.uk/arrayexpress/" id="intref0330">www.ebi.ac.uk/arrayexpress/</ext-link>
) with accession number <ext-link ext-link-type="uri" xlink:href="array-express:E-MTAB-5528" id="intref0335">E-MTAB-5528</ext-link>
(450k methylation).</p>
</sec>
<sec id="sec5.7"><title>Additional Resources</title>
<p>Processed copy number profiles are hosted as a disease-specific project within the Progenetix framework for annotated genomic analyses (<ext-link ext-link-type="uri" xlink:href="http://dipg.progenetix.org" id="intref0340">dipg.progenetix.org</ext-link>
) (<xref rid="bib9" ref-type="bibr">Cai et al., 2014</xref>
), and represented in the arrayMap resource (<ext-link ext-link-type="uri" xlink:href="http://arraymap.org" id="intref0345">arraymap.org</ext-link>
) (<xref rid="bib8" ref-type="bibr">Cai et al., 2012</xref>
). Curated gene-level copy number and mutation data are provided as part of the pediatric-specific implementation of the cBioPortal genomic data visualisation portal (<ext-link ext-link-type="uri" xlink:href="http://pedcbioportal.org" id="intref0350">pedcbioportal.org</ext-link>
). Newly-generated raw data files are housed alongside published datasets made available to the Cavatica NIH-integrated cloud platform (<ext-link ext-link-type="uri" xlink:href="http://www.cavatica.org" id="intref0355">www.cavatica.org</ext-link>
).</p>
</sec>
</sec>
<sec id="sec6"><title>Author Contributions</title>
<p>A.M., M.F., A.O.v.B., M.B., and C.J. conceived the study. A.M. and C.J. analyzed data and wrote the manuscript. A.B., D.C., E.I.D., J.F.S., K.T., L.B., M.V., M.N., S.T., and V.M. performed molecular analysis of unpublished samples. M.C., S.P., L.R.B., S.A.-S., A.N.K., D.M.K., K.M., K.-K.N., M.S., and C.K. carried out histopathological assessment of cases. M.M., J.G., C.H., N.J., S.J.B., S.M.P., and D.T.W.J. provided data. L.M., S.Z., S.V., H.C.M., A.J.M., C.C., N.E.-W., J.P., J.S., R.M.R., A.S.M., L.S., S.T., D.H.-B.B., A.M.C., C.d.T., O.C., J.M., and M.M. provided samples and clinical annotation. M.B., P.R., A.J.W., H.J.H., S.G., and A.R. constructed analytical and visualization tools and databases. All authors approved the manuscript.</p>
</sec>
</body>
<back><ref-list id="cebib0010"><title>References</title>
<ref id="bib1"><element-citation publication-type="journal" id="sref1"><person-group person-group-type="author"><name><surname>Baker</surname>
<given-names>S.J.</given-names>
</name>
<name><surname>Ellison</surname>
<given-names>D.W.</given-names>
</name>
<name><surname>Gutmann</surname>
<given-names>D.H.</given-names>
</name>
</person-group>
<article-title>Pediatric gliomas as neurodevelopmental disorders</article-title>
<source>Glia</source>
<volume>64</volume>
<year>2015</year>
<fpage>879</fpage>
<lpage>895</lpage>
<pub-id pub-id-type="pmid">26638183</pub-id>
</element-citation>
</ref>
<ref id="bib2"><element-citation publication-type="journal" id="sref2"><person-group person-group-type="author"><name><surname>Barrow</surname>
<given-names>J.</given-names>
</name>
<name><surname>Adamowicz-Brice</surname>
<given-names>M.</given-names>
</name>
<name><surname>Cartmill</surname>
<given-names>M.</given-names>
</name>
<name><surname>MacArthur</surname>
<given-names>D.</given-names>
</name>
<name><surname>Lowe</surname>
<given-names>J.</given-names>
</name>
<name><surname>Robson</surname>
<given-names>K.</given-names>
</name>
<name><surname>Brundler</surname>
<given-names>M.A.</given-names>
</name>
<name><surname>Walker</surname>
<given-names>D.A.</given-names>
</name>
<name><surname>Coyle</surname>
<given-names>B.</given-names>
</name>
<name><surname>Grundy</surname>
<given-names>R.</given-names>
</name>
</person-group>
<article-title>Homozygous loss of ADAM3A revealed by genome-wide analysis of pediatric high-grade glioma and diffuse intrinsic pontine gliomas</article-title>
<source>Neuro Oncol.</source>
<volume>13</volume>
<year>2011</year>
<fpage>212</fpage>
<lpage>222</lpage>
<pub-id pub-id-type="pmid">21138945</pub-id>
</element-citation>
</ref>
<ref id="bib3"><element-citation publication-type="journal" id="sref3"><person-group person-group-type="author"><name><surname>Bax</surname>
<given-names>D.A.</given-names>
</name>
<name><surname>Mackay</surname>
<given-names>A.</given-names>
</name>
<name><surname>Little</surname>
<given-names>S.E.</given-names>
</name>
<name><surname>Carvalho</surname>
<given-names>D.</given-names>
</name>
<name><surname>Viana-Pereira</surname>
<given-names>M.</given-names>
</name>
<name><surname>Tamber</surname>
<given-names>N.</given-names>
</name>
<name><surname>Grigoriadis</surname>
<given-names>A.E.</given-names>
</name>
<name><surname>Ashworth</surname>
<given-names>A.</given-names>
</name>
<name><surname>Reis</surname>
<given-names>R.M.</given-names>
</name>
<name><surname>Ellison</surname>
<given-names>D.W.</given-names>
</name>
</person-group>
<article-title>A distinct spectrum of copy number aberrations in pediatric high-grade gliomas</article-title>
<source>Clin. Cancer Res.</source>
<volume>16</volume>
<year>2010</year>
<fpage>3368</fpage>
<lpage>3377</lpage>
<pub-id pub-id-type="pmid">20570930</pub-id>
</element-citation>
</ref>
<ref id="bib4"><element-citation publication-type="journal" id="sref4"><person-group person-group-type="author"><name><surname>Bender</surname>
<given-names>S.</given-names>
</name>
<name><surname>Tang</surname>
<given-names>Y.</given-names>
</name>
<name><surname>Lindroth</surname>
<given-names>A.M.</given-names>
</name>
<name><surname>Hovestadt</surname>
<given-names>V.</given-names>
</name>
<name><surname>Jones</surname>
<given-names>D.T.</given-names>
</name>
<name><surname>Kool</surname>
<given-names>M.</given-names>
</name>
<name><surname>Zapatka</surname>
<given-names>M.</given-names>
</name>
<name><surname>Northcott</surname>
<given-names>P.A.</given-names>
</name>
<name><surname>Sturm</surname>
<given-names>D.</given-names>
</name>
<name><surname>Wang</surname>
<given-names>W.</given-names>
</name>
</person-group>
<article-title>Reduced H3K27me3 and DNA hypomethylation are major drivers of gene expression in K27M mutant pediatric high-grade gliomas</article-title>
<source>Cancer Cell</source>
<volume>24</volume>
<year>2013</year>
<fpage>660</fpage>
<lpage>672</lpage>
<pub-id pub-id-type="pmid">24183680</pub-id>
</element-citation>
</ref>
<ref id="bib5"><element-citation publication-type="journal" id="sref5"><person-group person-group-type="author"><name><surname>Bjerke</surname>
<given-names>L.</given-names>
</name>
<name><surname>Mackay</surname>
<given-names>A.</given-names>
</name>
<name><surname>Nandhabalan</surname>
<given-names>M.</given-names>
</name>
<name><surname>Burford</surname>
<given-names>A.</given-names>
</name>
<name><surname>Jury</surname>
<given-names>A.</given-names>
</name>
<name><surname>Popov</surname>
<given-names>S.</given-names>
</name>
<name><surname>Bax</surname>
<given-names>D.A.</given-names>
</name>
<name><surname>Carvalho</surname>
<given-names>D.</given-names>
</name>
<name><surname>Taylor</surname>
<given-names>K.R.</given-names>
</name>
<name><surname>Vinci</surname>
<given-names>M.</given-names>
</name>
</person-group>
<article-title>Histone H3.3. mutations drive pediatric glioblastoma through upregulation of MYCN</article-title>
<source>Cancer Discov.</source>
<volume>3</volume>
<year>2013</year>
<fpage>512</fpage>
<lpage>519</lpage>
<pub-id pub-id-type="pmid">23539269</pub-id>
</element-citation>
</ref>
<ref id="bib6"><element-citation publication-type="journal" id="sref6"><person-group person-group-type="author"><name><surname>Bouffet</surname>
<given-names>E.</given-names>
</name>
<name><surname>Larouche</surname>
<given-names>V.</given-names>
</name>
<name><surname>Campbell</surname>
<given-names>B.B.</given-names>
</name>
<name><surname>Merico</surname>
<given-names>D.</given-names>
</name>
<name><surname>de Borja</surname>
<given-names>R.</given-names>
</name>
<name><surname>Aronson</surname>
<given-names>M.</given-names>
</name>
<name><surname>Durno</surname>
<given-names>C.</given-names>
</name>
<name><surname>Krueger</surname>
<given-names>J.</given-names>
</name>
<name><surname>Cabric</surname>
<given-names>V.</given-names>
</name>
<name><surname>Ramaswamy</surname>
<given-names>V.</given-names>
</name>
</person-group>
<article-title>Immune checkpoint inhibition for hypermutant glioblastoma multiforme resulting from germline biallelic mismatch repair deficiency</article-title>
<source>J. Clin. Oncol.</source>
<volume>34</volume>
<year>2016</year>
<fpage>2206</fpage>
<pub-id pub-id-type="pmid">27001570</pub-id>
</element-citation>
</ref>
<ref id="bib7"><element-citation publication-type="journal" id="sref7"><person-group person-group-type="author"><name><surname>Buczkowicz</surname>
<given-names>P.</given-names>
</name>
<name><surname>Hoeman</surname>
<given-names>C.</given-names>
</name>
<name><surname>Rakopoulos</surname>
<given-names>P.</given-names>
</name>
<name><surname>Pajovic</surname>
<given-names>S.</given-names>
</name>
<name><surname>Letourneau</surname>
<given-names>L.</given-names>
</name>
<name><surname>Dzamba</surname>
<given-names>M.</given-names>
</name>
<name><surname>Morrison</surname>
<given-names>A.</given-names>
</name>
<name><surname>Lewis</surname>
<given-names>P.</given-names>
</name>
<name><surname>Bouffet</surname>
<given-names>E.</given-names>
</name>
<name><surname>Bartels</surname>
<given-names>U.</given-names>
</name>
</person-group>
<article-title>Genomic analysis of diffuse intrinsic pontine gliomas identifies three molecular subgroups and recurrent activating ACVR1 mutations</article-title>
<source>Nat. Genet.</source>
<volume>46</volume>
<year>2014</year>
<fpage>451</fpage>
<lpage>456</lpage>
<pub-id pub-id-type="pmid">24705254</pub-id>
</element-citation>
</ref>
<ref id="bib8"><element-citation publication-type="journal" id="sref8"><person-group person-group-type="author"><name><surname>Cai</surname>
<given-names>H.</given-names>
</name>
<name><surname>Kumar</surname>
<given-names>N.</given-names>
</name>
<name><surname>Baudis</surname>
<given-names>M.</given-names>
</name>
</person-group>
<article-title>arrayMap: a reference resource for genomic copy number imbalances in human malignancies</article-title>
<source>PLoS One</source>
<volume>7</volume>
<year>2012</year>
<fpage>e36944</fpage>
<pub-id pub-id-type="pmid">22629346</pub-id>
</element-citation>
</ref>
<ref id="bib9"><element-citation publication-type="journal" id="sref9"><person-group person-group-type="author"><name><surname>Cai</surname>
<given-names>H.</given-names>
</name>
<name><surname>Kumar</surname>
<given-names>N.</given-names>
</name>
<name><surname>Ai</surname>
<given-names>N.</given-names>
</name>
<name><surname>Gupta</surname>
<given-names>S.</given-names>
</name>
<name><surname>Rath</surname>
<given-names>P.</given-names>
</name>
<name><surname>Baudis</surname>
<given-names>M.</given-names>
</name>
</person-group>
<article-title>Progenetix: 12 years of oncogenomic data curation</article-title>
<source>Nucleic Acids Res.</source>
<volume>42</volume>
<year>2014</year>
<fpage>D1055</fpage>
<lpage>D1062</lpage>
<pub-id pub-id-type="pmid">24225322</pub-id>
</element-citation>
</ref>
<ref id="bib10"><element-citation publication-type="journal" id="sref10"><person-group person-group-type="author"><name><surname>Carvalho</surname>
<given-names>D.</given-names>
</name>
<name><surname>Mackay</surname>
<given-names>A.</given-names>
</name>
<name><surname>Bjerke</surname>
<given-names>L.</given-names>
</name>
<name><surname>Grundy</surname>
<given-names>R.G.</given-names>
</name>
<name><surname>Lopes</surname>
<given-names>C.</given-names>
</name>
<name><surname>Reis</surname>
<given-names>R.M.</given-names>
</name>
<name><surname>Jones</surname>
<given-names>C.</given-names>
</name>
</person-group>
<article-title>The prognostic role of intragenic copy number breakpoints and identification of novel fusion genes in paediatric high grade glioma</article-title>
<source>Acta Neuropathol. Commun.</source>
<volume>2</volume>
<year>2014</year>
<fpage>23</fpage>
<pub-id pub-id-type="pmid">24548782</pub-id>
</element-citation>
</ref>
<ref id="bib11"><element-citation publication-type="journal" id="sref11"><person-group person-group-type="author"><name><surname>Castel</surname>
<given-names>D.</given-names>
</name>
<name><surname>Philippe</surname>
<given-names>C.</given-names>
</name>
<name><surname>Calmon</surname>
<given-names>R.</given-names>
</name>
<name><surname>Le Dret</surname>
<given-names>L.</given-names>
</name>
<name><surname>Truffaux</surname>
<given-names>N.</given-names>
</name>
<name><surname>Boddaert</surname>
<given-names>N.</given-names>
</name>
<name><surname>Pages</surname>
<given-names>M.</given-names>
</name>
<name><surname>Taylor</surname>
<given-names>K.R.</given-names>
</name>
<name><surname>Saulnier</surname>
<given-names>P.</given-names>
</name>
<name><surname>Lacroix</surname>
<given-names>L.</given-names>
</name>
</person-group>
<article-title>Histone H3F3A and HIST1H3B K27M mutations define two subgroups of diffuse intrinsic pontine gliomas with different prognosis and phenotypes</article-title>
<source>Acta Neuropathol.</source>
<volume>130</volume>
<year>2015</year>
<fpage>815</fpage>
<lpage>827</lpage>
<pub-id pub-id-type="pmid">26399631</pub-id>
</element-citation>
</ref>
<ref id="bib12"><element-citation publication-type="journal" id="sref12"><person-group person-group-type="author"><name><surname>Ceccarelli</surname>
<given-names>M.</given-names>
</name>
<name><surname>Barthel</surname>
<given-names>F.P.</given-names>
</name>
<name><surname>Malta</surname>
<given-names>T.M.</given-names>
</name>
<name><surname>Sabedot</surname>
<given-names>T.S.</given-names>
</name>
<name><surname>Salama</surname>
<given-names>S.R.</given-names>
</name>
<name><surname>Murray</surname>
<given-names>B.A.</given-names>
</name>
<name><surname>Morozova</surname>
<given-names>O.</given-names>
</name>
<name><surname>Newton</surname>
<given-names>Y.</given-names>
</name>
<name><surname>Radenbaugh</surname>
<given-names>A.</given-names>
</name>
<name><surname>Pagnotta</surname>
<given-names>S.M.</given-names>
</name>
</person-group>
<article-title>Molecular profiling reveals biologically discrete subsets and pathways of progression in diffuse glioma</article-title>
<source>Cell</source>
<volume>164</volume>
<year>2016</year>
<fpage>550</fpage>
<lpage>563</lpage>
<pub-id pub-id-type="pmid">26824661</pub-id>
</element-citation>
</ref>
<ref id="bib13"><element-citation publication-type="journal" id="sref13"><person-group person-group-type="author"><name><surname>Chan</surname>
<given-names>K.M.</given-names>
</name>
<name><surname>Fang</surname>
<given-names>D.</given-names>
</name>
<name><surname>Gan</surname>
<given-names>H.</given-names>
</name>
<name><surname>Hashizume</surname>
<given-names>R.</given-names>
</name>
<name><surname>Yu</surname>
<given-names>C.</given-names>
</name>
<name><surname>Schroeder</surname>
<given-names>M.</given-names>
</name>
<name><surname>Gupta</surname>
<given-names>N.</given-names>
</name>
<name><surname>Mueller</surname>
<given-names>S.</given-names>
</name>
<name><surname>James</surname>
<given-names>C.D.</given-names>
</name>
<name><surname>Jenkins</surname>
<given-names>R.</given-names>
</name>
</person-group>
<article-title>The histone H3.3K27M mutation in pediatric glioma reprograms H3K27 methylation and gene expression</article-title>
<source>Genes Dev.</source>
<volume>27</volume>
<year>2013</year>
<fpage>985</fpage>
<lpage>990</lpage>
<pub-id pub-id-type="pmid">23603901</pub-id>
</element-citation>
</ref>
<ref id="bib14"><element-citation publication-type="journal" id="sref14"><person-group person-group-type="author"><name><surname>Davis</surname>
<given-names>R.J.</given-names>
</name>
<name><surname>Welcker</surname>
<given-names>M.</given-names>
</name>
<name><surname>Clurman</surname>
<given-names>B.E.</given-names>
</name>
</person-group>
<article-title>Tumor suppression by the Fbw7 ubiquitin ligase: mechanisms and opportunities</article-title>
<source>Cancer Cell</source>
<volume>26</volume>
<year>2014</year>
<fpage>455</fpage>
<lpage>464</lpage>
<pub-id pub-id-type="pmid">25314076</pub-id>
</element-citation>
</ref>
<ref id="bib15"><element-citation publication-type="journal" id="sref15"><person-group person-group-type="author"><name><surname>Fontebasso</surname>
<given-names>A.M.</given-names>
</name>
<name><surname>Schwartzentruber</surname>
<given-names>J.</given-names>
</name>
<name><surname>Khuong-Quang</surname>
<given-names>D.A.</given-names>
</name>
<name><surname>Liu</surname>
<given-names>X.Y.</given-names>
</name>
<name><surname>Sturm</surname>
<given-names>D.</given-names>
</name>
<name><surname>Korshunov</surname>
<given-names>A.</given-names>
</name>
<name><surname>Jones</surname>
<given-names>D.T.</given-names>
</name>
<name><surname>Witt</surname>
<given-names>H.</given-names>
</name>
<name><surname>Kool</surname>
<given-names>M.</given-names>
</name>
<name><surname>Albrecht</surname>
<given-names>S.</given-names>
</name>
</person-group>
<article-title>Mutations in SETD2 and genes affecting histone H3K36 methylation target hemispheric high-grade gliomas</article-title>
<source>Acta Neuropathol.</source>
<volume>125</volume>
<year>2013</year>
<fpage>659</fpage>
<lpage>669</lpage>
<pub-id pub-id-type="pmid">23417712</pub-id>
</element-citation>
</ref>
<ref id="bib16"><element-citation publication-type="journal" id="sref16"><person-group person-group-type="author"><name><surname>Fontebasso</surname>
<given-names>A.M.</given-names>
</name>
<name><surname>Papillon-Cavanagh</surname>
<given-names>S.</given-names>
</name>
<name><surname>Schwartzentruber</surname>
<given-names>J.</given-names>
</name>
<name><surname>Nikbakht</surname>
<given-names>H.</given-names>
</name>
<name><surname>Gerges</surname>
<given-names>N.</given-names>
</name>
<name><surname>Fiset</surname>
<given-names>P.O.</given-names>
</name>
<name><surname>Bechet</surname>
<given-names>D.</given-names>
</name>
<name><surname>Faury</surname>
<given-names>D.</given-names>
</name>
<name><surname>De Jay</surname>
<given-names>N.</given-names>
</name>
<name><surname>Ramkissoon</surname>
<given-names>L.A.</given-names>
</name>
</person-group>
<article-title>Recurrent somatic mutations in ACVR1 in pediatric midline high-grade astrocytoma</article-title>
<source>Nat. Genet.</source>
<volume>46</volume>
<year>2014</year>
<fpage>462</fpage>
<lpage>466</lpage>
<pub-id pub-id-type="pmid">24705250</pub-id>
</element-citation>
</ref>
<ref id="bib17"><element-citation publication-type="journal" id="sref17"><person-group person-group-type="author"><name><surname>Funato</surname>
<given-names>K.</given-names>
</name>
<name><surname>Major</surname>
<given-names>T.</given-names>
</name>
<name><surname>Lewis</surname>
<given-names>P.W.</given-names>
</name>
<name><surname>Allis</surname>
<given-names>C.D.</given-names>
</name>
<name><surname>Tabar</surname>
<given-names>V.</given-names>
</name>
</person-group>
<article-title>Use of human embryonic stem cells to model pediatric gliomas with H3.3K27M histone mutation</article-title>
<source>Science</source>
<volume>346</volume>
<year>2014</year>
<fpage>1529</fpage>
<lpage>1533</lpage>
<pub-id pub-id-type="pmid">25525250</pub-id>
</element-citation>
</ref>
<ref id="bib18"><element-citation publication-type="journal" id="sref18"><person-group person-group-type="author"><name><surname>Grasso</surname>
<given-names>C.S.</given-names>
</name>
<name><surname>Tang</surname>
<given-names>Y.</given-names>
</name>
<name><surname>Truffaux</surname>
<given-names>N.</given-names>
</name>
<name><surname>Berlow</surname>
<given-names>N.E.</given-names>
</name>
<name><surname>Liu</surname>
<given-names>L.</given-names>
</name>
<name><surname>Debily</surname>
<given-names>M.A.</given-names>
</name>
<name><surname>Quist</surname>
<given-names>M.J.</given-names>
</name>
<name><surname>Davis</surname>
<given-names>L.E.</given-names>
</name>
<name><surname>Huang</surname>
<given-names>E.C.</given-names>
</name>
<name><surname>Woo</surname>
<given-names>P.J.</given-names>
</name>
</person-group>
<article-title>Functionally defined therapeutic targets in diffuse intrinsic pontine glioma</article-title>
<source>Nat. Med.</source>
<volume>21</volume>
<year>2015</year>
<fpage>555</fpage>
<lpage>559</lpage>
<pub-id pub-id-type="pmid">25939062</pub-id>
</element-citation>
</ref>
<ref id="bib19"><element-citation publication-type="journal" id="sref19"><person-group person-group-type="author"><name><surname>Hennika</surname>
<given-names>T.</given-names>
</name>
<name><surname>Hu</surname>
<given-names>G.</given-names>
</name>
<name><surname>Olaciregui</surname>
<given-names>N.G.</given-names>
</name>
<name><surname>Barton</surname>
<given-names>K.L.</given-names>
</name>
<name><surname>Ehteda</surname>
<given-names>A.</given-names>
</name>
<name><surname>Chitranjan</surname>
<given-names>A.</given-names>
</name>
<name><surname>Chang</surname>
<given-names>C.</given-names>
</name>
<name><surname>Gifford</surname>
<given-names>A.J.</given-names>
</name>
<name><surname>Tsoli</surname>
<given-names>M.</given-names>
</name>
<name><surname>Ziegler</surname>
<given-names>D.S.</given-names>
</name>
</person-group>
<article-title>Pre-clinical study of panobinostat in xenograft and genetically engineered murine diffuse intrinsic pontine glioma models</article-title>
<source>PLoS One</source>
<volume>12</volume>
<year>2017</year>
<fpage>e0169485</fpage>
<pub-id pub-id-type="pmid">28052119</pub-id>
</element-citation>
</ref>
<ref id="bib20"><element-citation publication-type="journal" id="sref20"><person-group person-group-type="author"><collab>International Cancer Genome Consortium PedBrain Tumor Project</collab>
</person-group>
<article-title>Recurrent MET fusion genes represent a drug target in pediatric glioblastoma</article-title>
<source>Nat. Med.</source>
<volume>22</volume>
<year>2016</year>
<fpage>1314</fpage>
<lpage>1320</lpage>
<pub-id pub-id-type="pmid">27748748</pub-id>
</element-citation>
</ref>
<ref id="bib21"><element-citation publication-type="journal" id="sref21"><person-group person-group-type="author"><name><surname>Jones</surname>
<given-names>C.</given-names>
</name>
<name><surname>Baker</surname>
<given-names>S.J.</given-names>
</name>
</person-group>
<article-title>Unique genetic and epigenetic mechanisms driving paediatric diffuse high-grade glioma</article-title>
<source>Nat. Rev. Cancer</source>
<volume>14</volume>
<year>2014</year>
<fpage>651</fpage>
<lpage>661</lpage>
</element-citation>
</ref>
<ref id="bib22"><element-citation publication-type="journal" id="sref22"><person-group person-group-type="author"><name><surname>Jones</surname>
<given-names>C.</given-names>
</name>
<name><surname>Perryman</surname>
<given-names>L.</given-names>
</name>
<name><surname>Hargrave</surname>
<given-names>D.</given-names>
</name>
</person-group>
<article-title>Paediatric and adult malignant glioma: close relatives or distant cousins?</article-title>
<source>Nat. Rev. Clin. Oncol.</source>
<volume>9</volume>
<year>2012</year>
<fpage>400</fpage>
<lpage>413</lpage>
<pub-id pub-id-type="pmid">22641364</pub-id>
</element-citation>
</ref>
<ref id="bib23"><element-citation publication-type="journal" id="sref23"><person-group person-group-type="author"><name><surname>Jones</surname>
<given-names>C.</given-names>
</name>
<name><surname>Karajannis</surname>
<given-names>M.A.</given-names>
</name>
<name><surname>Jones</surname>
<given-names>D.T.</given-names>
</name>
<name><surname>Kieran</surname>
<given-names>M.W.</given-names>
</name>
<name><surname>Monje</surname>
<given-names>M.</given-names>
</name>
<name><surname>Baker</surname>
<given-names>S.J.</given-names>
</name>
<name><surname>Becher</surname>
<given-names>O.J.</given-names>
</name>
<name><surname>Cho</surname>
<given-names>Y.J.</given-names>
</name>
<name><surname>Gupta</surname>
<given-names>N.</given-names>
</name>
<name><surname>Hawkins</surname>
<given-names>C.</given-names>
</name>
</person-group>
<article-title>Pediatric high-grade glioma: biologically and clinically in need of new thinking</article-title>
<source>Neuro Oncol.</source>
<volume>19</volume>
<year>2016</year>
<fpage>153</fpage>
</element-citation>
</ref>
<ref id="bib24"><element-citation publication-type="journal" id="sref24"><person-group person-group-type="author"><name><surname>Khuong-Quang</surname>
<given-names>D.A.</given-names>
</name>
<name><surname>Buczkowicz</surname>
<given-names>P.</given-names>
</name>
<name><surname>Rakopoulos</surname>
<given-names>P.</given-names>
</name>
<name><surname>Liu</surname>
<given-names>X.Y.</given-names>
</name>
<name><surname>Fontebasso</surname>
<given-names>A.M.</given-names>
</name>
<name><surname>Bouffet</surname>
<given-names>E.</given-names>
</name>
<name><surname>Bartels</surname>
<given-names>U.</given-names>
</name>
<name><surname>Albrecht</surname>
<given-names>S.</given-names>
</name>
<name><surname>Schwartzentruber</surname>
<given-names>J.</given-names>
</name>
<name><surname>Letourneau</surname>
<given-names>L.</given-names>
</name>
</person-group>
<article-title>K27M mutation in histone H3.3 defines clinically and biologically distinct subgroups of pediatric diffuse intrinsic pontine gliomas</article-title>
<source>Acta Neuropathol.</source>
<volume>124</volume>
<year>2012</year>
<fpage>439</fpage>
<lpage>447</lpage>
<pub-id pub-id-type="pmid">22661320</pub-id>
</element-citation>
</ref>
<ref id="bib25"><element-citation publication-type="journal" id="sref25"><person-group person-group-type="author"><name><surname>Korshunov</surname>
<given-names>A.</given-names>
</name>
<name><surname>Ryzhova</surname>
<given-names>M.</given-names>
</name>
<name><surname>Hovestadt</surname>
<given-names>V.</given-names>
</name>
<name><surname>Bender</surname>
<given-names>S.</given-names>
</name>
<name><surname>Sturm</surname>
<given-names>D.</given-names>
</name>
<name><surname>Capper</surname>
<given-names>D.</given-names>
</name>
<name><surname>Meyer</surname>
<given-names>J.</given-names>
</name>
<name><surname>Schrimpf</surname>
<given-names>D.</given-names>
</name>
<name><surname>Kool</surname>
<given-names>M.</given-names>
</name>
<name><surname>Northcott</surname>
<given-names>P.A.</given-names>
</name>
</person-group>
<article-title>Integrated analysis of pediatric glioblastoma reveals a subset of biologically favorable tumors with associated molecular prognostic markers</article-title>
<source>Acta Neuropathol.</source>
<volume>129</volume>
<year>2015</year>
<fpage>669</fpage>
<lpage>678</lpage>
<pub-id pub-id-type="pmid">25752754</pub-id>
</element-citation>
</ref>
<ref id="bib26"><element-citation publication-type="journal" id="sref26"><person-group person-group-type="author"><name><surname>Korshunov</surname>
<given-names>A.</given-names>
</name>
<name><surname>Schrimpf</surname>
<given-names>D.</given-names>
</name>
<name><surname>Ryzhova</surname>
<given-names>M.</given-names>
</name>
<name><surname>Sturm</surname>
<given-names>D.</given-names>
</name>
<name><surname>Chavez</surname>
<given-names>L.</given-names>
</name>
<name><surname>Hovestadt</surname>
<given-names>V.</given-names>
</name>
<name><surname>Sharma</surname>
<given-names>T.</given-names>
</name>
<name><surname>Habel</surname>
<given-names>A.</given-names>
</name>
<name><surname>Burford</surname>
<given-names>A.</given-names>
</name>
<name><surname>Jones</surname>
<given-names>C.</given-names>
</name>
</person-group>
<article-title>H3-/IDH-wild type pediatric glioblastoma is comprised of molecularly and prognostically distinct subtypes with associated oncogenic drivers</article-title>
<source>Acta Neuropathol.</source>
<year>2017</year>
</element-citation>
</ref>
<ref id="bib27"><element-citation publication-type="journal" id="sref27"><person-group person-group-type="author"><name><surname>Kramm</surname>
<given-names>C.M.</given-names>
</name>
<name><surname>Butenhoff</surname>
<given-names>S.</given-names>
</name>
<name><surname>Rausche</surname>
<given-names>U.</given-names>
</name>
<name><surname>Warmuth-Metz</surname>
<given-names>M.</given-names>
</name>
<name><surname>Kortmann</surname>
<given-names>R.D.</given-names>
</name>
<name><surname>Pietsch</surname>
<given-names>T.</given-names>
</name>
<name><surname>Gnekow</surname>
<given-names>A.</given-names>
</name>
<name><surname>Jorch</surname>
<given-names>N.</given-names>
</name>
<name><surname>Janssen</surname>
<given-names>G.</given-names>
</name>
<name><surname>Berthold</surname>
<given-names>F.</given-names>
</name>
</person-group>
<article-title>Thalamic high-grade gliomas in children: a distinct clinical subset?</article-title>
<source>Neuro Oncol.</source>
<volume>13</volume>
<year>2011</year>
<fpage>680</fpage>
<lpage>689</lpage>
<pub-id pub-id-type="pmid">21636712</pub-id>
</element-citation>
</ref>
<ref id="bib28"><element-citation publication-type="journal" id="sref28"><person-group person-group-type="author"><name><surname>Louis</surname>
<given-names>D.N.</given-names>
</name>
<name><surname>Perry</surname>
<given-names>A.</given-names>
</name>
<name><surname>Reifenberger</surname>
<given-names>G.</given-names>
</name>
<name><surname>von Deimling</surname>
<given-names>A.</given-names>
</name>
<name><surname>Figarella-Branger</surname>
<given-names>D.</given-names>
</name>
<name><surname>Cavenee</surname>
<given-names>W.K.</given-names>
</name>
<name><surname>Ohgaki</surname>
<given-names>H.</given-names>
</name>
<name><surname>Wiestler</surname>
<given-names>O.D.</given-names>
</name>
<name><surname>Kleihues</surname>
<given-names>P.</given-names>
</name>
<name><surname>Ellison</surname>
<given-names>D.W.</given-names>
</name>
</person-group>
<article-title>The 2016 World Health Organization classification of tumors of the central nervous system: a summary</article-title>
<source>Acta Neuropathol.</source>
<volume>131</volume>
<year>2016</year>
<fpage>803</fpage>
<lpage>820</lpage>
<pub-id pub-id-type="pmid">27157931</pub-id>
</element-citation>
</ref>
<ref id="bib29"><element-citation publication-type="journal" id="sref29"><person-group person-group-type="author"><name><surname>Nicolaides</surname>
<given-names>T.P.</given-names>
</name>
<name><surname>Li</surname>
<given-names>H.</given-names>
</name>
<name><surname>Solomon</surname>
<given-names>D.A.</given-names>
</name>
<name><surname>Hariono</surname>
<given-names>S.</given-names>
</name>
<name><surname>Hashizume</surname>
<given-names>R.</given-names>
</name>
<name><surname>Barkovich</surname>
<given-names>K.</given-names>
</name>
<name><surname>Baker</surname>
<given-names>S.J.</given-names>
</name>
<name><surname>Paugh</surname>
<given-names>B.S.</given-names>
</name>
<name><surname>Jones</surname>
<given-names>C.</given-names>
</name>
<name><surname>Forshew</surname>
<given-names>T.</given-names>
</name>
</person-group>
<article-title>Targeted therapy for BRAFV600E malignant astrocytoma</article-title>
<source>Clin. Cancer Res.</source>
<volume>17</volume>
<year>2011</year>
<fpage>7595</fpage>
<lpage>7604</lpage>
<pub-id pub-id-type="pmid">22038996</pub-id>
</element-citation>
</ref>
<ref id="bib30"><element-citation publication-type="journal" id="sref30"><person-group person-group-type="author"><name><surname>Northcott</surname>
<given-names>P.A.</given-names>
</name>
<name><surname>Lee</surname>
<given-names>C.</given-names>
</name>
<name><surname>Zichner</surname>
<given-names>T.</given-names>
</name>
<name><surname>Stutz</surname>
<given-names>A.M.</given-names>
</name>
<name><surname>Erkek</surname>
<given-names>S.</given-names>
</name>
<name><surname>Kawauchi</surname>
<given-names>D.</given-names>
</name>
<name><surname>Shih</surname>
<given-names>D.J.</given-names>
</name>
<name><surname>Hovestadt</surname>
<given-names>V.</given-names>
</name>
<name><surname>Zapatka</surname>
<given-names>M.</given-names>
</name>
<name><surname>Sturm</surname>
<given-names>D.</given-names>
</name>
</person-group>
<article-title>Enhancer hijacking activates GFI1 family oncogenes in medulloblastoma</article-title>
<source>Nature</source>
<volume>511</volume>
<year>2014</year>
<fpage>428</fpage>
<lpage>434</lpage>
<pub-id pub-id-type="pmid">25043047</pub-id>
</element-citation>
</ref>
<ref id="bib31"><element-citation publication-type="journal" id="sref31"><person-group person-group-type="author"><name><surname>Ostrom</surname>
<given-names>Q.T.</given-names>
</name>
<name><surname>Gittleman</surname>
<given-names>H.</given-names>
</name>
<name><surname>Fulop</surname>
<given-names>J.</given-names>
</name>
<name><surname>Liu</surname>
<given-names>M.</given-names>
</name>
<name><surname>Blanda</surname>
<given-names>R.</given-names>
</name>
<name><surname>Kromer</surname>
<given-names>C.</given-names>
</name>
<name><surname>Wolinsky</surname>
<given-names>Y.</given-names>
</name>
<name><surname>Kruchko</surname>
<given-names>C.</given-names>
</name>
<name><surname>Barnholtz-Sloan</surname>
<given-names>J.S.</given-names>
</name>
</person-group>
<article-title>CBTRUS statistical report: primary brain and central nervous system tumors diagnosed in the United States in 2008–2012</article-title>
<source>Neuro Oncol.</source>
<volume>17</volume>
<issue>Suppl 4</issue>
<year>2015</year>
<fpage>iv1</fpage>
<lpage>iv62</lpage>
<pub-id pub-id-type="pmid">26511214</pub-id>
</element-citation>
</ref>
<ref id="bib32"><element-citation publication-type="journal" id="sref32"><person-group person-group-type="author"><name><surname>Paugh</surname>
<given-names>B.S.</given-names>
</name>
<name><surname>Qu</surname>
<given-names>C.</given-names>
</name>
<name><surname>Jones</surname>
<given-names>C.</given-names>
</name>
<name><surname>Liu</surname>
<given-names>Z.</given-names>
</name>
<name><surname>Adamowicz-Brice</surname>
<given-names>M.</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>J.</given-names>
</name>
<name><surname>Bax</surname>
<given-names>D.A.</given-names>
</name>
<name><surname>Coyle</surname>
<given-names>B.</given-names>
</name>
<name><surname>Barrow</surname>
<given-names>J.</given-names>
</name>
<name><surname>Hargrave</surname>
<given-names>D.</given-names>
</name>
</person-group>
<article-title>Integrated molecular genetic profiling of pediatric high-grade gliomas reveals key differences with the adult disease</article-title>
<source>J. Clin. Oncol.</source>
<volume>28</volume>
<year>2010</year>
<fpage>3061</fpage>
<lpage>3068</lpage>
<pub-id pub-id-type="pmid">20479398</pub-id>
</element-citation>
</ref>
<ref id="bib33"><element-citation publication-type="journal" id="sref33"><person-group person-group-type="author"><name><surname>Paugh</surname>
<given-names>B.S.</given-names>
</name>
<name><surname>Broniscer</surname>
<given-names>A.</given-names>
</name>
<name><surname>Qu</surname>
<given-names>C.</given-names>
</name>
<name><surname>Miller</surname>
<given-names>C.P.</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>J.</given-names>
</name>
<name><surname>Tatevossian</surname>
<given-names>R.G.</given-names>
</name>
<name><surname>Olson</surname>
<given-names>J.M.</given-names>
</name>
<name><surname>Geyer</surname>
<given-names>J.R.</given-names>
</name>
<name><surname>Chi</surname>
<given-names>S.N.</given-names>
</name>
<name><surname>da Silva</surname>
<given-names>N.S.</given-names>
</name>
</person-group>
<article-title>Genome-wide analyses identify recurrent amplifications of receptor tyrosine kinases and cell-cycle regulatory genes in diffuse intrinsic pontine glioma</article-title>
<source>J. Clin. Oncol.</source>
<volume>29</volume>
<year>2011</year>
<fpage>3999</fpage>
<lpage>4006</lpage>
<pub-id pub-id-type="pmid">21931021</pub-id>
</element-citation>
</ref>
<ref id="bib34"><element-citation publication-type="journal" id="sref34"><person-group person-group-type="author"><name><surname>Paugh</surname>
<given-names>B.S.</given-names>
</name>
<name><surname>Zhu</surname>
<given-names>X.</given-names>
</name>
<name><surname>Qu</surname>
<given-names>C.</given-names>
</name>
<name><surname>Endersby</surname>
<given-names>R.</given-names>
</name>
<name><surname>Diaz</surname>
<given-names>A.K.</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>J.</given-names>
</name>
<name><surname>Bax</surname>
<given-names>D.A.</given-names>
</name>
<name><surname>Carvalho</surname>
<given-names>D.</given-names>
</name>
<name><surname>Reis</surname>
<given-names>R.M.</given-names>
</name>
<name><surname>Onar-Thomas</surname>
<given-names>A.</given-names>
</name>
</person-group>
<article-title>Novel oncogenic PDGFRA mutations in pediatric high-grade gliomas</article-title>
<source>Cancer Res.</source>
<volume>73</volume>
<year>2013</year>
<fpage>6219</fpage>
<lpage>6229</lpage>
<pub-id pub-id-type="pmid">23970477</pub-id>
</element-citation>
</ref>
<ref id="bib35"><element-citation publication-type="journal" id="sref35"><person-group person-group-type="author"><name><surname>Puget</surname>
<given-names>S.</given-names>
</name>
<name><surname>Philippe</surname>
<given-names>C.</given-names>
</name>
<name><surname>Bax</surname>
<given-names>D.A.</given-names>
</name>
<name><surname>Job</surname>
<given-names>B.</given-names>
</name>
<name><surname>Varlet</surname>
<given-names>P.</given-names>
</name>
<name><surname>Junier</surname>
<given-names>M.P.</given-names>
</name>
<name><surname>Andreiuolo</surname>
<given-names>F.</given-names>
</name>
<name><surname>Carvalho</surname>
<given-names>D.</given-names>
</name>
<name><surname>Reis</surname>
<given-names>R.</given-names>
</name>
<name><surname>Guerrini-Rousseau</surname>
<given-names>L.</given-names>
</name>
</person-group>
<article-title>Mesenchymal transition and PDGFRA amplification/mutation are key distinct oncogenic events in pediatric diffuse intrinsic pontine gliomas</article-title>
<source>PLoS One</source>
<volume>7</volume>
<year>2012</year>
<fpage>e30313</fpage>
<pub-id pub-id-type="pmid">22389665</pub-id>
</element-citation>
</ref>
<ref id="bib55"><element-citation publication-type="journal" id="sref55"><person-group person-group-type="author"><name><surname>Qin</surname>
<given-names>E.Y.</given-names>
</name>
<name><surname>Cooper</surname>
<given-names>D.D.</given-names>
</name>
<name><surname>Abbott</surname>
<given-names>K.L.</given-names>
</name>
<name><surname>Lennon</surname>
<given-names>J.</given-names>
</name>
<name><surname>Nagaraja</surname>
<given-names>S.</given-names>
</name>
<name><surname>Mackay</surname>
<given-names>A.</given-names>
</name>
<name><surname>Jones</surname>
<given-names>C.</given-names>
</name>
<name><surname>Vogel</surname>
<given-names>H.</given-names>
</name>
<name><surname>Jackson</surname>
<given-names>P.K.</given-names>
</name>
<name><surname>Monje</surname>
<given-names>M.</given-names>
</name>
</person-group>
<article-title>Neural Precursor-Derived Pleiotrophin Mediates Subventricular Zone Invasion by Glioma</article-title>
<source>Cell</source>
<volume>170</volume>
<issue>5</issue>
<year>2017</year>
<fpage>845</fpage>
<lpage>859</lpage>
<pub-id pub-id-type="pmid">28823557</pub-id>
</element-citation>
</ref>
<ref id="bib36"><element-citation publication-type="journal" id="sref36"><person-group person-group-type="author"><name><surname>Richards</surname>
<given-names>M.W.</given-names>
</name>
<name><surname>Burgess</surname>
<given-names>S.G.</given-names>
</name>
<name><surname>Poon</surname>
<given-names>E.</given-names>
</name>
<name><surname>Carstensen</surname>
<given-names>A.</given-names>
</name>
<name><surname>Eilers</surname>
<given-names>M.</given-names>
</name>
<name><surname>Chesler</surname>
<given-names>L.</given-names>
</name>
<name><surname>Bayliss</surname>
<given-names>R.</given-names>
</name>
</person-group>
<article-title>Structural basis of N-Myc binding by Aurora-A and its destabilization by kinase inhibitors</article-title>
<source>Proc. Natl. Acad. Sci. USA</source>
<volume>113</volume>
<year>2016</year>
<fpage>13726</fpage>
<lpage>13731</lpage>
<pub-id pub-id-type="pmid">27837025</pub-id>
</element-citation>
</ref>
<ref id="bib37"><element-citation publication-type="journal" id="sref37"><person-group person-group-type="author"><name><surname>Schiffman</surname>
<given-names>J.D.</given-names>
</name>
<name><surname>Hodgson</surname>
<given-names>J.G.</given-names>
</name>
<name><surname>VandenBerg</surname>
<given-names>S.R.</given-names>
</name>
<name><surname>Flaherty</surname>
<given-names>P.</given-names>
</name>
<name><surname>Polley</surname>
<given-names>M.Y.</given-names>
</name>
<name><surname>Yu</surname>
<given-names>M.</given-names>
</name>
<name><surname>Fisher</surname>
<given-names>P.G.</given-names>
</name>
<name><surname>Rowitch</surname>
<given-names>D.H.</given-names>
</name>
<name><surname>Ford</surname>
<given-names>J.M.</given-names>
</name>
<name><surname>Berger</surname>
<given-names>M.S.</given-names>
</name>
</person-group>
<article-title>Oncogenic BRAF mutation with CDKN2A inactivation is characteristic of a subset of pediatric malignant astrocytomas</article-title>
<source>Cancer Res.</source>
<volume>70</volume>
<year>2010</year>
<fpage>512</fpage>
<lpage>519</lpage>
<pub-id pub-id-type="pmid">20068183</pub-id>
</element-citation>
</ref>
<ref id="bib38"><element-citation publication-type="journal" id="sref38"><person-group person-group-type="author"><name><surname>Schwartzentruber</surname>
<given-names>J.</given-names>
</name>
<name><surname>Korshunov</surname>
<given-names>A.</given-names>
</name>
<name><surname>Liu</surname>
<given-names>X.Y.</given-names>
</name>
<name><surname>Jones</surname>
<given-names>D.T.</given-names>
</name>
<name><surname>Pfaff</surname>
<given-names>E.</given-names>
</name>
<name><surname>Jacob</surname>
<given-names>K.</given-names>
</name>
<name><surname>Sturm</surname>
<given-names>D.</given-names>
</name>
<name><surname>Fontebasso</surname>
<given-names>A.M.</given-names>
</name>
<name><surname>Quang</surname>
<given-names>D.A.</given-names>
</name>
<name><surname>Tonjes</surname>
<given-names>M.</given-names>
</name>
</person-group>
<article-title>Driver mutations in histone H3.3 and chromatin remodelling genes in paediatric glioblastoma</article-title>
<source>Nature</source>
<volume>482</volume>
<year>2012</year>
<fpage>226</fpage>
<lpage>231</lpage>
<pub-id pub-id-type="pmid">22286061</pub-id>
</element-citation>
</ref>
<ref id="bib39"><element-citation publication-type="journal" id="sref39"><person-group person-group-type="author"><name><surname>Shlien</surname>
<given-names>A.</given-names>
</name>
<name><surname>Campbell</surname>
<given-names>B.B.</given-names>
</name>
<name><surname>de Borja</surname>
<given-names>R.</given-names>
</name>
<name><surname>Alexandrov</surname>
<given-names>L.B.</given-names>
</name>
<name><surname>Merico</surname>
<given-names>D.</given-names>
</name>
<name><surname>Wedge</surname>
<given-names>D.</given-names>
</name>
<name><surname>Van Loo</surname>
<given-names>P.</given-names>
</name>
<name><surname>Tarpey</surname>
<given-names>P.S.</given-names>
</name>
<name><surname>Coupland</surname>
<given-names>P.</given-names>
</name>
<name><surname>Behjati</surname>
<given-names>S.</given-names>
</name>
</person-group>
<article-title>Combined hereditary and somatic mutations of replication error repair genes result in rapid onset of ultra-hypermutated cancers</article-title>
<source>Nat. Genet.</source>
<volume>47</volume>
<year>2015</year>
<fpage>257</fpage>
<lpage>262</lpage>
<pub-id pub-id-type="pmid">25642631</pub-id>
</element-citation>
</ref>
<ref id="bib40"><element-citation publication-type="journal" id="sref40"><person-group person-group-type="author"><name><surname>Sturm</surname>
<given-names>D.</given-names>
</name>
<name><surname>Witt</surname>
<given-names>H.</given-names>
</name>
<name><surname>Hovestadt</surname>
<given-names>V.</given-names>
</name>
<name><surname>Khuong-Quang</surname>
<given-names>D.A.</given-names>
</name>
<name><surname>Jones</surname>
<given-names>D.T.</given-names>
</name>
<name><surname>Konermann</surname>
<given-names>C.</given-names>
</name>
<name><surname>Pfaff</surname>
<given-names>E.</given-names>
</name>
<name><surname>Tonjes</surname>
<given-names>M.</given-names>
</name>
<name><surname>Sill</surname>
<given-names>M.</given-names>
</name>
<name><surname>Bender</surname>
<given-names>S.</given-names>
</name>
</person-group>
<article-title>Hotspot mutations in H3F3A and IDH1 define distinct epigenetic and biological subgroups of glioblastoma</article-title>
<source>Cancer Cell</source>
<volume>22</volume>
<year>2012</year>
<fpage>425</fpage>
<lpage>437</lpage>
<pub-id pub-id-type="pmid">23079654</pub-id>
</element-citation>
</ref>
<ref id="bib41"><element-citation publication-type="journal" id="sref41"><person-group person-group-type="author"><name><surname>Sturm</surname>
<given-names>D.</given-names>
</name>
<name><surname>Bender</surname>
<given-names>S.</given-names>
</name>
<name><surname>Jones</surname>
<given-names>D.T.</given-names>
</name>
<name><surname>Lichter</surname>
<given-names>P.</given-names>
</name>
<name><surname>Grill</surname>
<given-names>J.</given-names>
</name>
<name><surname>Becher</surname>
<given-names>O.</given-names>
</name>
<name><surname>Hawkins</surname>
<given-names>C.</given-names>
</name>
<name><surname>Majewski</surname>
<given-names>J.</given-names>
</name>
<name><surname>Jones</surname>
<given-names>C.</given-names>
</name>
<name><surname>Costello</surname>
<given-names>J.F.</given-names>
</name>
</person-group>
<article-title>Paediatric and adult glioblastoma: multiform (epi)genomic culprits emerge</article-title>
<source>Nat. Rev. Cancer</source>
<volume>14</volume>
<year>2014</year>
<fpage>92</fpage>
<lpage>107</lpage>
<pub-id pub-id-type="pmid">24457416</pub-id>
</element-citation>
</ref>
<ref id="bib42"><element-citation publication-type="journal" id="sref42"><person-group person-group-type="author"><name><surname>Taylor</surname>
<given-names>K.R.</given-names>
</name>
<name><surname>Mackay</surname>
<given-names>A.</given-names>
</name>
<name><surname>Truffaux</surname>
<given-names>N.</given-names>
</name>
<name><surname>Butterfield</surname>
<given-names>Y.S.</given-names>
</name>
<name><surname>Morozova</surname>
<given-names>O.</given-names>
</name>
<name><surname>Philippe</surname>
<given-names>C.</given-names>
</name>
<name><surname>Castel</surname>
<given-names>D.</given-names>
</name>
<name><surname>Grasso</surname>
<given-names>C.S.</given-names>
</name>
<name><surname>Vinci</surname>
<given-names>M.</given-names>
</name>
<name><surname>Carvalho</surname>
<given-names>D.</given-names>
</name>
</person-group>
<article-title>Recurrent activating ACVR1 mutations in diffuse intrinsic pontine glioma</article-title>
<source>Nat. Genet.</source>
<volume>46</volume>
<year>2014</year>
<fpage>457</fpage>
<lpage>461</lpage>
<pub-id pub-id-type="pmid">24705252</pub-id>
</element-citation>
</ref>
<ref id="bib43"><element-citation publication-type="journal" id="sref43"><person-group person-group-type="author"><name><surname>Taylor</surname>
<given-names>K.R.</given-names>
</name>
<name><surname>Vinci</surname>
<given-names>M.</given-names>
</name>
<name><surname>Bullock</surname>
<given-names>A.N.</given-names>
</name>
<name><surname>Jones</surname>
<given-names>C.</given-names>
</name>
</person-group>
<article-title>ACVR1 mutations in DIPG: lessons learned from FOP</article-title>
<source>Cancer Res.</source>
<volume>74</volume>
<year>2014</year>
<fpage>4565</fpage>
<lpage>4570</lpage>
<pub-id pub-id-type="pmid">25136070</pub-id>
</element-citation>
</ref>
<ref id="bib44"><element-citation publication-type="journal" id="sref44"><person-group person-group-type="author"><name><surname>Temime-Smaali</surname>
<given-names>N.</given-names>
</name>
<name><surname>Guittat</surname>
<given-names>L.</given-names>
</name>
<name><surname>Wenner</surname>
<given-names>T.</given-names>
</name>
<name><surname>Bayart</surname>
<given-names>E.</given-names>
</name>
<name><surname>Douarre</surname>
<given-names>C.</given-names>
</name>
<name><surname>Gomez</surname>
<given-names>D.</given-names>
</name>
<name><surname>Giraud-Panis</surname>
<given-names>M.J.</given-names>
</name>
<name><surname>Londono-Vallejo</surname>
<given-names>A.</given-names>
</name>
<name><surname>Gilson</surname>
<given-names>E.</given-names>
</name>
<name><surname>Amor-Gueret</surname>
<given-names>M.</given-names>
</name>
</person-group>
<article-title>Topoisomerase IIIalpha is required for normal proliferation and telomere stability in alternative lengthening of telomeres</article-title>
<source>EMBO J.</source>
<volume>27</volume>
<year>2008</year>
<fpage>1513</fpage>
<lpage>1524</lpage>
<pub-id pub-id-type="pmid">18418389</pub-id>
</element-citation>
</ref>
<ref id="bib45"><element-citation publication-type="journal" id="sref45"><person-group person-group-type="author"><name><surname>Temime-Smaali</surname>
<given-names>N.</given-names>
</name>
<name><surname>Guittat</surname>
<given-names>L.</given-names>
</name>
<name><surname>Sidibe</surname>
<given-names>A.</given-names>
</name>
<name><surname>Shin-ya</surname>
<given-names>K.</given-names>
</name>
<name><surname>Trentesaux</surname>
<given-names>C.</given-names>
</name>
<name><surname>Riou</surname>
<given-names>J.F.</given-names>
</name>
</person-group>
<article-title>The G-quadruplex ligand telomestatin impairs binding of topoisomerase IIIalpha to G-quadruplex-forming oligonucleotides and uncaps telomeres in ALT cells</article-title>
<source>PLoS One</source>
<volume>4</volume>
<year>2009</year>
<fpage>e6919</fpage>
<pub-id pub-id-type="pmid">19742304</pub-id>
</element-citation>
</ref>
<ref id="bib46"><element-citation publication-type="journal" id="sref46"><person-group person-group-type="author"><name><surname>Tiberi</surname>
<given-names>L.</given-names>
</name>
<name><surname>Bonnefont</surname>
<given-names>J.</given-names>
</name>
<name><surname>van den Ameele</surname>
<given-names>J.</given-names>
</name>
<name><surname>Le Bon</surname>
<given-names>S.D.</given-names>
</name>
<name><surname>Herpoel</surname>
<given-names>A.</given-names>
</name>
<name><surname>Bilheu</surname>
<given-names>A.</given-names>
</name>
<name><surname>Baron</surname>
<given-names>B.W.</given-names>
</name>
<name><surname>Vanderhaeghen</surname>
<given-names>P.</given-names>
</name>
</person-group>
<article-title>A BCL6/BCOR/SIRT1 complex triggers neurogenesis and suppresses medulloblastoma by repressing Sonic Hedgehog signaling</article-title>
<source>Cancer Cell</source>
<volume>26</volume>
<year>2014</year>
<fpage>797</fpage>
<lpage>812</lpage>
<pub-id pub-id-type="pmid">25490446</pub-id>
</element-citation>
</ref>
<ref id="bib47"><element-citation publication-type="journal" id="sref47"><person-group person-group-type="author"><name><surname>Venkatesh</surname>
<given-names>H.S.</given-names>
</name>
<name><surname>Johung</surname>
<given-names>T.B.</given-names>
</name>
<name><surname>Caretti</surname>
<given-names>V.</given-names>
</name>
<name><surname>Noll</surname>
<given-names>A.</given-names>
</name>
<name><surname>Tang</surname>
<given-names>Y.</given-names>
</name>
<name><surname>Nagaraja</surname>
<given-names>S.</given-names>
</name>
<name><surname>Gibson</surname>
<given-names>E.M.</given-names>
</name>
<name><surname>Mount</surname>
<given-names>C.W.</given-names>
</name>
<name><surname>Polepalli</surname>
<given-names>J.</given-names>
</name>
<name><surname>Mitra</surname>
<given-names>S.S.</given-names>
</name>
</person-group>
<article-title>Neuronal activity promotes glioma growth through Neuroligin-3 secretion</article-title>
<source>Cell</source>
<volume>161</volume>
<year>2015</year>
<fpage>803</fpage>
<lpage>816</lpage>
<pub-id pub-id-type="pmid">25913192</pub-id>
</element-citation>
</ref>
<ref id="bib48"><element-citation publication-type="journal" id="sref48"><person-group person-group-type="author"><name><surname>Welcker</surname>
<given-names>M.</given-names>
</name>
<name><surname>Orian</surname>
<given-names>A.</given-names>
</name>
<name><surname>Jin</surname>
<given-names>J.</given-names>
</name>
<name><surname>Grim</surname>
<given-names>J.E.</given-names>
</name>
<name><surname>Harper</surname>
<given-names>J.W.</given-names>
</name>
<name><surname>Eisenman</surname>
<given-names>R.N.</given-names>
</name>
<name><surname>Clurman</surname>
<given-names>B.E.</given-names>
</name>
</person-group>
<article-title>The Fbw7 tumor suppressor regulates glycogen synthase kinase 3 phosphorylation-dependent c-Myc protein degradation</article-title>
<source>Proc. Natl. Acad. Sci. USA</source>
<volume>101</volume>
<year>2004</year>
<fpage>9085</fpage>
<lpage>9090</lpage>
<pub-id pub-id-type="pmid">15150404</pub-id>
</element-citation>
</ref>
<ref id="bib49"><element-citation publication-type="journal" id="sref49"><person-group person-group-type="author"><name><surname>Wu</surname>
<given-names>L.</given-names>
</name>
<name><surname>Davies</surname>
<given-names>S.L.</given-names>
</name>
<name><surname>North</surname>
<given-names>P.S.</given-names>
</name>
<name><surname>Goulaouic</surname>
<given-names>H.</given-names>
</name>
<name><surname>Riou</surname>
<given-names>J.F.</given-names>
</name>
<name><surname>Turley</surname>
<given-names>H.</given-names>
</name>
<name><surname>Gatter</surname>
<given-names>K.C.</given-names>
</name>
<name><surname>Hickson</surname>
<given-names>I.D.</given-names>
</name>
</person-group>
<article-title>The Bloom's syndrome gene product interacts with topoisomerase III</article-title>
<source>J. Biol. Chem.</source>
<volume>275</volume>
<year>2000</year>
<fpage>9636</fpage>
<lpage>9644</lpage>
<pub-id pub-id-type="pmid">10734115</pub-id>
</element-citation>
</ref>
<ref id="bib50"><element-citation publication-type="journal" id="sref50"><person-group person-group-type="author"><name><surname>Wu</surname>
<given-names>G.</given-names>
</name>
<name><surname>Broniscer</surname>
<given-names>A.</given-names>
</name>
<name><surname>McEachron</surname>
<given-names>T.A.</given-names>
</name>
<name><surname>Lu</surname>
<given-names>C.</given-names>
</name>
<name><surname>Paugh</surname>
<given-names>B.S.</given-names>
</name>
<name><surname>Becksfort</surname>
<given-names>J.</given-names>
</name>
<name><surname>Qu</surname>
<given-names>C.</given-names>
</name>
<name><surname>Ding</surname>
<given-names>L.</given-names>
</name>
<name><surname>Huether</surname>
<given-names>R.</given-names>
</name>
<name><surname>Parker</surname>
<given-names>M.</given-names>
</name>
</person-group>
<article-title>Somatic histone H3 alterations in pediatric diffuse intrinsic pontine gliomas and non-brainstem glioblastomas</article-title>
<source>Nat. Genet.</source>
<volume>44</volume>
<year>2012</year>
<fpage>251</fpage>
<lpage>253</lpage>
<pub-id pub-id-type="pmid">22286216</pub-id>
</element-citation>
</ref>
<ref id="bib51"><element-citation publication-type="journal" id="sref51"><person-group person-group-type="author"><name><surname>Wu</surname>
<given-names>G.</given-names>
</name>
<name><surname>Diaz</surname>
<given-names>A.K.</given-names>
</name>
<name><surname>Paugh</surname>
<given-names>B.S.</given-names>
</name>
<name><surname>Rankin</surname>
<given-names>S.L.</given-names>
</name>
<name><surname>Ju</surname>
<given-names>B.</given-names>
</name>
<name><surname>Li</surname>
<given-names>Y.</given-names>
</name>
<name><surname>Zhu</surname>
<given-names>X.</given-names>
</name>
<name><surname>Qu</surname>
<given-names>C.</given-names>
</name>
<name><surname>Chen</surname>
<given-names>X.</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>J.</given-names>
</name>
</person-group>
<article-title>The genomic landscape of diffuse intrinsic pontine glioma and pediatric non-brainstem high-grade glioma</article-title>
<source>Nat. Genet.</source>
<volume>46</volume>
<year>2014</year>
<fpage>444</fpage>
<lpage>450</lpage>
<pub-id pub-id-type="pmid">24705251</pub-id>
</element-citation>
</ref>
<ref id="bib52"><element-citation publication-type="journal" id="sref52"><person-group person-group-type="author"><name><surname>Yada</surname>
<given-names>M.</given-names>
</name>
<name><surname>Hatakeyama</surname>
<given-names>S.</given-names>
</name>
<name><surname>Kamura</surname>
<given-names>T.</given-names>
</name>
<name><surname>Nishiyama</surname>
<given-names>M.</given-names>
</name>
<name><surname>Tsunematsu</surname>
<given-names>R.</given-names>
</name>
<name><surname>Imaki</surname>
<given-names>H.</given-names>
</name>
<name><surname>Ishida</surname>
<given-names>N.</given-names>
</name>
<name><surname>Okumura</surname>
<given-names>F.</given-names>
</name>
<name><surname>Nakayama</surname>
<given-names>K.</given-names>
</name>
<name><surname>Nakayama</surname>
<given-names>K.I.</given-names>
</name>
</person-group>
<article-title>Phosphorylation-dependent degradation of c-Myc is mediated by the F-box protein Fbw7</article-title>
<source>EMBO J.</source>
<volume>23</volume>
<year>2004</year>
<fpage>2116</fpage>
<lpage>2125</lpage>
<pub-id pub-id-type="pmid">15103331</pub-id>
</element-citation>
</ref>
<ref id="bib53"><element-citation publication-type="journal" id="sref53"><person-group person-group-type="author"><name><surname>Yang</surname>
<given-names>J.</given-names>
</name>
<name><surname>Bachrati</surname>
<given-names>C.Z.</given-names>
</name>
<name><surname>Ou</surname>
<given-names>J.</given-names>
</name>
<name><surname>Hickson</surname>
<given-names>I.D.</given-names>
</name>
<name><surname>Brown</surname>
<given-names>G.W.</given-names>
</name>
</person-group>
<article-title>Human topoisomerase IIIalpha is a single-stranded DNA decatenase that is stimulated by BLM and RMI1</article-title>
<source>J. Biol. Chem.</source>
<volume>285</volume>
<year>2010</year>
<fpage>21426</fpage>
<lpage>21436</lpage>
<pub-id pub-id-type="pmid">20445207</pub-id>
</element-citation>
</ref>
<ref id="bib54"><element-citation publication-type="journal" id="sref54"><person-group person-group-type="author"><name><surname>Zarghooni</surname>
<given-names>M.</given-names>
</name>
<name><surname>Bartels</surname>
<given-names>U.</given-names>
</name>
<name><surname>Lee</surname>
<given-names>E.</given-names>
</name>
<name><surname>Buczkowicz</surname>
<given-names>P.</given-names>
</name>
<name><surname>Morrison</surname>
<given-names>A.</given-names>
</name>
<name><surname>Huang</surname>
<given-names>A.</given-names>
</name>
<name><surname>Bouffet</surname>
<given-names>E.</given-names>
</name>
<name><surname>Hawkins</surname>
<given-names>C.</given-names>
</name>
</person-group>
<article-title>Whole-genome profiling of pediatric diffuse intrinsic pontine gliomas highlights platelet-derived growth factor receptor alpha and poly (ADP-ribose) polymerase as potential therapeutic targets</article-title>
<source>J. Clin. Oncol.</source>
<volume>28</volume>
<year>2010</year>
<fpage>1337</fpage>
<lpage>1344</lpage>
<pub-id pub-id-type="pmid">20142589</pub-id>
</element-citation>
</ref>
</ref-list>
<sec id="app2" sec-type="supplementary-material"><title>Supplemental Information</title>
<p><supplementary-material content-type="local-data" id="mmc1"><caption><title>Document S1. Figures S1–S8</title>
</caption>
<media xlink:href="mmc1.pdf"></media>
</supplementary-material>
<supplementary-material content-type="local-data" id="mmc2"><caption><title>Table S1. Clinicopathological and Molecular Subgroups of pHGG/DIPG, Related to Figure 1</title>
</caption>
<media xlink:href="mmc2.xlsx"></media>
</supplementary-material>
<supplementary-material content-type="local-data" id="mmc3"><caption><title>Table S2. Methylation-Based Subclassification of pHGG/DIPG, Related to Figure 2</title>
</caption>
<media xlink:href="mmc3.xlsx"></media>
</supplementary-material>
<supplementary-material content-type="local-data" id="mmc4"><caption><title>Table S3. DNA Copy-Number Aberrations in pHGG/DIPG, Related to Figure 3</title>
</caption>
<media xlink:href="mmc4.xlsx"></media>
</supplementary-material>
<supplementary-material content-type="local-data" id="mmc5"><caption><title>Table S4. Subgroup-Specific Copy-Number Changes in pHGG/DIPG, Related to Figure 4</title>
</caption>
<media xlink:href="mmc5.xlsx"></media>
</supplementary-material>
<supplementary-material content-type="local-data" id="mmc6"><caption><title>Table S5. Novel Alterations Targeting FBXW7 in H3.3G34R/V pHGG and TOP3A in H3.3K27M DIPG, Related to Figure 5</title>
</caption>
<media xlink:href="mmc6.xlsx"></media>
</supplementary-material>
<supplementary-material content-type="local-data" id="mmc7"><caption><title>Table S6. Somatic Mutations in pHGG/DIPG, Related to Figure 6</title>
</caption>
<media xlink:href="mmc7.xlsx"></media>
</supplementary-material>
<supplementary-material content-type="local-data" id="mmc8"><caption><title>Table S7. Integrated Pathway Analysis of pHGG/DIPG, Related to Figure 7</title>
</caption>
<media xlink:href="mmc8.xlsx"></media>
</supplementary-material>
<supplementary-material content-type="local-data" id="mmc9"><caption><title>Table S8. Integrated Analysis of H3/IDH1 Wild-Type pHGG/DIPG, Related to Figure 8</title>
</caption>
<media xlink:href="mmc9.xlsx"></media>
</supplementary-material>
<supplementary-material content-type="local-data" id="mmc10"><caption><title>Document S2. Article plus Supplemental Information</title>
</caption>
<media xlink:href="mmc10.pdf"></media>
</supplementary-material>
</p>
</sec>
<ack id="ack0010"><title>Acknowledgments</title>
<p>This work was supported by <funding-source id="gs1">Cancer Research UK</funding-source>
(grants C13468/A13982 and C13468/A23536), <funding-source id="gs2">CRIS Cancer Foundation</funding-source>
, <funding-source id="gs3">Abbie's Army and the DIPG Collaborative</funding-source>
, the <funding-source id="gs4">Cure Starts Now Foundation</funding-source>
, <funding-source id="gs17">Christopher's Smile</funding-source>
, <funding-source id="gs5">McKenna Claire Foundation</funding-source>
, <funding-source id="gs6">Lyla Nsouli Foundation</funding-source>
, <funding-source id="gs7">National Institutes of Health</funding-source>
(grants R01NS085336 and R01NS091620), <funding-source id="gs8">The Dragon Master Foundation</funding-source>
, <funding-source id="gs9">The Kortney Rose Foundation</funding-source>
, <funding-source id="gs10">The Musella Foundation For Brain Tumor Research & Information</funding-source>
, <funding-source id="gs11">Gray Matters Foundation</funding-source>
, <funding-source id="gs12">Pediatric Brain Tumor Foundation</funding-source>
, and the INSTINCT network funded by The <funding-source id="gs13">Brain Tumour Charity</funding-source>
, <funding-source id="gs14">Great Ormond Street Children's Charity</funding-source>
, and <funding-source id="gs15">Children with Cancer UK</funding-source>
. The authors acknowledge <funding-source id="gs16">NHS</funding-source>
funding to the NIHR Biomedical Research Centre at The Royal Marsden and the ICR. LTB was recipient of São Paulo Research Foundation fellowships (2011/08523-7 and 2012/08287-4). This study makes use of data generated by the St. Jude Children's Research Hospital – Washington University Pediatric Cancer Genome Project, the Hospital for Sick Children, the McGill University-DKFZ Pediatric Brain Tumor Consortium, the International Cancer Genomics Consortium PedBrain Project and the Cancer Research UK Genomics Initiative (C13468/A14078) and supports the Children's Brain Tumor Tissue Consortium and The Pacific Pediatric Neuro-Oncology Consortium (PNOC) CAVATICA: Project OPEN DIPG initiative.</p>
</ack>
<fn-group><fn id="app1" fn-type="supplementary-material"><p>Supplemental Information includes eight figures and eight tables and can be found with this article online at <ext-link ext-link-type="doi" xlink:href="10.1016/j.ccell.2017.08.017" id="intref0360">http://dx.doi.org/10.1016/j.ccell.2017.08.017</ext-link>
.</p>
</fn>
</fn-group>
</back>
</pmc>
</record>
Pour manipuler ce document sous Unix (Dilib)
EXPLOR_STEP=$WICRI_ROOT/Wicri/Asie/explor/AustralieFrV1/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 0023639 | SxmlIndent | more
Ou
HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 0023639 | SxmlIndent | more
Pour mettre un lien sur cette page dans le réseau Wicri
{{Explor lien |wiki= Wicri/Asie |area= AustralieFrV1 |flux= Pmc |étape= Corpus |type= RBID |clé= |texte= }}
This area was generated with Dilib version V0.6.33. |