Links to Exploration step
Le document en format XML
<record><TEI><teiHeader><fileDesc><titleStmt><title xml:lang="en">Development and GBS-genotyping of introgression lines (ILs) using two wild species of rice, <italic>O. meridionalis</italic>
and <italic>O. rufipogon,</italic>
in a common recurrent parent, <italic>O.</italic>
<italic>sativa</italic>
cv. Curinga</title>
<author><name sortKey="Arbelaez, Juan D" sort="Arbelaez, Juan D" uniqKey="Arbelaez J" first="Juan D." last="Arbelaez">Juan D. Arbelaez</name>
<affiliation><nlm:aff id="Aff1">Department of Plant Breeding and Genetics, Cornell University, 162 Emerson Hall, Ithaca, NY 14853-1901 USA</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Moreno, Laura T" sort="Moreno, Laura T" uniqKey="Moreno L" first="Laura T." last="Moreno">Laura T. Moreno</name>
<affiliation><nlm:aff id="Aff2">School of Botany, The University of Melbourne, Parkville, VIC 3010 Australia</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Singh, Namrata" sort="Singh, Namrata" uniqKey="Singh N" first="Namrata" last="Singh">Namrata Singh</name>
<affiliation><nlm:aff id="Aff1">Department of Plant Breeding and Genetics, Cornell University, 162 Emerson Hall, Ithaca, NY 14853-1901 USA</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Tung, Chih Wei" sort="Tung, Chih Wei" uniqKey="Tung C" first="Chih-Wei" last="Tung">Chih-Wei Tung</name>
<affiliation><nlm:aff id="Aff3">Department of Agronomy, National Taiwan University, No. 1, Section 4, Roosevelt Road, Taipei, 106 Taiwan</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Maron, Lyza G" sort="Maron, Lyza G" uniqKey="Maron L" first="Lyza G." last="Maron">Lyza G. Maron</name>
<affiliation><nlm:aff id="Aff1">Department of Plant Breeding and Genetics, Cornell University, 162 Emerson Hall, Ithaca, NY 14853-1901 USA</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Ospina, Yolima" sort="Ospina, Yolima" uniqKey="Ospina Y" first="Yolima" last="Ospina">Yolima Ospina</name>
<affiliation><nlm:aff id="Aff4">Rice Program, International Center for Tropical Agriculture (CIAT), AA6713 Cali, Colombia</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Martinez, Cesar P" sort="Martinez, Cesar P" uniqKey="Martinez C" first="César P." last="Martinez">César P. Martinez</name>
<affiliation><nlm:aff id="Aff4">Rice Program, International Center for Tropical Agriculture (CIAT), AA6713 Cali, Colombia</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Grenier, Cecile" sort="Grenier, Cecile" uniqKey="Grenier C" first="Cécile" last="Grenier">Cécile Grenier</name>
<affiliation><nlm:aff id="Aff5">CIRAD-AGAP 34394, Montpellier Cedex 5, France</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Lorieux, Mathias" sort="Lorieux, Mathias" uniqKey="Lorieux M" first="Mathias" last="Lorieux">Mathias Lorieux</name>
<affiliation><nlm:aff id="Aff6">DIADE Research Unit, Institut de Recherche Pour le Développement, 34394 Montpellier Cedex 5, France</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="Aff7">Rice Genetics and Genomics Laboratory, International Center for Tropical Agriculture (CIAT), AA6713 Cali, Colombia</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Mccouch, Susan" sort="Mccouch, Susan" uniqKey="Mccouch S" first="Susan" last="Mccouch">Susan Mccouch</name>
<affiliation><nlm:aff id="Aff1">Department of Plant Breeding and Genetics, Cornell University, 162 Emerson Hall, Ithaca, NY 14853-1901 USA</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt><idno type="wicri:source">PMC</idno>
<idno type="pmid">25705117</idno>
<idno type="pmc">4328105</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4328105</idno>
<idno type="RBID">PMC:4328105</idno>
<idno type="doi">10.1007/s11032-015-0276-7</idno>
<date when="2015">2015</date>
<idno type="wicri:Area/Pmc/Corpus">000D78</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000D78</idno>
</publicationStmt>
<sourceDesc><biblStruct><analytic><title xml:lang="en" level="a" type="main">Development and GBS-genotyping of introgression lines (ILs) using two wild species of rice, <italic>O. meridionalis</italic>
and <italic>O. rufipogon,</italic>
in a common recurrent parent, <italic>O.</italic>
<italic>sativa</italic>
cv. Curinga</title>
<author><name sortKey="Arbelaez, Juan D" sort="Arbelaez, Juan D" uniqKey="Arbelaez J" first="Juan D." last="Arbelaez">Juan D. Arbelaez</name>
<affiliation><nlm:aff id="Aff1">Department of Plant Breeding and Genetics, Cornell University, 162 Emerson Hall, Ithaca, NY 14853-1901 USA</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Moreno, Laura T" sort="Moreno, Laura T" uniqKey="Moreno L" first="Laura T." last="Moreno">Laura T. Moreno</name>
<affiliation><nlm:aff id="Aff2">School of Botany, The University of Melbourne, Parkville, VIC 3010 Australia</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Singh, Namrata" sort="Singh, Namrata" uniqKey="Singh N" first="Namrata" last="Singh">Namrata Singh</name>
<affiliation><nlm:aff id="Aff1">Department of Plant Breeding and Genetics, Cornell University, 162 Emerson Hall, Ithaca, NY 14853-1901 USA</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Tung, Chih Wei" sort="Tung, Chih Wei" uniqKey="Tung C" first="Chih-Wei" last="Tung">Chih-Wei Tung</name>
<affiliation><nlm:aff id="Aff3">Department of Agronomy, National Taiwan University, No. 1, Section 4, Roosevelt Road, Taipei, 106 Taiwan</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Maron, Lyza G" sort="Maron, Lyza G" uniqKey="Maron L" first="Lyza G." last="Maron">Lyza G. Maron</name>
<affiliation><nlm:aff id="Aff1">Department of Plant Breeding and Genetics, Cornell University, 162 Emerson Hall, Ithaca, NY 14853-1901 USA</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Ospina, Yolima" sort="Ospina, Yolima" uniqKey="Ospina Y" first="Yolima" last="Ospina">Yolima Ospina</name>
<affiliation><nlm:aff id="Aff4">Rice Program, International Center for Tropical Agriculture (CIAT), AA6713 Cali, Colombia</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Martinez, Cesar P" sort="Martinez, Cesar P" uniqKey="Martinez C" first="César P." last="Martinez">César P. Martinez</name>
<affiliation><nlm:aff id="Aff4">Rice Program, International Center for Tropical Agriculture (CIAT), AA6713 Cali, Colombia</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Grenier, Cecile" sort="Grenier, Cecile" uniqKey="Grenier C" first="Cécile" last="Grenier">Cécile Grenier</name>
<affiliation><nlm:aff id="Aff5">CIRAD-AGAP 34394, Montpellier Cedex 5, France</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Lorieux, Mathias" sort="Lorieux, Mathias" uniqKey="Lorieux M" first="Mathias" last="Lorieux">Mathias Lorieux</name>
<affiliation><nlm:aff id="Aff6">DIADE Research Unit, Institut de Recherche Pour le Développement, 34394 Montpellier Cedex 5, France</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="Aff7">Rice Genetics and Genomics Laboratory, International Center for Tropical Agriculture (CIAT), AA6713 Cali, Colombia</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Mccouch, Susan" sort="Mccouch, Susan" uniqKey="Mccouch S" first="Susan" last="Mccouch">Susan Mccouch</name>
<affiliation><nlm:aff id="Aff1">Department of Plant Breeding and Genetics, Cornell University, 162 Emerson Hall, Ithaca, NY 14853-1901 USA</nlm:aff>
</affiliation>
</author>
</analytic>
<series><title level="j">Molecular Breeding</title>
<idno type="ISSN">1380-3743</idno>
<idno type="eISSN">1572-9788</idno>
<imprint><date when="2015">2015</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc><textClass></textClass>
</profileDesc>
</teiHeader>
<front><div type="abstract" xml:lang="en"><p>Two populations of interspecific introgression lines (ILs) in a common recurrent parent were developed for use in pre-breeding and QTL mapping. The ILs were derived from crosses between cv Curinga, a <italic>tropical japonica</italic>
upland cultivar, and two different wild donors, <italic>Oryza meridionalis</italic>
Ng. accession (W2112) and <italic>Oryza rufipogon</italic>
Griff. accession (IRGC 105491). The lines were genotyped using genotyping-by-sequencing (GBS) and SSRs. The 32 Curinga/<italic>O. meridionalis</italic>
ILs contain 76.73 % of the donor genome in individual introgressed segments, and each line has an average of 94.9 % recurrent parent genome. The 48 Curinga/<italic>O. rufipogon</italic>
ILs collectively contain 97.6 % of the donor genome with an average of 89.9 % recurrent parent genome per line. To confirm that these populations were segregating for traits of interest, they were phenotyped for pericarp color in the greenhouse and for four agronomic traits—days to flowering, plant height, number of tillers, and number of panicles—in an upland field environment. Seeds from these IL libraries and the accompanying GBS datasets are publicly available and represent valuable genetic resources for exploring the genetics and breeding potential of rice wild relatives.</p>
<sec><title>Electronic supplementary material</title>
<p>The online version of this article (doi:10.1007/s11032-015-0276-7) contains supplementary material, which is available to authorized users.</p>
</sec>
</div>
</front>
<back><div1 type="bibliography"><listBibl><biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Ali, Ml" uniqKey="Ali M">ML Ali</name>
</author>
<author><name sortKey="Sanchez, Pl" uniqKey="Sanchez P">PL Sanchez</name>
</author>
<author><name sortKey="Yu, S" uniqKey="Yu S">S Yu</name>
</author>
<author><name sortKey="Lorieux, M" uniqKey="Lorieux M">M Lorieux</name>
</author>
<author><name sortKey="Eizenga, Gc" uniqKey="Eizenga G">GC Eizenga</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ando, T" uniqKey="Ando T">T Ando</name>
</author>
<author><name sortKey="Yamamoto, T" uniqKey="Yamamoto T">T Yamamoto</name>
</author>
<author><name sortKey="Shimizu, T" uniqKey="Shimizu T">T Shimizu</name>
</author>
<author><name sortKey="Ma, Xf" uniqKey="Ma X">XF Ma</name>
</author>
<author><name sortKey="Shomura, A" uniqKey="Shomura A">A Shomura</name>
</author>
<author><name sortKey="Takeuchi, Y" uniqKey="Takeuchi Y">Y Takeuchi</name>
</author>
<author><name sortKey="Lin, Sy" uniqKey="Lin S">SY Lin</name>
</author>
<author><name sortKey="Yano, M" uniqKey="Yano M">M Yano</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Asins, Mj" uniqKey="Asins M">MJ Asíns</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Bradbury, Pj" uniqKey="Bradbury P">PJ Bradbury</name>
</author>
<author><name sortKey="Zhang, Z" uniqKey="Zhang Z">Z Zhang</name>
</author>
<author><name sortKey="Kroon, De" uniqKey="Kroon D">DE Kroon</name>
</author>
<author><name sortKey="Casstevens, Tm" uniqKey="Casstevens T">TM Casstevens</name>
</author>
<author><name sortKey="Ramdoss, Y" uniqKey="Ramdoss Y">Y Ramdoss</name>
</author>
<author><name sortKey="Buckler, Es" uniqKey="Buckler E">ES Buckler</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Brar, Ds" uniqKey="Brar D">DS Brar</name>
</author>
<author><name sortKey="Khush, Gs" uniqKey="Khush G">GS Khush</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Brondani, C" uniqKey="Brondani C">C Brondani</name>
</author>
<author><name sortKey="Brondani, R" uniqKey="Brondani R">R Brondani</name>
</author>
<author><name sortKey="Rangel, P" uniqKey="Rangel P">P Rangel</name>
</author>
<author><name sortKey="Ferreira, M" uniqKey="Ferreira M">M Ferreira</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Chatel, M" uniqKey="Chatel M">M Châtel</name>
</author>
<author><name sortKey="Ospina, Y" uniqKey="Ospina Y">Y Ospina</name>
</author>
<author><name sortKey="Rodriguez, F" uniqKey="Rodriguez F">F Rodriguez</name>
</author>
<author><name sortKey="Lozano, Vh" uniqKey="Lozano V">VH Lozano</name>
</author>
<author><name sortKey="Delgado, H" uniqKey="Delgado H">H Delgado</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Chin, Jh" uniqKey="Chin J">JH Chin</name>
</author>
<author><name sortKey="Gamuyao, R" uniqKey="Gamuyao R">R Gamuyao</name>
</author>
<author><name sortKey="Dalid, C" uniqKey="Dalid C">C Dalid</name>
</author>
<author><name sortKey="Bustamam, M" uniqKey="Bustamam M">M Bustamam</name>
</author>
<author><name sortKey="Prasetiyono, J" uniqKey="Prasetiyono J">J Prasetiyono</name>
</author>
<author><name sortKey="Moeljopawiro, S" uniqKey="Moeljopawiro S">S Moeljopawiro</name>
</author>
<author><name sortKey="Wissuwa, M" uniqKey="Wissuwa M">M Wissuwa</name>
</author>
<author><name sortKey="Heuer, S" uniqKey="Heuer S">S Heuer</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Collard, Bcy" uniqKey="Collard B">BCY Collard</name>
</author>
<author><name sortKey="Mackill, Dj" uniqKey="Mackill D">DJ Mackill</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Doerge, Rw" uniqKey="Doerge R">RW Doerge</name>
</author>
<author><name sortKey="Churchill, Ga" uniqKey="Churchill G">GA Churchill</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Dunnett, Cw" uniqKey="Dunnett C">CW Dunnett</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Elshire, Rj" uniqKey="Elshire R">RJ Elshire</name>
</author>
<author><name sortKey="Glaubitz, Jc" uniqKey="Glaubitz J">JC Glaubitz</name>
</author>
<author><name sortKey="Sun, Q" uniqKey="Sun Q">Q Sun</name>
</author>
<author><name sortKey="Poland, Ja" uniqKey="Poland J">JA Poland</name>
</author>
<author><name sortKey="Kawamoto, K" uniqKey="Kawamoto K">K Kawamoto</name>
</author>
<author><name sortKey="Buckler, Es" uniqKey="Buckler E">ES Buckler</name>
</author>
<author><name sortKey="Mitchell, Se" uniqKey="Mitchell S">SE Mitchell</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Gao, L Z" uniqKey="Gao L">L-Z Gao</name>
</author>
<author><name sortKey="Zhang, C H" uniqKey="Zhang C">C-H Zhang</name>
</author>
<author><name sortKey="Li, D Y" uniqKey="Li D">D-Y Li</name>
</author>
<author><name sortKey="Pan, D J" uniqKey="Pan D">D-J Pan</name>
</author>
<author><name sortKey="Jia, J Z" uniqKey="Jia J">J-Z Jia</name>
</author>
<author><name sortKey="Dong, Y S" uniqKey="Dong Y">Y-S Dong</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Godfray, Hcj" uniqKey="Godfray H">HCJ Godfray</name>
</author>
<author><name sortKey="Beddington, Jr" uniqKey="Beddington J">JR Beddington</name>
</author>
<author><name sortKey="Crute, Ir" uniqKey="Crute I">IR Crute</name>
</author>
<author><name sortKey="Haddad, L" uniqKey="Haddad L">L Haddad</name>
</author>
<author><name sortKey="Lawrence, D" uniqKey="Lawrence D">D Lawrence</name>
</author>
<author><name sortKey="Muir, Jf" uniqKey="Muir J">JF Muir</name>
</author>
<author><name sortKey="Pretty, J" uniqKey="Pretty J">J Pretty</name>
</author>
<author><name sortKey="Robinson, S" uniqKey="Robinson S">S Robinson</name>
</author>
<author><name sortKey="Thomas, Sm" uniqKey="Thomas S">SM Thomas</name>
</author>
<author><name sortKey="Toulmin, C" uniqKey="Toulmin C">C Toulmin</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Gu, X Y" uniqKey="Gu X">X-Y Gu</name>
</author>
<author><name sortKey="Foley, Me" uniqKey="Foley M">ME Foley</name>
</author>
<author><name sortKey="Horvath, Dp" uniqKey="Horvath D">DP Horvath</name>
</author>
<author><name sortKey="Anderson, Jv" uniqKey="Anderson J">JV Anderson</name>
</author>
<author><name sortKey="Feng, J" uniqKey="Feng J">J Feng</name>
</author>
<author><name sortKey="Zhang, L" uniqKey="Zhang L">L Zhang</name>
</author>
<author><name sortKey="Mowry, Cr" uniqKey="Mowry C">CR Mowry</name>
</author>
<author><name sortKey="Ye, H" uniqKey="Ye H">H Ye</name>
</author>
<author><name sortKey="Suttle, Jc" uniqKey="Suttle J">JC Suttle</name>
</author>
<author><name sortKey="Kadowaki, K" uniqKey="Kadowaki K">K Kadowaki</name>
</author>
<author><name sortKey="Chen, Z" uniqKey="Chen Z">Z Chen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Guimaraes, Ep" uniqKey="Guimaraes E">EP Guimaraes</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Guimaraees, Ep" uniqKey="Guimaraees E">EP Guimaraees</name>
</author>
<author><name sortKey="Borrero, J" uniqKey="Borrero J">J Borrero</name>
</author>
<author><name sortKey="Ospina Rey, Y" uniqKey="Ospina Rey Y">Y Ospina-Rey</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Gutierrez, A" uniqKey="Gutierrez A">A Gutierrez</name>
</author>
<author><name sortKey="Carabali, J" uniqKey="Carabali J">J Carabali</name>
</author>
<author><name sortKey="Giraldo, O" uniqKey="Giraldo O">O Giraldo</name>
</author>
<author><name sortKey="Martinez, C" uniqKey="Martinez C">C Martinez</name>
</author>
<author><name sortKey="Correa, F" uniqKey="Correa F">F Correa</name>
</author>
<author><name sortKey="Prado, G" uniqKey="Prado G">G Prado</name>
</author>
<author><name sortKey="Tohme, J" uniqKey="Tohme J">J Tohme</name>
</author>
<author><name sortKey="Lorieux, M" uniqKey="Lorieux M">M Lorieux</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Heslot, N" uniqKey="Heslot N">N Heslot</name>
</author>
<author><name sortKey="Rutkoski, J" uniqKey="Rutkoski J">J Rutkoski</name>
</author>
<author><name sortKey="Poland, J" uniqKey="Poland J">J Poland</name>
</author>
<author><name sortKey="Jannink, J L" uniqKey="Jannink J">J-L Jannink</name>
</author>
<author><name sortKey="Sorrells, Me" uniqKey="Sorrells M">ME Sorrells</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Hospital, F" uniqKey="Hospital F">F Hospital</name>
</author>
<author><name sortKey="Moreau, L" uniqKey="Moreau L">L Moreau</name>
</author>
<author><name sortKey="Lacoudre, F" uniqKey="Lacoudre F">F Lacoudre</name>
</author>
<author><name sortKey="Charcosset, A" uniqKey="Charcosset A">A Charcosset</name>
</author>
<author><name sortKey="Gallais, A" uniqKey="Gallais A">A Gallais</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Imai, I" uniqKey="Imai I">I Imai</name>
</author>
<author><name sortKey="Kimball, J" uniqKey="Kimball J">J Kimball</name>
</author>
<author><name sortKey="Conway, B" uniqKey="Conway B">B Conway</name>
</author>
<author><name sortKey="Yeater, K" uniqKey="Yeater K">K Yeater</name>
</author>
<author><name sortKey="Mccouch, S" uniqKey="Mccouch S">S McCouch</name>
</author>
<author><name sortKey="Mcclung, A" uniqKey="Mcclung A">A McClung</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Inukai, T" uniqKey="Inukai T">T Inukai</name>
</author>
<author><name sortKey="Zeigler, Rs" uniqKey="Zeigler R">RS Zeigler</name>
</author>
<author><name sortKey="Sarkarung, S" uniqKey="Sarkarung S">S Sarkarung</name>
</author>
<author><name sortKey="Bronson, M" uniqKey="Bronson M">M Bronson</name>
</author>
<author><name sortKey="Dung, Lv" uniqKey="Dung L">LV Dung</name>
</author>
<author><name sortKey="Kinoshita, T" uniqKey="Kinoshita T">T Kinoshita</name>
</author>
<author><name sortKey="Nelson, Rj" uniqKey="Nelson R">RJ Nelson</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kanbe, T" uniqKey="Kanbe T">T Kanbe</name>
</author>
<author><name sortKey="Sasaki, H" uniqKey="Sasaki H">H Sasaki</name>
</author>
<author><name sortKey="Aoki, N" uniqKey="Aoki N">N Aoki</name>
</author>
<author><name sortKey="Yamagishi, T" uniqKey="Yamagishi T">T Yamagishi</name>
</author>
<author><name sortKey="Ebitani, T" uniqKey="Ebitani T">T Ebitani</name>
</author>
<author><name sortKey="Yano, M" uniqKey="Yano M">M Yano</name>
</author>
<author><name sortKey="Ohsugi, R" uniqKey="Ohsugi R">R Ohsugi</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kawahara, Y" uniqKey="Kawahara Y">Y Kawahara</name>
</author>
<author><name sortKey="De La Bastide, M" uniqKey="De La Bastide M">M de la Bastide</name>
</author>
<author><name sortKey="Hamilton, J" uniqKey="Hamilton J">J Hamilton</name>
</author>
<author><name sortKey="Kanamori, H" uniqKey="Kanamori H">H Kanamori</name>
</author>
<author><name sortKey="Mccombie, Wr" uniqKey="Mccombie W">WR McCombie</name>
</author>
<author><name sortKey="Ouyang, S" uniqKey="Ouyang S">S Ouyang</name>
</author>
<author><name sortKey="Schwartz, D" uniqKey="Schwartz D">D Schwartz</name>
</author>
<author><name sortKey="Tanaka, T" uniqKey="Tanaka T">T Tanaka</name>
</author>
<author><name sortKey="Wu, J" uniqKey="Wu J">J Wu</name>
</author>
<author><name sortKey="Zhou, S" uniqKey="Zhou S">S Zhou</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kinoshita, T" uniqKey="Kinoshita T">T Kinoshita</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kinoshita, T" uniqKey="Kinoshita T">T Kinoshita</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Koide, Y" uniqKey="Koide Y">Y Koide</name>
</author>
<author><name sortKey="Onishi, K" uniqKey="Onishi K">K Onishi</name>
</author>
<author><name sortKey="Nishimoto, D" uniqKey="Nishimoto D">D Nishimoto</name>
</author>
<author><name sortKey="Baruah, Ar" uniqKey="Baruah A">AR Baruah</name>
</author>
<author><name sortKey="Kanazawa, A" uniqKey="Kanazawa A">A Kanazawa</name>
</author>
<author><name sortKey="Sano, Y" uniqKey="Sano Y">Y Sano</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kosambi, Dd" uniqKey="Kosambi D">DD Kosambi</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kubo, T" uniqKey="Kubo T">T Kubo</name>
</author>
<author><name sortKey="Aida, Y" uniqKey="Aida Y">Y Aida</name>
</author>
<author><name sortKey="Nakamura, K" uniqKey="Nakamura K">K Nakamura</name>
</author>
<author><name sortKey="Tsunematsu, H" uniqKey="Tsunematsu H">H Tsunematsu</name>
</author>
<author><name sortKey="Doi, K" uniqKey="Doi K">K Doi</name>
</author>
<author><name sortKey="Yoshimura, A" uniqKey="Yoshimura A">A Yoshimura</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lentini, Z" uniqKey="Lentini Z">Z Lentini</name>
</author>
<author><name sortKey="Reyes, P" uniqKey="Reyes P">P Reyes</name>
</author>
<author><name sortKey="Martinez, Cp" uniqKey="Martinez C">CP Martínez</name>
</author>
<author><name sortKey="Roca, Wm" uniqKey="Roca W">WM Roca</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Li, H" uniqKey="Li H">H Li</name>
</author>
<author><name sortKey="Ye, G" uniqKey="Ye G">G Ye</name>
</author>
<author><name sortKey="Wang, J" uniqKey="Wang J">J Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Li, S" uniqKey="Li S">S Li</name>
</author>
<author><name sortKey="Yan, S" uniqKey="Yan S">S Yan</name>
</author>
<author><name sortKey="Wang, A H" uniqKey="Wang A">A-h Wang</name>
</author>
<author><name sortKey="Zou, G" uniqKey="Zou G">G Zou</name>
</author>
<author><name sortKey="Huang, X" uniqKey="Huang X">X Huang</name>
</author>
<author><name sortKey="Han, B" uniqKey="Han B">B Han</name>
</author>
<author><name sortKey="Qian, Q" uniqKey="Qian Q">Q Qian</name>
</author>
<author><name sortKey="Tao, Y" uniqKey="Tao Y">Y Tao</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lin, H" uniqKey="Lin H">H Lin</name>
</author>
<author><name sortKey="Ashikari, M" uniqKey="Ashikari M">M Ashikari</name>
</author>
<author><name sortKey="Yamanouchi, U" uniqKey="Yamanouchi U">U Yamanouchi</name>
</author>
<author><name sortKey="Sasaki, T" uniqKey="Sasaki T">T Sasaki</name>
</author>
<author><name sortKey="Yano, M" uniqKey="Yano M">M Yano</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ling, Wh" uniqKey="Ling W">WH Ling</name>
</author>
<author><name sortKey="Cheng, Qx" uniqKey="Cheng Q">QX Cheng</name>
</author>
<author><name sortKey="Ma, J" uniqKey="Ma J">J Ma</name>
</author>
<author><name sortKey="Wang, T" uniqKey="Wang T">T Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Liu, G" uniqKey="Liu G">G Liu</name>
</author>
<author><name sortKey="Zhang, Z" uniqKey="Zhang Z">Z Zhang</name>
</author>
<author><name sortKey="Zhu, H" uniqKey="Zhu H">H Zhu</name>
</author>
<author><name sortKey="Zhao, F" uniqKey="Zhao F">F Zhao</name>
</author>
<author><name sortKey="Ding, X" uniqKey="Ding X">X Ding</name>
</author>
<author><name sortKey="Zeng, R" uniqKey="Zeng R">R Zeng</name>
</author>
<author><name sortKey="Li, W" uniqKey="Li W">W Li</name>
</author>
<author><name sortKey="Zhang, G" uniqKey="Zhang G">G Zhang</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Lorieux, M" uniqKey="Lorieux M">M Lorieux</name>
</author>
<author><name sortKey="Ndjiondjop, M N" uniqKey="Ndjiondjop M">M-N Ndjiondjop</name>
</author>
<author><name sortKey="Ghesquiere, A" uniqKey="Ghesquiere A">A Ghesquière</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Maas, Lf" uniqKey="Maas L">LF Maas</name>
</author>
<author><name sortKey="Mcclung, A" uniqKey="Mcclung A">A McClung</name>
</author>
<author><name sortKey="Mccouch, S" uniqKey="Mccouch S">S McCouch</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Marri, Pr" uniqKey="Marri P">PR Marri</name>
</author>
<author><name sortKey="Sarla, N" uniqKey="Sarla N">N Sarla</name>
</author>
<author><name sortKey="Reddy, Lv" uniqKey="Reddy L">LV Reddy</name>
</author>
<author><name sortKey="Siddiq, Ea" uniqKey="Siddiq E">EA Siddiq</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Matsubara, K" uniqKey="Matsubara K">K Matsubara</name>
</author>
<author><name sortKey="Khin Thidar, Sano Y" uniqKey="Khin Thidar S">Sano Y Khin-Thidar</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Mccouch, Sr" uniqKey="Mccouch S">SR McCouch</name>
</author>
<author><name sortKey="Kochert, G" uniqKey="Kochert G">G Kochert</name>
</author>
<author><name sortKey="Yu, Zh" uniqKey="Yu Z">ZH Yu</name>
</author>
<author><name sortKey="Wang, Zy" uniqKey="Wang Z">ZY Wang</name>
</author>
<author><name sortKey="Khush, Gs" uniqKey="Khush G">GS Khush</name>
</author>
<author><name sortKey="Coffman, Wr" uniqKey="Coffman W">WR Coffman</name>
</author>
<author><name sortKey="Tanksley, Sd" uniqKey="Tanksley S">SD Tanksley</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Mccouch, Sr" uniqKey="Mccouch S">SR McCouch</name>
</author>
<author><name sortKey="Teytelman, L" uniqKey="Teytelman L">L Teytelman</name>
</author>
<author><name sortKey="Xu, Y" uniqKey="Xu Y">Y Xu</name>
</author>
<author><name sortKey="Lobos, Kb" uniqKey="Lobos K">KB Lobos</name>
</author>
<author><name sortKey="Clare, K" uniqKey="Clare K">K Clare</name>
</author>
<author><name sortKey="Walton, M" uniqKey="Walton M">M Walton</name>
</author>
<author><name sortKey="Fu, B" uniqKey="Fu B">B Fu</name>
</author>
<author><name sortKey="Maghirang, R" uniqKey="Maghirang R">R Maghirang</name>
</author>
<author><name sortKey="Li, Z" uniqKey="Li Z">Z Li</name>
</author>
<author><name sortKey="Xing, Y" uniqKey="Xing Y">Y Xing</name>
</author>
<author><name sortKey="Zhang, Q" uniqKey="Zhang Q">Q Zhang</name>
</author>
<author><name sortKey="Kono, I" uniqKey="Kono I">I Kono</name>
</author>
<author><name sortKey="Yano, M" uniqKey="Yano M">M Yano</name>
</author>
<author><name sortKey="Fjellstrom, R" uniqKey="Fjellstrom R">R Fjellstrom</name>
</author>
<author><name sortKey="Declerck, G" uniqKey="Declerck G">G DeClerck</name>
</author>
<author><name sortKey="Schneider, D" uniqKey="Schneider D">D Schneider</name>
</author>
<author><name sortKey="Cartinhour, S" uniqKey="Cartinhour S">S Cartinhour</name>
</author>
<author><name sortKey="Ware, D" uniqKey="Ware D">D Ware</name>
</author>
<author><name sortKey="Stein, L" uniqKey="Stein L">L Stein</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Mccouch, Sr" uniqKey="Mccouch S">SR McCouch</name>
</author>
<author><name sortKey="Sweeney, M" uniqKey="Sweeney M">M Sweeney</name>
</author>
<author><name sortKey="Li, J" uniqKey="Li J">J Li</name>
</author>
<author><name sortKey="Jiang, H" uniqKey="Jiang H">H Jiang</name>
</author>
<author><name sortKey="Thomson, M" uniqKey="Thomson M">M Thomson</name>
</author>
<author><name sortKey="Septiningsih, E" uniqKey="Septiningsih E">E Septiningsih</name>
</author>
<author><name sortKey="Edwards, J" uniqKey="Edwards J">J Edwards</name>
</author>
<author><name sortKey="Moncada, P" uniqKey="Moncada P">P Moncada</name>
</author>
<author><name sortKey="Xiao, J" uniqKey="Xiao J">J Xiao</name>
</author>
<author><name sortKey="Garris, A" uniqKey="Garris A">A Garris</name>
</author>
<author><name sortKey="Tai, T" uniqKey="Tai T">T Tai</name>
</author>
<author><name sortKey="Martinez, C" uniqKey="Martinez C">C Martinez</name>
</author>
<author><name sortKey="Tohme, J" uniqKey="Tohme J">J Tohme</name>
</author>
<author><name sortKey="Sugiono, M" uniqKey="Sugiono M">M Sugiono</name>
</author>
<author><name sortKey="Mcclung, A" uniqKey="Mcclung A">A McClung</name>
</author>
<author><name sortKey="Yuan, Lp" uniqKey="Yuan L">LP Yuan</name>
</author>
<author><name sortKey="Ahn, S N" uniqKey="Ahn S">S-N Ahn</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Mccouch, S" uniqKey="Mccouch S">S McCouch</name>
</author>
<author><name sortKey="Baute, Gj" uniqKey="Baute G">GJ Baute</name>
</author>
<author><name sortKey="Bradeen, J" uniqKey="Bradeen J">J Bradeen</name>
</author>
<author><name sortKey="Bramel, P" uniqKey="Bramel P">P Bramel</name>
</author>
<author><name sortKey="Bretting, Pk" uniqKey="Bretting P">PK Bretting</name>
</author>
<author><name sortKey="Buckler, E" uniqKey="Buckler E">E Buckler</name>
</author>
<author><name sortKey="Burke, Jm" uniqKey="Burke J">JM Burke</name>
</author>
<author><name sortKey="Charest, D" uniqKey="Charest D">D Charest</name>
</author>
<author><name sortKey="Cloutier, S" uniqKey="Cloutier S">S Cloutier</name>
</author>
<author><name sortKey="Cole, G" uniqKey="Cole G">G Cole</name>
</author>
<author><name sortKey="Dempewolf, H" uniqKey="Dempewolf H">H Dempewolf</name>
</author>
<author><name sortKey="Dingkuhn, M" uniqKey="Dingkuhn M">M Dingkuhn</name>
</author>
<author><name sortKey="Feuillet, C" uniqKey="Feuillet C">C Feuillet</name>
</author>
<author><name sortKey="Gepts, P" uniqKey="Gepts P">P Gepts</name>
</author>
<author><name sortKey="Grattapaglia, D" uniqKey="Grattapaglia D">D Grattapaglia</name>
</author>
<author><name sortKey="Guarino, L" uniqKey="Guarino L">L Guarino</name>
</author>
<author><name sortKey="Jackson, S" uniqKey="Jackson S">S Jackson</name>
</author>
<author><name sortKey="Knapp, S" uniqKey="Knapp S">S Knapp</name>
</author>
<author><name sortKey="Langridge, P" uniqKey="Langridge P">P Langridge</name>
</author>
<author><name sortKey="Lawton Rauh, A" uniqKey="Lawton Rauh A">A Lawton-Rauh</name>
</author>
<author><name sortKey="Lijua, Q" uniqKey="Lijua Q">Q Lijua</name>
</author>
<author><name sortKey="Lusty, C" uniqKey="Lusty C">C Lusty</name>
</author>
<author><name sortKey="Michael, T" uniqKey="Michael T">T Michael</name>
</author>
<author><name sortKey="Myles, S" uniqKey="Myles S">S Myles</name>
</author>
<author><name sortKey="Naito, K" uniqKey="Naito K">K Naito</name>
</author>
<author><name sortKey="Nelson, Rl" uniqKey="Nelson R">RL Nelson</name>
</author>
<author><name sortKey="Pontarollo, R" uniqKey="Pontarollo R">R Pontarollo</name>
</author>
<author><name sortKey="Richards, Cm" uniqKey="Richards C">CM Richards</name>
</author>
<author><name sortKey="Rieseberg, L" uniqKey="Rieseberg L">L Rieseberg</name>
</author>
<author><name sortKey="Ross Ibarra, J" uniqKey="Ross Ibarra J">J Ross-Ibarra</name>
</author>
<author><name sortKey="Rounsley, S" uniqKey="Rounsley S">S Rounsley</name>
</author>
<author><name sortKey="Hamilton, Rs" uniqKey="Hamilton R">RS Hamilton</name>
</author>
<author><name sortKey="Schurr, U" uniqKey="Schurr U">U Schurr</name>
</author>
<author><name sortKey="Stein, N" uniqKey="Stein N">N Stein</name>
</author>
<author><name sortKey="Tomooka, N" uniqKey="Tomooka N">N Tomooka</name>
</author>
<author><name sortKey="Van Der Knaap, E" uniqKey="Van Der Knaap E">E van der Knaap</name>
</author>
<author><name sortKey="Van Tassel, D" uniqKey="Van Tassel D">D van Tassel</name>
</author>
<author><name sortKey="Toll, J" uniqKey="Toll J">J Toll</name>
</author>
<author><name sortKey="Valls, J" uniqKey="Valls J">J Valls</name>
</author>
<author><name sortKey="Varshney, Rk" uniqKey="Varshney R">RK Varshney</name>
</author>
<author><name sortKey="Ward, J" uniqKey="Ward J">J Ward</name>
</author>
<author><name sortKey="Waugh, R" uniqKey="Waugh R">R Waugh</name>
</author>
<author><name sortKey="Wenzl, P" uniqKey="Wenzl P">P Wenzl</name>
</author>
<author><name sortKey="Zamir, D" uniqKey="Zamir D">D Zamir</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Moncada, P" uniqKey="Moncada P">P Moncada</name>
</author>
<author><name sortKey="Martinez, Cp" uniqKey="Martinez C">CP Martínez</name>
</author>
<author><name sortKey="Borrero, J" uniqKey="Borrero J">J Borrero</name>
</author>
<author><name sortKey="Chatel, M" uniqKey="Chatel M">M Chatel</name>
</author>
<author><name sortKey="Gauch, H" uniqKey="Gauch H">H Gauch</name>
</author>
<author><name sortKey="Guimaraes, E" uniqKey="Guimaraes E">E Guimaraes</name>
</author>
<author><name sortKey="Tohme, J" uniqKey="Tohme J">J Tohme</name>
</author>
<author><name sortKey="Mccouch, Sr" uniqKey="Mccouch S">SR McCouch</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ng, Nq" uniqKey="Ng N">NQ Ng</name>
</author>
<author><name sortKey="Hawkes, Jg" uniqKey="Hawkes J">JG Hawkes</name>
</author>
<author><name sortKey="Williams, Jt" uniqKey="Williams J">JT Williams</name>
</author>
<author><name sortKey="Chang, Tt" uniqKey="Chang T">TT Chang</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Orjuela, J" uniqKey="Orjuela J">J Orjuela</name>
</author>
<author><name sortKey="Garavito, A" uniqKey="Garavito A">A Garavito</name>
</author>
<author><name sortKey="Bouniol, M" uniqKey="Bouniol M">M Bouniol</name>
</author>
<author><name sortKey="Arbelaez, J" uniqKey="Arbelaez J">J Arbelaez</name>
</author>
<author><name sortKey="Moreno, L" uniqKey="Moreno L">L Moreno</name>
</author>
<author><name sortKey="Kimball, J" uniqKey="Kimball J">J Kimball</name>
</author>
<author><name sortKey="Wilson, G" uniqKey="Wilson G">G Wilson</name>
</author>
<author><name sortKey="Rami, J F" uniqKey="Rami J">J-F Rami</name>
</author>
<author><name sortKey="Tohme, J" uniqKey="Tohme J">J Tohme</name>
</author>
<author><name sortKey="Mccouch, S" uniqKey="Mccouch S">S McCouch</name>
</author>
<author><name sortKey="Lorieux, M" uniqKey="Lorieux M">M Lorieux</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Panaud, O" uniqKey="Panaud O">O Panaud</name>
</author>
<author><name sortKey="Chen, X" uniqKey="Chen X">X Chen</name>
</author>
<author><name sortKey="Mccouch, Sr" uniqKey="Mccouch S">SR McCouch</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Park, Kc" uniqKey="Park K">KC Park</name>
</author>
<author><name sortKey="Kim, Nh" uniqKey="Kim N">NH Kim</name>
</author>
<author><name sortKey="Cho, Ys" uniqKey="Cho Y">YS Cho</name>
</author>
<author><name sortKey="Kang, Kh" uniqKey="Kang K">KH Kang</name>
</author>
<author><name sortKey="Lee, Jk" uniqKey="Lee J">JK Lee</name>
</author>
<author><name sortKey="Kim, N S" uniqKey="Kim N">N-S Kim</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Periyannan, S" uniqKey="Periyannan S">S Periyannan</name>
</author>
<author><name sortKey="Moore, J" uniqKey="Moore J">J Moore</name>
</author>
<author><name sortKey="Ayliffe, M" uniqKey="Ayliffe M">M Ayliffe</name>
</author>
<author><name sortKey="Bansal, U" uniqKey="Bansal U">U Bansal</name>
</author>
<author><name sortKey="Wang, X" uniqKey="Wang X">X Wang</name>
</author>
<author><name sortKey="Huang, L" uniqKey="Huang L">L Huang</name>
</author>
<author><name sortKey="Deal, K" uniqKey="Deal K">K Deal</name>
</author>
<author><name sortKey="Luo, M" uniqKey="Luo M">M Luo</name>
</author>
<author><name sortKey="Kong, X" uniqKey="Kong X">X Kong</name>
</author>
<author><name sortKey="Bariana, H" uniqKey="Bariana H">H Bariana</name>
</author>
<author><name sortKey="Mago, R" uniqKey="Mago R">R Mago</name>
</author>
<author><name sortKey="Mcintosh, R" uniqKey="Mcintosh R">R McIntosh</name>
</author>
<author><name sortKey="Dodds, P" uniqKey="Dodds P">P Dodds</name>
</author>
<author><name sortKey="Dvorak, J" uniqKey="Dvorak J">J Dvorak</name>
</author>
<author><name sortKey="Lagudah, E" uniqKey="Lagudah E">E Lagudah</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ray, Dk" uniqKey="Ray D">DK Ray</name>
</author>
<author><name sortKey="Mueller, Nd" uniqKey="Mueller N">ND Mueller</name>
</author>
<author><name sortKey="West, Pc" uniqKey="West P">PC West</name>
</author>
<author><name sortKey="Foley, Ja" uniqKey="Foley J">JA Foley</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ren, F" uniqKey="Ren F">F Ren</name>
</author>
<author><name sortKey="Lu, B R" uniqKey="Lu B">B-R Lu</name>
</author>
<author><name sortKey="Li, S" uniqKey="Li S">S Li</name>
</author>
<author><name sortKey="Huang, J" uniqKey="Huang J">J Huang</name>
</author>
<author><name sortKey="Zhu, Y" uniqKey="Zhu Y">Y Zhu</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Romero, Le" uniqKey="Romero L">LE Romero</name>
</author>
<author><name sortKey="Lozano, I" uniqKey="Lozano I">I Lozano</name>
</author>
<author><name sortKey="Garavito, A" uniqKey="Garavito A">A Garavito</name>
</author>
<author><name sortKey="Carabali, Sj" uniqKey="Carabali S">SJ Carabali</name>
</author>
<author><name sortKey="Triana, M" uniqKey="Triana M">M Triana</name>
</author>
<author><name sortKey="Villareal, N" uniqKey="Villareal N">N Villareal</name>
</author>
<author><name sortKey="Reyes, L" uniqKey="Reyes L">L Reyes</name>
</author>
<author><name sortKey="Duque, Mc" uniqKey="Duque M">MC Duque</name>
</author>
<author><name sortKey="Martinez, Cp" uniqKey="Martinez C">CP Martinez</name>
</author>
<author><name sortKey="Calvert, L" uniqKey="Calvert L">L Calvert</name>
</author>
<author><name sortKey="Lorieux, M" uniqKey="Lorieux M">M Lorieux</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Saintenac, C" uniqKey="Saintenac C">C Saintenac</name>
</author>
<author><name sortKey="Zhang, W" uniqKey="Zhang W">W Zhang</name>
</author>
<author><name sortKey="Salcedo, A" uniqKey="Salcedo A">A Salcedo</name>
</author>
<author><name sortKey="Rouse, Mn" uniqKey="Rouse M">MN Rouse</name>
</author>
<author><name sortKey="Trick, Hn" uniqKey="Trick H">HN Trick</name>
</author>
<author><name sortKey="Akhunov, E" uniqKey="Akhunov E">E Akhunov</name>
</author>
<author><name sortKey="Dubcovsky, J" uniqKey="Dubcovsky J">J Dubcovsky</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Sano, Y" uniqKey="Sano Y">Y Sano</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Sasaki, A" uniqKey="Sasaki A">A Sasaki</name>
</author>
<author><name sortKey="Ashikari, M" uniqKey="Ashikari M">M Ashikari</name>
</author>
<author><name sortKey="Ueguchi Tanaka, M" uniqKey="Ueguchi Tanaka M">M Ueguchi-Tanaka</name>
</author>
<author><name sortKey="Itoh, H" uniqKey="Itoh H">H Itoh</name>
</author>
<author><name sortKey="Nishimura, A" uniqKey="Nishimura A">A Nishimura</name>
</author>
<author><name sortKey="Swapan, D" uniqKey="Swapan D">D Swapan</name>
</author>
<author><name sortKey="Ishiyama, K" uniqKey="Ishiyama K">K Ishiyama</name>
</author>
<author><name sortKey="Saito, T" uniqKey="Saito T">T Saito</name>
</author>
<author><name sortKey="Kobayashi, M" uniqKey="Kobayashi M">M Kobayashi</name>
</author>
<author><name sortKey="Khush, Gs" uniqKey="Khush G">GS Khush</name>
</author>
<author><name sortKey="Kitano, H" uniqKey="Kitano H">H Kitano</name>
</author>
<author><name sortKey="Matsuoka, M" uniqKey="Matsuoka M">M Matsuoka</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Septiningsih, Em" uniqKey="Septiningsih E">EM Septiningsih</name>
</author>
<author><name sortKey="Trijatmiko, Kr" uniqKey="Trijatmiko K">KR Trijatmiko</name>
</author>
<author><name sortKey="Moeljopawiro, S" uniqKey="Moeljopawiro S">S Moeljopawiro</name>
</author>
<author><name sortKey="Mccouch, Sr" uniqKey="Mccouch S">SR McCouch</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Sonah, H" uniqKey="Sonah H">H Sonah</name>
</author>
<author><name sortKey="Bastien, M" uniqKey="Bastien M">M Bastien</name>
</author>
<author><name sortKey="Iquira, E" uniqKey="Iquira E">E Iquira</name>
</author>
<author><name sortKey="Tardivel, A" uniqKey="Tardivel A">A Tardivel</name>
</author>
<author><name sortKey="Legare, G" uniqKey="Legare G">G Légaré</name>
</author>
<author><name sortKey="Boyle, B" uniqKey="Boyle B">B Boyle</name>
</author>
<author><name sortKey="Normandeau, E" uniqKey="Normandeau E">É Normandeau</name>
</author>
<author><name sortKey="Laroche, J" uniqKey="Laroche J">J Laroche</name>
</author>
<author><name sortKey="Larose, S" uniqKey="Larose S">S Larose</name>
</author>
<author><name sortKey="Jean, M" uniqKey="Jean M">M Jean</name>
</author>
<author><name sortKey="Belzile, F" uniqKey="Belzile F">F Belzile</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Song, W Y" uniqKey="Song W">W-Y Song</name>
</author>
<author><name sortKey="Wang, G L" uniqKey="Wang G">G-L Wang</name>
</author>
<author><name sortKey="Chen, L L" uniqKey="Chen L">L-L Chen</name>
</author>
<author><name sortKey="Kim, H S" uniqKey="Kim H">H-S Kim</name>
</author>
<author><name sortKey="Pi, L Y" uniqKey="Pi L">L-Y Pi</name>
</author>
<author><name sortKey="Holsten, T" uniqKey="Holsten T">T Holsten</name>
</author>
<author><name sortKey="Gardner, J" uniqKey="Gardner J">J Gardner</name>
</author>
<author><name sortKey="Wang, B" uniqKey="Wang B">B Wang</name>
</author>
<author><name sortKey="Zhai, W X" uniqKey="Zhai W">W-X Zhai</name>
</author>
<author><name sortKey="Zhu, L H" uniqKey="Zhu L">L-H Zhu</name>
</author>
<author><name sortKey="Fauquet, C" uniqKey="Fauquet C">C Fauquet</name>
</author>
<author><name sortKey="Ronald, P" uniqKey="Ronald P">P Ronald</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Spindel, J" uniqKey="Spindel J">J Spindel</name>
</author>
<author><name sortKey="Wright, M" uniqKey="Wright M">M Wright</name>
</author>
<author><name sortKey="Chen, C" uniqKey="Chen C">C Chen</name>
</author>
<author><name sortKey="Cobb, J" uniqKey="Cobb J">J Cobb</name>
</author>
<author><name sortKey="Gage, J" uniqKey="Gage J">J Gage</name>
</author>
<author><name sortKey="Harrington, S" uniqKey="Harrington S">S Harrington</name>
</author>
<author><name sortKey="Lorieux, M" uniqKey="Lorieux M">M Lorieux</name>
</author>
<author><name sortKey="Ahmadi, N" uniqKey="Ahmadi N">N Ahmadi</name>
</author>
<author><name sortKey="Mccouch, S" uniqKey="Mccouch S">S McCouch</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Sweeney, Mt" uniqKey="Sweeney M">MT Sweeney</name>
</author>
<author><name sortKey="Thomson, Mj" uniqKey="Thomson M">MJ Thomson</name>
</author>
<author><name sortKey="Pfeil, Be" uniqKey="Pfeil B">BE Pfeil</name>
</author>
<author><name sortKey="Mccouch, S" uniqKey="Mccouch S">S McCouch</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Sweeney, Mt" uniqKey="Sweeney M">MT Sweeney</name>
</author>
<author><name sortKey="Thomson, Mj" uniqKey="Thomson M">MJ Thomson</name>
</author>
<author><name sortKey="Cho, Yg" uniqKey="Cho Y">YG Cho</name>
</author>
<author><name sortKey="Park, Yj" uniqKey="Park Y">YJ Park</name>
</author>
<author><name sortKey="Williamson, Sh" uniqKey="Williamson S">SH Williamson</name>
</author>
<author><name sortKey="Bustamante, Cd" uniqKey="Bustamante C">CD Bustamante</name>
</author>
<author><name sortKey="Mccouch, Sr" uniqKey="Mccouch S">SR McCouch</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Tadege, M" uniqKey="Tadege M">M Tadege</name>
</author>
<author><name sortKey="Sheldon, Cc" uniqKey="Sheldon C">CC Sheldon</name>
</author>
<author><name sortKey="Helliwell, Ca" uniqKey="Helliwell C">CA Helliwell</name>
</author>
<author><name sortKey="Upadhyaya, Nm" uniqKey="Upadhyaya N">NM Upadhyaya</name>
</author>
<author><name sortKey="Dennis, Es" uniqKey="Dennis E">ES Dennis</name>
</author>
<author><name sortKey="Peacock, Wj" uniqKey="Peacock W">WJ Peacock</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Takahashi, Y" uniqKey="Takahashi Y">Y Takahashi</name>
</author>
<author><name sortKey="Shomura, A" uniqKey="Shomura A">A Shomura</name>
</author>
<author><name sortKey="Sasaki, T" uniqKey="Sasaki T">T Sasaki</name>
</author>
<author><name sortKey="Yano, M" uniqKey="Yano M">M Yano</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Tanksley, Sd" uniqKey="Tanksley S">SD Tanksley</name>
</author>
<author><name sortKey="Mccouch, Sr" uniqKey="Mccouch S">SR McCouch</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Tanksley, Sd" uniqKey="Tanksley S">SD Tanksley</name>
</author>
<author><name sortKey="Nelson, Jc" uniqKey="Nelson J">JC Nelson</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Tester, M" uniqKey="Tester M">M Tester</name>
</author>
<author><name sortKey="Langridge, P" uniqKey="Langridge P">P Langridge</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Thomson, Mj" uniqKey="Thomson M">MJ Thomson</name>
</author>
<author><name sortKey="Tai, Th" uniqKey="Tai T">TH Tai</name>
</author>
<author><name sortKey="Mcclung, Am" uniqKey="Mcclung A">AM McClung</name>
</author>
<author><name sortKey="Lai, X H" uniqKey="Lai X">X-H Lai</name>
</author>
<author><name sortKey="Hinga, Me" uniqKey="Hinga M">ME Hinga</name>
</author>
<author><name sortKey="Lobos, Kb" uniqKey="Lobos K">KB Lobos</name>
</author>
<author><name sortKey="Xu, Y" uniqKey="Xu Y">Y Xu</name>
</author>
<author><name sortKey="Martinez, Cp" uniqKey="Martinez C">CP Martinez</name>
</author>
<author><name sortKey="Mccouch, Sr" uniqKey="Mccouch S">SR McCouch</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Thomson, Mj" uniqKey="Thomson M">MJ Thomson</name>
</author>
<author><name sortKey="Edwards, Jd" uniqKey="Edwards J">JD Edwards</name>
</author>
<author><name sortKey="Septiningsih, Em" uniqKey="Septiningsih E">EM Septiningsih</name>
</author>
<author><name sortKey="Harrington, Se" uniqKey="Harrington S">SE Harrington</name>
</author>
<author><name sortKey="Mccouch, Sr" uniqKey="Mccouch S">SR McCouch</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Tian, F" uniqKey="Tian F">F Tian</name>
</author>
<author><name sortKey="Li, D" uniqKey="Li D">D Li</name>
</author>
<author><name sortKey="Fu, Q" uniqKey="Fu Q">Q Fu</name>
</author>
<author><name sortKey="Zhu, Z" uniqKey="Zhu Z">Z Zhu</name>
</author>
<author><name sortKey="Fu, Y" uniqKey="Fu Y">Y Fu</name>
</author>
<author><name sortKey="Wang, X" uniqKey="Wang X">X Wang</name>
</author>
<author><name sortKey="Sun, C" uniqKey="Sun C">C Sun</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wang, Zy" uniqKey="Wang Z">ZY Wang</name>
</author>
<author><name sortKey="Second, G" uniqKey="Second G">G Second</name>
</author>
<author><name sortKey="Tanksley, Sd" uniqKey="Tanksley S">SD Tanksley</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Xiao, J" uniqKey="Xiao J">J Xiao</name>
</author>
<author><name sortKey="Li, J" uniqKey="Li J">J Li</name>
</author>
<author><name sortKey="Grandillo, S" uniqKey="Grandillo S">S Grandillo</name>
</author>
<author><name sortKey="Ahn, Sn" uniqKey="Ahn S">SN Ahn</name>
</author>
<author><name sortKey="Yuan, L" uniqKey="Yuan L">L Yuan</name>
</author>
<author><name sortKey="Tanksley, Sd" uniqKey="Tanksley S">SD Tanksley</name>
</author>
<author><name sortKey="Mccouch, Sr" uniqKey="Mccouch S">SR McCouch</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Xu, Y" uniqKey="Xu Y">Y Xu</name>
</author>
<author><name sortKey="Zhu, L" uniqKey="Zhu L">L Zhu</name>
</author>
<author><name sortKey="Xiao, J" uniqKey="Xiao J">J Xiao</name>
</author>
<author><name sortKey="Huang, N" uniqKey="Huang N">N Huang</name>
</author>
<author><name sortKey="Mccouch, Sr" uniqKey="Mccouch S">SR McCouch</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Xu, J" uniqKey="Xu J">J Xu</name>
</author>
<author><name sortKey="Zhao, Q" uniqKey="Zhao Q">Q Zhao</name>
</author>
<author><name sortKey="Du, P" uniqKey="Du P">P Du</name>
</author>
<author><name sortKey="Xu, C" uniqKey="Xu C">C Xu</name>
</author>
<author><name sortKey="Wang, B" uniqKey="Wang B">B Wang</name>
</author>
<author><name sortKey="Feng, Q" uniqKey="Feng Q">Q Feng</name>
</author>
<author><name sortKey="Liu, Q" uniqKey="Liu Q">Q Liu</name>
</author>
<author><name sortKey="Tang, S" uniqKey="Tang S">S Tang</name>
</author>
<author><name sortKey="Gu, M" uniqKey="Gu M">M Gu</name>
</author>
<author><name sortKey="Han, B" uniqKey="Han B">B Han</name>
</author>
<author><name sortKey="Liang, G" uniqKey="Liang G">G Liang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Yano, M" uniqKey="Yano M">M Yano</name>
</author>
<author><name sortKey="Katayose, Y" uniqKey="Katayose Y">Y Katayose</name>
</author>
<author><name sortKey="Ashikari, M" uniqKey="Ashikari M">M Ashikari</name>
</author>
<author><name sortKey="Yamanouchi, U" uniqKey="Yamanouchi U">U Yamanouchi</name>
</author>
<author><name sortKey="Monna, L" uniqKey="Monna L">L Monna</name>
</author>
<author><name sortKey="Fuse, T" uniqKey="Fuse T">T Fuse</name>
</author>
<author><name sortKey="Baba, T" uniqKey="Baba T">T Baba</name>
</author>
<author><name sortKey="Yamamoto, K" uniqKey="Yamamoto K">K Yamamoto</name>
</author>
<author><name sortKey="Umehara, Y" uniqKey="Umehara Y">Y Umehara</name>
</author>
<author><name sortKey="Nagamura, Y" uniqKey="Nagamura Y">Y Nagamura</name>
</author>
<author><name sortKey="Sasaki, T" uniqKey="Sasaki T">T Sasaki</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Zamir, D" uniqKey="Zamir D">D Zamir</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Zhu, Q" uniqKey="Zhu Q">Q Zhu</name>
</author>
<author><name sortKey="Ge, S" uniqKey="Ge S">S Ge</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Zhu, T" uniqKey="Zhu T">T Zhu</name>
</author>
<author><name sortKey="Xu, P Z" uniqKey="Xu P">P-Z Xu</name>
</author>
<author><name sortKey="Liu, J P" uniqKey="Liu J">J-P Liu</name>
</author>
<author><name sortKey="Peng, S" uniqKey="Peng S">S Peng</name>
</author>
<author><name sortKey="Mo, X C" uniqKey="Mo X">X-C Mo</name>
</author>
<author><name sortKey="Gao, L Z" uniqKey="Gao L">L-Z Gao</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article"><pmc-dir>properties open_access</pmc-dir>
<front><journal-meta><journal-id journal-id-type="nlm-ta">Mol Breed</journal-id>
<journal-id journal-id-type="iso-abbrev">Mol. Breed</journal-id>
<journal-title-group><journal-title>Molecular Breeding</journal-title>
</journal-title-group>
<issn pub-type="ppub">1380-3743</issn>
<issn pub-type="epub">1572-9788</issn>
<publisher><publisher-name>Springer Netherlands</publisher-name>
<publisher-loc>Dordrecht</publisher-loc>
</publisher>
</journal-meta>
<article-meta><article-id pub-id-type="pmid">25705117</article-id>
<article-id pub-id-type="pmc">4328105</article-id>
<article-id pub-id-type="publisher-id">276</article-id>
<article-id pub-id-type="doi">10.1007/s11032-015-0276-7</article-id>
<article-categories><subj-group subj-group-type="heading"><subject>Article</subject>
</subj-group>
</article-categories>
<title-group><article-title>Development and GBS-genotyping of introgression lines (ILs) using two wild species of rice, <italic>O. meridionalis</italic>
and <italic>O. rufipogon,</italic>
in a common recurrent parent, <italic>O.</italic>
<italic>sativa</italic>
cv. Curinga</article-title>
</title-group>
<contrib-group><contrib contrib-type="author"><name><surname>Arbelaez</surname>
<given-names>Juan D.</given-names>
</name>
<xref ref-type="aff" rid="Aff1"></xref>
</contrib>
<contrib contrib-type="author"><name><surname>Moreno</surname>
<given-names>Laura T.</given-names>
</name>
<xref ref-type="aff" rid="Aff2"></xref>
</contrib>
<contrib contrib-type="author"><name><surname>Singh</surname>
<given-names>Namrata</given-names>
</name>
<xref ref-type="aff" rid="Aff1"></xref>
</contrib>
<contrib contrib-type="author"><name><surname>Tung</surname>
<given-names>Chih-Wei</given-names>
</name>
<xref ref-type="aff" rid="Aff3"></xref>
</contrib>
<contrib contrib-type="author"><name><surname>Maron</surname>
<given-names>Lyza G.</given-names>
</name>
<xref ref-type="aff" rid="Aff1"></xref>
</contrib>
<contrib contrib-type="author"><name><surname>Ospina</surname>
<given-names>Yolima</given-names>
</name>
<xref ref-type="aff" rid="Aff4"></xref>
</contrib>
<contrib contrib-type="author"><name><surname>Martinez</surname>
<given-names>César P.</given-names>
</name>
<xref ref-type="aff" rid="Aff4"></xref>
</contrib>
<contrib contrib-type="author"><name><surname>Grenier</surname>
<given-names>Cécile</given-names>
</name>
<xref ref-type="aff" rid="Aff5"></xref>
</contrib>
<contrib contrib-type="author"><name><surname>Lorieux</surname>
<given-names>Mathias</given-names>
</name>
<xref ref-type="aff" rid="Aff6"></xref>
<xref ref-type="aff" rid="Aff7"></xref>
</contrib>
<contrib contrib-type="author" corresp="yes"><name><surname>McCouch</surname>
<given-names>Susan</given-names>
</name>
<address><phone>+1 (607) 255-0420</phone>
<email>srm4@cornell.edu</email>
</address>
<xref ref-type="aff" rid="Aff1"></xref>
</contrib>
<aff id="Aff1"><label></label>
Department of Plant Breeding and Genetics, Cornell University, 162 Emerson Hall, Ithaca, NY 14853-1901 USA</aff>
<aff id="Aff2"><label></label>
School of Botany, The University of Melbourne, Parkville, VIC 3010 Australia</aff>
<aff id="Aff3"><label></label>
Department of Agronomy, National Taiwan University, No. 1, Section 4, Roosevelt Road, Taipei, 106 Taiwan</aff>
<aff id="Aff4"><label></label>
Rice Program, International Center for Tropical Agriculture (CIAT), AA6713 Cali, Colombia</aff>
<aff id="Aff5"><label></label>
CIRAD-AGAP 34394, Montpellier Cedex 5, France</aff>
<aff id="Aff6"><label></label>
DIADE Research Unit, Institut de Recherche Pour le Développement, 34394 Montpellier Cedex 5, France</aff>
<aff id="Aff7"><label></label>
Rice Genetics and Genomics Laboratory, International Center for Tropical Agriculture (CIAT), AA6713 Cali, Colombia</aff>
</contrib-group>
<pub-date pub-type="epub"><day>14</day>
<month>2</month>
<year>2015</year>
</pub-date>
<pub-date pub-type="pmc-release"><day>14</day>
<month>2</month>
<year>2015</year>
</pub-date>
<pub-date pub-type="ppub"><year>2015</year>
</pub-date>
<volume>35</volume>
<issue>2</issue>
<elocation-id>81</elocation-id>
<history><date date-type="received"><day>22</day>
<month>8</month>
<year>2014</year>
</date>
<date date-type="accepted"><day>29</day>
<month>1</month>
<year>2015</year>
</date>
</history>
<permissions><copyright-statement>© The Author(s) 2015</copyright-statement>
<license license-type="OpenAccess"><license-p><bold>Open Access</bold>
This article is distributed under the terms of the Creative Commons Attribution License which permits any use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited.</license-p>
</license>
</permissions>
<abstract id="Abs1"><p>Two populations of interspecific introgression lines (ILs) in a common recurrent parent were developed for use in pre-breeding and QTL mapping. The ILs were derived from crosses between cv Curinga, a <italic>tropical japonica</italic>
upland cultivar, and two different wild donors, <italic>Oryza meridionalis</italic>
Ng. accession (W2112) and <italic>Oryza rufipogon</italic>
Griff. accession (IRGC 105491). The lines were genotyped using genotyping-by-sequencing (GBS) and SSRs. The 32 Curinga/<italic>O. meridionalis</italic>
ILs contain 76.73 % of the donor genome in individual introgressed segments, and each line has an average of 94.9 % recurrent parent genome. The 48 Curinga/<italic>O. rufipogon</italic>
ILs collectively contain 97.6 % of the donor genome with an average of 89.9 % recurrent parent genome per line. To confirm that these populations were segregating for traits of interest, they were phenotyped for pericarp color in the greenhouse and for four agronomic traits—days to flowering, plant height, number of tillers, and number of panicles—in an upland field environment. Seeds from these IL libraries and the accompanying GBS datasets are publicly available and represent valuable genetic resources for exploring the genetics and breeding potential of rice wild relatives.</p>
<sec><title>Electronic supplementary material</title>
<p>The online version of this article (doi:10.1007/s11032-015-0276-7) contains supplementary material, which is available to authorized users.</p>
</sec>
</abstract>
<kwd-group xml:lang="en"><title>Keywords</title>
<kwd>Rice</kwd>
<kwd><italic>Oryza sativa</italic>
</kwd>
<kwd>Crop wild relatives</kwd>
<kwd>Chromosome segment substitution lines (CSSLs)</kwd>
<kwd>Allele discovery</kwd>
<kwd>Marker-assisted selection (MAS)</kwd>
<kwd>Genotyping by sequencing (GBS)</kwd>
</kwd-group>
<custom-meta-group><custom-meta><meta-name>issue-copyright-statement</meta-name>
<meta-value>© Springer Science+Business Media Dordrecht 2015</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body><sec id="Sec1" sec-type="intro"><title>Introduction</title>
<p>Asian rice (<italic>Oryza sativa</italic>
L.) is the staple crop for 3 billion people around the world (Food and Agricultural Organization <xref ref-type="bibr" rid="CR19">2003</xref>
; Bouman et al. <xref ref-type="bibr" rid="CR6">2007</xref>
). To meet the growing demand for food driven by population growth and economic development, global rice production must double by 2050 (Ray et al. <xref ref-type="bibr" rid="CR64">2013</xref>
). Much of this increase is expected to come from new crop varieties that are high yielding, resource-use efficient and resistant to diseases, insects and abiotic stresses, problems that are exacerbated by climate volatility (Godfray et al. <xref ref-type="bibr" rid="CR22">2010</xref>
; Tester and Langridge <xref ref-type="bibr" rid="CR82">2010</xref>
). Genetic variation is the raw material used by plant breeders to improve traits and characteristics of interest for producers and consumers (Asíns <xref ref-type="bibr" rid="CR5">2002</xref>
). While intensive breeding for modern, high-yielding varieties has globally reduced the genetic diversity of crops in farmers’ fields, there is still abundant natural variation in landraces and crop wild relatives conserved in national and international gene banks that can be tapped to accelerate crop improvement for the future (Asano et al. <xref ref-type="bibr" rid="CR4">2011</xref>
; Gao et al. <xref ref-type="bibr" rid="CR20">2006</xref>
; Lorieux et al. <xref ref-type="bibr" rid="CR48">2004</xref>
; McCouch et al. <xref ref-type="bibr" rid="CR56">2013</xref>
).</p>
<p>Wild relatives of rice are of particular interest as donors of genetic variation because they contain a variety of traits and trait complexes that were eliminated from the cultivated gene pools during the early phases of crop domestication. Wild genetic diversity is most effectively tapped for crop improvement through the creation of interspecific populations via backcrossing with a well-adapted and productive cultivar—a practice that is often termed ‘pre-breeding’. Yet this process is labor and time-consuming and typically fraught with difficulties due to incompatibility barriers, limited recombination, and linkage drag, all of which limit the ease of identifying, transferring, and utilizing beneficial wild alleles in crop improvement (Lorieux et al. <xref ref-type="bibr" rid="CR48">2004</xref>
; Brar and Khush <xref ref-type="bibr" rid="CR8">1997</xref>
; Tanksley and McCouch <xref ref-type="bibr" rid="CR80">1997</xref>
).</p>
<p>The use of DNA-marker technology has greatly accelerated the development of pre-breeding populations and facilitated the targeted introduction of useful variation into elite breeding backgrounds. It has also enabled dissection of quantitative trait locus (QTL) and the discovery of wild alleles underlying traits of agronomic importance (Wang et al. <xref ref-type="bibr" rid="CR86">1992</xref>
; Song et al. <xref ref-type="bibr" rid="CR74">1995</xref>
; Zamir <xref ref-type="bibr" rid="CR92">2001</xref>
; Collard and Mackill <xref ref-type="bibr" rid="CR12">2008</xref>
; Chin et al. <xref ref-type="bibr" rid="CR11">2011</xref>
; Periyannan et al. <xref ref-type="bibr" rid="CR63">2013</xref>
; Saintenac et al. <xref ref-type="bibr" rid="CR68">2013</xref>
). Recent developments in next generation sequencing, including the use of reduced representation libraries in genotyping by sequencing (GBS), have further reduced the cost and increased the resolution and throughput of trait mapping and marker-assisted breeding, making it faster and easier to genetically characterize and select lines with favorable wild alleles for use in breeding.</p>
<p>Advanced backcross populations, such as near-isogenic lines (NILs) (Inukai et al. <xref ref-type="bibr" rid="CR31">1996</xref>
; Takahashi et al. <xref ref-type="bibr" rid="CR79">2001</xref>
; Maas et al. <xref ref-type="bibr" rid="CR50">2010</xref>
; Imai et al. <xref ref-type="bibr" rid="CR30">2013</xref>
), Introgression Lines (ILs) (Thomson et al. <xref ref-type="bibr" rid="CR83">2003</xref>
, <xref ref-type="bibr" rid="CR84">2006</xref>
; Tian et al. <xref ref-type="bibr" rid="CR85">2006</xref>
; Gutierrez et al. <xref ref-type="bibr" rid="CR26">2010</xref>
; Ogawa et al. <xref ref-type="bibr" rid="CR59">2014</xref>
), and chromosome segment substitution lines (CSSLs) (Kubo et al. <xref ref-type="bibr" rid="CR38">2002</xref>
; Ebitani et al. <xref ref-type="bibr" rid="CR17">2005</xref>
; Ando et al. <xref ref-type="bibr" rid="CR3">2008</xref>
; Ali et al. <xref ref-type="bibr" rid="CR2">2010</xref>
; Xu et al. <xref ref-type="bibr" rid="CR89">2010</xref>
) are commonly used when working with intra and interspecific crosses of rice. In these materials, small chromosomal segments containing alleles from a wild donor parent are systematically introduced into a cultivated genetic background using marker-assisted selection (MAS). Each line contains only one or few well-defined introgressions in an adapted, recurrent parent (RP) background. This is advantageous so the effect of individual wild alleles can be determined in the genetic background of a commercially acceptable variety (Tanksley and Nelson <xref ref-type="bibr" rid="CR81">1996</xref>
; Kubo et al. <xref ref-type="bibr" rid="CR38">2002</xref>
; Ebitani et al. <xref ref-type="bibr" rid="CR17">2005</xref>
; Kanbe et al. <xref ref-type="bibr" rid="CR32">2008</xref>
; Ali et al. <xref ref-type="bibr" rid="CR2">2010</xref>
; Gutierrez et al. <xref ref-type="bibr" rid="CR26">2010</xref>
). In addition, when fixed lines are used for evaluation, identical genotypes can be evaluated repeatedly in different seasons and environments to improve the accuracy of QTL detection (Liu et al. <xref ref-type="bibr" rid="CR44">2008</xref>
). ILs can also be used to rapidly develop secondary F<sub>2</sub>
populations for fine mapping and positional cloning of interesting genes and QTL (Yano et al. <xref ref-type="bibr" rid="CR90">2000</xref>
).</p>
<p>The two wild species used as donors in this study, <italic>O. meridionalis</italic>
Ng. and <italic>O. rufipogon</italic>
Griff., both carry the AA genome and are cross-compatible, but are estimated to have diverged approximately 2 million years ago (Park et al. <xref ref-type="bibr" rid="CR62">2003</xref>
; Ren et al. <xref ref-type="bibr" rid="CR65">2003</xref>
; Zhu and Ge <xref ref-type="bibr" rid="CR93">2005</xref>
). <italic>O. meridionalis</italic>
is considered to be the basal lineage of the AA genome species and is the most divergent with respect to cultivated Asian rice, <italic>O. sativa</italic>
(Zhu et al. <xref ref-type="bibr" rid="CR94">2014</xref>
). In contrast, <italic>O. rufipogon</italic>
is considered to be the immediate ancestor of <italic>O. sativa. O. meridionalis</italic>
is native to Australia and some regions of West Papua and Indonesia (Ng et al. <xref ref-type="bibr" rid="CR58">1981</xref>
; Lu and Silitonga <xref ref-type="bibr" rid="CR49">1999</xref>
), while <italic>O. rufipogon</italic>
is found throughout tropical mainland and South East Asia.</p>
<p>In this study, we apply marker-assisted backcrossing (MABC) to develop two sets of advanced backcross ILs by crossing an <italic>O. meridionalis</italic>
accession, W2112, hereafter referred to as <italic>MER</italic>
, and an <italic>O. rufipogon</italic>
accession, IRGC 105491, hereafter referred to as <italic>RUF</italic>
, with a <italic>tropical japonica</italic>
cultivar from Brazil, cv Curinga, hereafter referred to as <italic>CUR</italic>
(de Morais et al. <xref ref-type="bibr" rid="CR13">2005</xref>
). Few attempts to develop pre-breeding materials utilizing <italic>MER</italic>
as a donor have been reported (Yoshimura et al. <xref ref-type="bibr" rid="CR91">2010</xref>
; Doi et al. <xref ref-type="bibr" rid="CR15">2003</xref>
), while <italic>RUF</italic>
has been used in several previous QTL and pre-breeding studies and is known to carry favorable alleles for yield and yield components (Xiao et al. <xref ref-type="bibr" rid="CR87">1998</xref>
; Moncada et al. <xref ref-type="bibr" rid="CR57">2001</xref>
; Thomson et al. <xref ref-type="bibr" rid="CR83">2003</xref>
; Septiningsih et al. <xref ref-type="bibr" rid="CR72">2003</xref>
; Marri et al. <xref ref-type="bibr" rid="CR51">2005</xref>
; McCouch et al. <xref ref-type="bibr" rid="CR55">2007</xref>
; Imai et al. <xref ref-type="bibr" rid="CR30">2013</xref>
).</p>
<p>We demonstrated the usefulness and versatility of these ILs for genetic mapping and as pre-breeding germplasm by evaluating their segregation for one Mendelian trait, red pericarp, and four quantitative traits, flowering time, plant height, tiller number and panicle number, based on greenhouse and field studies. Red pericarp is a highly heritable trait, regulated by the <italic>RC</italic>
gene (Sweeney et al. <xref ref-type="bibr" rid="CR76">2006</xref>
). A 14-bp deletion in the sixth exon of <italic>RC</italic>
is the most common mutation leading to white pericarp. The functional version of <italic>RC</italic>
is found in virtually all wild rice and confers both red grain color and seed dormancy. While both traits were selected against during rice domestication, some degree of dormancy is still important in white pericarp cultivars where pre-harvest sprouting may otherwise become a problem (Gu et al. <xref ref-type="bibr" rid="CR23">2011</xref>
). More recently, cultivated red rice varieties, such as the Buthanece Red, Thai Red Cargo and the French Camargue Red Rice, have sought to bring back the health benefits associated with pigmented pericarp, while avoiding the problems associated with excessive degrees of dormancy. These varieties have the potential to be commercialized in the rice specialty varieties market.</p>
<p>We also evaluated the collection of <italic>CUR/RUF</italic>
introgression lines for four agronomic traits, flowering time, plant height, tiller number, and panicle number, under upland field conditions. Rice grown in the upland farming system constitutes only 12 % of the total area planted on a global basis, but in Latin America, it accounts for 45 % of rice area, with 69.6 % of rice in Brazil and 23 % in Colombia grown as a dry land crop (Moncada et al. <xref ref-type="bibr" rid="CR57">2001</xref>
). Many upland soils are highly acidic, making it necessary to breed for acid soil tolerance as well as yield potential for these systems. We were interested to determine whether particular <italic>O. rufipogon</italic>
-derived alleles might confer positive effects in the <italic>CUR</italic>
genetic background for the four traits of interest, and to determine the effect of the introgressions in soils that were naturally acidic (pH < 5.0) and in soils that were limed (pH > 5.0).</p>
</sec>
<sec id="Sec2" sec-type="materials|methods"><title>Materials and methods</title>
<sec id="Sec3"><title>Plant materials</title>
<p>The common recurrent parent Curinga (<italic>O. sativa ssp. tropical japonica</italic>
) (<italic>CUR</italic>
) is a commercial rice variety released in 2005, developed by the Empresa Brasileira de Pesquisa Agropecuária (EMBRAPA, Goiania, Brazil) (de Morais et al. <xref ref-type="bibr" rid="CR13">2005</xref>
). It is a semi-early maturing, drought-tolerant cultivar with an average yield under upland conditions of 4,465 kg/ha. This cultivar is characterized by long fine grains with good whole kernel yields, resistance to rice blast and leaf scald, tolerance to acid soils and drought conditions (de Morais et al. <xref ref-type="bibr" rid="CR13">2005</xref>
). The wild donor parent, <italic>O. meridionalis</italic>
Ng, acc. W2112 (<italic>MER</italic>
) (Oryzabase: <ext-link ext-link-type="uri" xlink:href="http://www.shigen.nig.ac.jp/rice/oryzabaseV4/">http://www.shigen.nig.ac.jp/rice/oryzabaseV4/</ext-link>
) was collected in Cooktown, Australia, by Gérard Second, IRD, Montpellier. It shows strong dormancy, seed shattering, photoperiod sensitivity and good tillering proliferation (results not shown). The wild donor <italic>O. rufipogon</italic>
Griff. acc. IRGC 105491 (<italic>RUF</italic>
) (International Rice Research Institute, IRRI; <ext-link ext-link-type="uri" xlink:href="http://www.irgcis.irri.org:81/grc/IRGCISHome.html">http://www.irgcis.irri.org:81/grc/IRGCISHome.html</ext-link>
) was collected in Kelantan, Malaysia. This wild accession shows high seedling vigor, good germination rates, good tiller proliferation, and upright grow habit (results not shown). Hereafter, the Curinga × <italic>O. meridionalis</italic>
population will be referred to as <italic>CUR/MER</italic>
and the Curinga × <italic>O. rufipogon</italic>
population will be referred to as <italic>CUR/RUF</italic>
.</p>
</sec>
<sec id="Sec4"><title>Linkage map construction</title>
<p>Two genetic maps were developed using 110 BC<sub>1</sub>
F<sub>1</sub>
<italic>CUR/MER</italic>
plants genotyped with 122 simple sequence repeat markers (SSR), and 80 BC<sub>1</sub>
F<sub>1</sub>
<italic>CUR/RUF</italic>
plants genotyped with 131 SSR markers (Orjuela et al. <xref ref-type="bibr" rid="CR60">2009</xref>
). The genetic linkage maps were generated using the software MapDisto v.1.7.5 (Lorieux <xref ref-type="bibr" rid="CR46">2012</xref>
; <ext-link ext-link-type="uri" xlink:href="http://mapdisto.free.fr/MapDisto/">http://mapdisto.free.fr/MapDisto/</ext-link>
). Markers were placed into linkage groups using a logarithm of odds (LOD) probability that two markers are linked versus non-linked of 3.0 and a maximum recombination fraction (<italic>r</italic>
<sub>max</sub>
) of 0.3. Marker order in linkage groups was determined using a combination of the ‘Order,’ ‘Ripple’ and ‘Check inversions’ commands. Data errors were then corrected using the ‘Color Genotypes’ module in MapDisto. Recombination fractions were transformed to estimate map distance using the Kosambi mapping function (Kosambi <xref ref-type="bibr" rid="CR37">1943</xref>
; Lorieux <xref ref-type="bibr" rid="CR46">2012</xref>
). A Chi-square test (<italic>χ</italic>
<sup>2</sup>
) was carried out for each marker to test deviations of genotypic classes from the expected Mendelian inheritance ratios of 1:1 (<italic>p</italic>
< 0.01). The ‘Compare maps’ command was used to graphically compare colinearity between the generated linkage maps with physical distances from the Michigan State University (MSU) version 7 Rice Genome assembly (<ext-link ext-link-type="uri" xlink:href="http://rice.plantbiology.msu.edu/">http://rice.plantbiology.msu.edu/</ext-link>
).</p>
</sec>
<sec id="Sec5"><title>Development of introgression lines (ILs)</title>
<p>Using marker-assisted backcrossing (MABC) two IL libraries were developed. Fixed lines were selected after three rounds of MABC and one generation of double haploidization (DH) using anther culture (Lentini et al. <xref ref-type="bibr" rid="CR39">1995</xref>
) (Online resource 1). A set of 32 and 48 fixed lines were selected to comprise the <italic>CUR/MER</italic>
and <italic>CUR/RUF</italic>
populations, respectively. Between each crossing cycle (Sarkarung <xref ref-type="bibr" rid="CR70">1991</xref>
), SSRs (McCouch et al. <xref ref-type="bibr" rid="CR54">2002</xref>
, <ext-link ext-link-type="uri" xlink:href="http://www.gramene.org">http://www.gramene.org</ext-link>
) comprising the Universal Core Genetic Map (UCGM) (Orjuela et al. <xref ref-type="bibr" rid="CR60">2009</xref>
) and transposable-element-based (TE) indel markers were used to perform foreground and background selection (Hospital et al. <xref ref-type="bibr" rid="CR29">1997</xref>
). In total, 32 <italic>CUR/MER</italic>
lines were genotyped with 122 SSRs and nine TE-based markers and 48 <italic>CUR/RUF</italic>
lines were screened with 131 SSRs as the basis for selecting the IL libraries. Separate sets of markers were used on the two populations due to differences in polymorphism between the parents. Genotypic selection was implemented using CSSL Finder v. 0.9 (Lorieux <xref ref-type="bibr" rid="CR45">2005</xref>
; <ext-link ext-link-type="uri" xlink:href="http://mapdisto.free.fr/CSSLFinder/">http://mapdisto.free.fr/CSSLFinder/</ext-link>
) which enables selecting the minimum set of lines to cover the entire donor genome with a desired number and size of included introgressions, small overlaps between consecutive introgressed fragments, and minimal background genome recovery. Genotyping by sequencing (GBS, Elshire et al. <xref ref-type="bibr" rid="CR18">2011</xref>
) was conducted in the final generation (BC<sub>3</sub>
F<sub>1</sub>
-DH).</p>
</sec>
<sec id="Sec6"><title>Double haploid protocol</title>
<p>DH plants were generated as described by Lentini et al. (<xref ref-type="bibr" rid="CR39">1995</xref>
). Seeds were sown in germination trays and grown in the greenhouse for 20–25 days. Seedlings were then transplanted to the field and space-planted at 30 × 40 cm between plants and rows, and grown under standard flooded (paddy) conditions. At booting stage (~60–70 days after sowing, depending on the genotype), when only 5–8 cm of the emerging panicle (boot) was visible above the sheath, 3–5 immature panicles (still wrapped in the sheath) were harvested from each plant and kept in polyethylene bags in the dark for 7 days at 10 ± 2 °C before culturing.</p>
<p>Panicles were surfaced-sterilized using sterile distilled water and 70 % ethanol. Spikelets from the second third of the panicle were then removed from the sheath leaf, soaked for 3 min in 10 % commercial bleach (5.25 % NaOCl), mixed with three drops of Tween 80, and rinsed with sterile distilled water. Each flower was cut at the base, at the anther filament, and grouped into clusters of 10–15 cut flowers. Each cluster was picked with forceps, and the anthers were released by tapping the forceps on the edge of the culture jar (7 cm high × 4 cm diameter). For each jar, ~250 anthers per 10 ml of liquid callus induction medium were cultured. Jars were sealed with Magenta-B caps and kept in the dark at 25 ± 1 °C during 4–6 weeks. Ten embryogenic calli of approximately 1–2 mm in diameter were transferred onto 60 ml regeneration medium contained in 12 cm high × 9 cm diameter glass jars. Jars were sealed with a plastic cap and placed under indirect light for one week and then moved to 80 µE/m<sup>2</sup>
/s and 16 h photoperiod. Temperature was kept steady at 25 ± 1 °C. After 4–6 weeks, green regenerated plants with fully developed roots were transplanted to sterile soil in the greenhouse for 3–4 weeks and then moved to the field. Haploid, DH or diploid, and polyploid plants were identified by evaluating plant morphology and fertility. The type-A basal callus induction media, and the components and quantities of plant regeneration media used to generate the DH plants were as described by Lentini et al. (<xref ref-type="bibr" rid="CR39">1995</xref>
).</p>
</sec>
<sec id="Sec7"><title>SSR marker analysis</title>
<p>Fresh leaf tissue was collected during each generation, and genomic DNA was extracted using a CTAB protocol described by Romero et al. (<xref ref-type="bibr" rid="CR67">2014</xref>
). DNA concentration and quality were evaluated on 0.8 % agarose gels stained with ethidium bromide. The two subsets of SSR from the UCGM set were used in genotyping. Polymerase chain reactions (PCR) were performed using 20 ng of DNA as template, 100 mM Tris–HCL, 500 mM KCL, 0.1 % Triton X-100, 2 ng/µl MgCl<sub>2</sub>
(25 µm), 0.3 µM of each dNTP and primer, and 1 U of <italic>Taq</italic>
DNA polymerase. The reactants were initially denaturated at 94 °C for 3 min, followed by 30 cycles at 94 °C for 30 s, 30 cycles at 50–67 °C (depending on annealing temperature of each primer pair) for 45 s, 72 °C for 1 min, and a final extension at 72 °C for 5 min. PCR amplified fragments were analyzed using 4 % agarose gels stained with ethidium bromide or 6 % denaturing acrylamide gels stained with silver staining (Panaud et al. <xref ref-type="bibr" rid="CR61">1996</xref>
).</p>
</sec>
<sec id="Sec8"><title>GBS library preparation and data analysis</title>
<p>Total genomic DNA was extracted from each IL and parents using the Qiagen DNeasy kit (<ext-link ext-link-type="uri" xlink:href="http://www.qiagen.com/">http://www.qiagen.com/</ext-link>
). 96-plex libraries were prepared according to Elshire et al. (<xref ref-type="bibr" rid="CR18">2011</xref>
). A custom-designed pipeline described by Spindel et al. (<xref ref-type="bibr" rid="CR75">2013</xref>
) that combines the built-in TASSEL (Bradbury et al. <xref ref-type="bibr" rid="CR7">2007</xref>
; <ext-link ext-link-type="uri" xlink:href="http://www.maizegenetics.net/#!tassel/c17q9">http://www.maizegenetics.net/#!tassel/c17q9</ext-link>
) SNP caller and the sequence aligner algorithm from PANATI with the genotype imputation algorithm GBS-PLAID-2 was used for data analysis.</p>
</sec>
<sec id="Sec9"><title>Custom Infinium 6K SNP assay and data analysis</title>
<p>GBS single-nucleotide polymorphism (SNP) calls were confirmed using a custom-designed Infinium HD SNP Assay (M. Wright, Cornell University, pers. comm.; <ext-link ext-link-type="uri" xlink:href="http://www.illumina.com">http://www.illumina.com</ext-link>
) that detected 1,092 segregating SNPs in the <italic>CUR/MER</italic>
and 1,769 in the <italic>CUR/RUF</italic>
populations using the same DNA extracted for GBS assays. The 6K Infinium assay required 750 ng—1 µg of high molecular weight DNA. The DNA was isothermally amplified overnight and a controlled enzyme process fragmented the amplified product. The fragmented DNA was alcohol precipitated and resuspended for hybridization. The BeadChip was prepared for hybridization in a capillary flow-through chamber to which the amplified-fragmented DNA samples was applied and incubated overnight. During the hybridization step, the DNA annealed to locus-specific SNP markers (50-mers) and the allele specificity was conferred by base extension. The products were fluorescently labeled and intensity was detected and recorded by the Illumina BeadArray reader. Illumina’s genome studio software was used for analyzing the genotype calls. Graphical genotypes were drawn using CSSL Finder v.0.9 (Lorieux <xref ref-type="bibr" rid="CR45">2005</xref>
).</p>
</sec>
<sec id="Sec10"><title>Genetic analysis of pericarp color</title>
<p>Five grains from each of the parents, <italic>CUR, MER, RUF,</italic>
and each IL were de-hulled, photographed and visually scored for pericarp color. Each phenotyped seed was coded 1 = pigmented pericarp, or 0 = white pericarp. Two ILs from the <italic>CUR/MER</italic>
and 7 ILs from the <italic>CUR/RUF</italic>
populations carried the red pericarp and were used to determine whether the <italic>RC</italic>
gene was responsible for the trait. A functional indel marker designed by Sweeney et al. (<xref ref-type="bibr" rid="CR76">2006</xref>
) was used to amplify the 14-bp insertion/deletion in the <italic>RC</italic>
gene (LOC_Os07g11020.1) responsible for white pericarp (forward primer: CTTGCCAGTTTCAGAGAAATCA; reverse primer: CTCTTTCAGCACATGGTTGG). PCR products were amplified from the parents, the 9 ILs with red pericarp, 8 ILs with white pericarp (selected at random from the 71 white seeded ILs), and control white-pericarp varieties, IR64 (ssp <italic>indica</italic>
) and Azucena (ssp <italic>tropical japonica</italic>
). PCR products were visualized using a 4 % agarose gel stained with SYBR<sup>®</sup>
Safe (<ext-link ext-link-type="uri" xlink:href="http://www.lifetechnologies.com/">http://www.lifetechnologies.com/</ext-link>
), as described by Sweeney et al. (<xref ref-type="bibr" rid="CR77">2007</xref>
).</p>
</sec>
<sec id="Sec11"><title>Upland field evaluation of <italic>CUR/RUF</italic>
ILs</title>
<p>The recurrent parent, <italic>CUR</italic>
, 48 ILs from <italic>CUR/RUF</italic>
population, and 15 elite local checks from the CIAT/CIRAD (International Center for Tropical Agriculture/Centre de Cooperation Internationale en Research Agronomique) upland rice program were evaluated under upland conditions using two different agronomic practices; natural soil conditions (pH < 5.0) and limed soil conditions (pH > 5.0), at the experimental field station ‘La Libertad ICA’ (latitude 4°3′40. 63″N, longitude 73°27′46. 25″W) in Meta, Colombia during Summer 2012. (Note: the <italic>RUF</italic>
donor parent could not be grown in the field due to its classification as a noxious weed. The <italic>CUR/MER</italic>
population was not evaluated in the field because seeds were not available at that time) An alpha lattice design with two replications was used to evaluate the 64 lines distributed in eight blocks, under two treatments: (1) acid soil (pH levels < 5 and aluminum saturation over 75 %), occur under natural conditions in Meta, and (2) lime treated soil, where soil was amended with 3 tons/ha of calcium carbonate (CaCO<sub>3</sub>
) before planting (Online Resource 2a). Planting was implemented using a six-row planter with a sowing density of 1 g of seed per linear meter. The plot size was 3 m wide with two rows per plot, spaced 26 cm between rows. Fertilizer was applied in two stages. Before planting 80 kg/ha of DAP (NH<sub>4</sub>
)<sub>2</sub>
HPO<sub>4</sub>
, 80 kg/ha of KCl (K<sub>2</sub>
O), 12 kg/ha of Zn, and 75 kg/ha of kieserite (MgSO<sub>4</sub>
·H<sub>2</sub>
O) were applied. After planting one application of 40 kg/ha of KCl and three applications of 26.6 kg/ha of urea were added. Weed control was done by applying a post-emergence herbicide, Butaclor 3 L/ha, and Bentazol at 3 L/ha plus manual weeding. The fungicide Bim was applied throughout the vegetative cycle as a preventive disease-control measure.</p>
<p>For phenotyping, one linear meter around the center of each plot was marked and plants within that area were harvested. Four agronomic traits: flowering time, plant height, number of tillers, and number of panicles, were evaluated under both treatments. ‘Flowering time’ was scored as the number of days from planting until 50 % of the plants in the plot have emerged panicles. ‘Plant height’ was measured using a ruler, as the average length in centimeters from five random tillers in the linear meter from the base of the plant to the tip of the panicle. ‘Number of tillers’ was defined as the number of tillers from one linear meter harvested from the middle of the plot. ‘Number of panicles’ was defined as the number of panicles from one linear meter harvested from the middle of the plot.</p>
<p>Broad-sense heritability for each trait was estimated using the formula <inline-formula id="IEq1"><alternatives><tex-math id="M1">\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$H^{2} = \delta_{G}^{2} /\left(\delta_{G}^{2} + \left( {\frac{{\delta_{\text{GE}}^{2} }}{e}} \right) + \left( {\frac{{\delta_{e}^{2} }}{re}} \right)\right)$$\end{document}</tex-math>
<mml:math id="M2"><mml:mrow><mml:msup><mml:mi>H</mml:mi>
<mml:mn>2</mml:mn>
</mml:msup>
<mml:mo>=</mml:mo>
<mml:msubsup><mml:mi mathvariant="italic">δ</mml:mi>
<mml:mrow><mml:mi>G</mml:mi>
</mml:mrow>
<mml:mn>2</mml:mn>
</mml:msubsup>
<mml:mo stretchy="false">/</mml:mo>
<mml:mfenced close=")" open="(" separators=""><mml:msubsup><mml:mi mathvariant="italic">δ</mml:mi>
<mml:mrow><mml:mi>G</mml:mi>
</mml:mrow>
<mml:mn>2</mml:mn>
</mml:msubsup>
<mml:mo>+</mml:mo>
<mml:mfenced close=")" open="(" separators=""><mml:mfrac><mml:msubsup><mml:mi mathvariant="italic">δ</mml:mi>
<mml:mrow><mml:mtext>GE</mml:mtext>
</mml:mrow>
<mml:mn>2</mml:mn>
</mml:msubsup>
<mml:mi>e</mml:mi>
</mml:mfrac>
</mml:mfenced>
<mml:mo>+</mml:mo>
<mml:mfenced close=")" open="(" separators=""><mml:mfrac><mml:msubsup><mml:mi mathvariant="italic">δ</mml:mi>
<mml:mrow><mml:mi>e</mml:mi>
</mml:mrow>
<mml:mn>2</mml:mn>
</mml:msubsup>
<mml:mrow><mml:mi>r</mml:mi>
<mml:mi>e</mml:mi>
</mml:mrow>
</mml:mfrac>
</mml:mfenced>
</mml:mfenced>
</mml:mrow>
</mml:math>
<inline-graphic xlink:href="11032_2015_276_Article_IEq1.gif"></inline-graphic>
</alternatives>
</inline-formula>
(Hallauer et al. <xref ref-type="bibr" rid="CR27">2010</xref>
) where <italic>e</italic>
and <italic>r</italic>
are the numbers of environments and replications per environment.</p>
</sec>
<sec id="Sec12"><title>Statistical analysis</title>
<p>To detect significant differences between the recurrent parent <italic>CUR</italic>
and the ILs, a post hoc Dunnett’s pairwise multiple comparison test (Dunnett <xref ref-type="bibr" rid="CR16">1980</xref>
) with a significant level of 0.01 and using <italic>CUR</italic>
as control was performed for each trait. Because most ILs carry more than one segment from the donor parent, a standard single-marker linear regression analysis (SMLRA) was used to identify markers significantly associated with pericarp color, and a stepwise regression analysis (Li et al. <xref ref-type="bibr" rid="CR40">2007</xref>
) was implemented for flowering time, plant height, number of tillers and number of panicles using the software iciMapping v.3.2 (<ext-link ext-link-type="uri" xlink:href="http://www.isbreeding.net/software/?type=detail&id=13">http://www.isbreeding.net/software/?type=detail&id=13</ext-link>
). A likelihood ratio test based on linear regression was used to estimate LOD scores from the <italic>p</italic>
values. A permutation test using 1,000 permutations (Doerge and Churchill <xref ref-type="bibr" rid="CR14">1996</xref>
) was used to determine the experiment-wise significance threshold at a 0.05 level of significance.</p>
</sec>
</sec>
<sec id="Sec13" sec-type="results"><title>Results</title>
<sec id="Sec14"><title>Development of introgression lines</title>
<p>A marker-assisted backcrossing strategy (MABC) was implemented to develop the two IL libraries. Fixed lines were selected after three rounds of MABC and one generation of double haploidization using anther culture (Lentini et al. <xref ref-type="bibr" rid="CR39">1995</xref>
) (Online resource 1). A set of 32 and 48 fixed lines were selected to comprise the <italic>CUR/MER</italic>
and <italic>CUR/RUF</italic>
introgression libraries, respectively (Figs. <xref rid="Fig1" ref-type="fig">1</xref>
, <xref rid="Fig2" ref-type="fig">2</xref>
). Together, the lines comprising each library contain the majority of the donor genome introgressed as small overlapping chromosome fragments in the <italic>CUR</italic>
genetic background.<fig id="Fig1"><label>Fig. 1</label>
<caption><p>Graphical genotypes, distribution of target and non-target introgressions, and genotypic statistics for 32 <italic>CUR/MER</italic>
ILs. Graphic representation of the genotypic make-up for the recurrent parent <italic>CUR</italic>
(<italic>gray</italic>
), the donor parent <italic>MER</italic>
(<italic>red</italic>
) in the 32 ILs (<italic>MER1</italic>
-<italic>MER32</italic>
) from the <italic>bottom</italic>
to the <italic>top</italic>
of the <italic>graph</italic>
across each of the 12 chromosomes. The chromosome where the target introgression is located, its base-pair size, number of donor segments and percentage of recurrent and donor genome are listed next to each IL. (Color figure online)</p>
</caption>
<graphic xlink:href="11032_2015_276_Fig1_HTML" id="MO1"></graphic>
</fig>
<fig id="Fig2"><label>Fig. 2</label>
<caption><p>Graphical genotypes and distribution of target and non-target introgressions for 40 <italic>CUR/RUF</italic>
ILs. Graphic representation of the genotypic make-up for the recurrent parent <italic>CUR</italic>
(<italic>gray</italic>
), the donor parent <italic>RUF</italic>
(<italic>green</italic>
) in 40 ILs (<italic>RUF1</italic>
-<italic>RUF48</italic>
) from the <italic>bottom</italic>
to the <italic>top</italic>
of the <italic>graph</italic>
across each of the 12 chromosomes. The chromosome where the target introgression is located, its base-pair size, number of donor segments and percentage of recurrent and donor genome are listed next to each IL. (Color figure online)</p>
</caption>
<graphic xlink:href="11032_2015_276_Fig2_HTML" id="MO2"></graphic>
</fig>
</p>
<p>A linkage map for each interspecific cross was generated from SSR segregation data in the BC<sub>1</sub>
F<sub>1</sub>
generation to confirm the colinearity of the genomes in <italic>O. sativa</italic>
and the distantly related wild donor genomes. The SSR linkage maps also served as the basis for genotypic selection during the first three backcross-generations of IL population development (Online Resource 1). The genetic maps had total distances of 2,005.25 cM (<italic>CUR/MER</italic>
) and 1,797.57 cM (<italic>CUR/RUF</italic>
) (Online Resource 3a and 3b). The average distance between markers was 16.41 cM in <italic>CUR/MER</italic>
and 13.95 cM in <italic>CUR/RUF</italic>
(Online Resource 4a and 4b). When the positions of markers on the respective genetic maps were compared using pseudo-centimorgans (1 cM ~ 240 Kbp), we observed complete colinearity in the two populations (Online Resource 4a and 4b). A Chi-square test for skewed segregation of genotypic classes showed strong deviation (<italic>p</italic>
< 0.01) for 18 markers on six chromosomes in the <italic>CUR/MER</italic>
population (Online Resource 5a and 5b), but no skewed segregation rations were observed in the <italic>CUR/RUF</italic>
population.</p>
<p>In the BC<sub>3</sub>
F<sub>1</sub>
DH generation, the two libraries were genotyped using GBS to increase marker density, improve estimation of each recombination break point and to detect donor introgressions that had gone undetected using the sparse coverage provided by the SSR and indel markers (Fig. <xref rid="Fig3" ref-type="fig">3</xref>
a, b). The number of polymorphic markers identified between <italic>CUR</italic>
and the two wild donors is summarized in Fig. <xref rid="Fig3" ref-type="fig">3</xref>
a for the SSR/indels, the 6K SNPs and the GBS markers. Using the 6K SNP assay, marker density increased over tenfold, from an average of 16.41 cM/marker using SSRs to 1.70 cM/marker in the <italic>CUR/MER</italic>
and from an average of 13.95 cM/marker to 1.03 cM/marker in the <italic>CUR/RUF</italic>
population. Using GBS, marker density increased again, an estimated 50-fold, from an average of 1.70 cM/marker using the 6K assay to 0.02 cM/marker in the <italic>CUR/MER</italic>
and from an average of 1.03 cM/marker using the 6K assay to 0.024 cM/marker in the <italic>CUR/RUF</italic>
population. In practical terms, this increase in resolution allowed us to detect additional introgressions that had been missed using SSRs and to better define the size and genome positions of both target and background introgressions in all the ILs as illustrated in Fig. <xref rid="Fig3" ref-type="fig">3</xref>
b.<fig id="Fig3"><label>Fig. 3</label>
<caption><p><bold>a</bold>
Polymorphic markers between the recurrent parent <italic>CUR</italic>
and the two donor parents <italic>MER</italic>
and <italic>RUF</italic>
, using SSR markers, and SNP-markers from 6K Infinium platform and GBS platform. <bold>b</bold>
Genotyping-platforms comparison. Illustration of a 12.2 Mbp region in chromosome 1 genotyped in two <italic>CUR/MER</italic>
lines, <italic>MER3</italic>
(on the <italic>left</italic>
) and <italic>MER19</italic>
(on the <italic>right</italic>
) using SSR markers, a 6K-SNP Infinium chip and GBS. Respectively for each platform 4, 35 and 4,079 markers segregate. The <italic>MER</italic>
alleles are <italic>color</italic>
-<italic>coded red</italic>
, and the <italic>CUR</italic>
alleles are <italic>color</italic>
-<italic>coded blue</italic>
. Comparisons between platforms are determined by <italic>dashed lines</italic>
. (Color figure online)</p>
</caption>
<graphic xlink:href="11032_2015_276_Fig3_HTML" id="MO3"></graphic>
</fig>
</p>
<p>In the <italic>CUR/MER</italic>
IL library, donor introgressions cover 76.73 % of the <italic>MER</italic>
genome. The missing portion of the donor genome (23.27 %) is distributed in 13 regions across nine different chromosomes (Online Resource 6a). For the <italic>CUR/RUF</italic>
, the donor introgressions cover 97.6 % of the <italic>RUF</italic>
genome. The small missing portion of the donor genome (2.4 %) is distributed in 11 regions across four different chromosomes (Online Resource 6b). The location of each targeted introgressed donor segment, number of donor introgressions and percentage of background donor genome for each ILs are summarized in Figs. <xref rid="Fig1" ref-type="fig">1</xref>
, <xref rid="Fig2" ref-type="fig">2</xref>
.</p>
</sec>
<sec id="Sec15"><title>Phenotypic evaluation</title>
<p>To demonstrate the utility of the IL libraries for mapping and as pre-breeding materials, we evaluated both populations for a simply inherited trait (pericarp color) in the greenhouse, and the <italic>CUR/RUF</italic>
population for four quantitatively inherited traits under upland conditions in the field.</p>
<sec id="Sec16"><title>Pericarp color</title>
<p>The wild donor parents, <italic>MER</italic>
and <italic>RUF,</italic>
both have red pericarp, while <italic>CUR</italic>
has a translucent or white pericarp (Online Resource 7). Two ILs from the <italic>CUR/MER</italic>
library (<italic>MER16</italic>
and <italic>MER23</italic>
) and seven from the <italic>CUR/RUF</italic>
library (<italic>RUF1</italic>
, <italic>RUF4</italic>
, <italic>RUF8</italic>
, <italic>RUF29</italic>
, <italic>RUF36</italic>
, <italic>RUF39</italic>
, and <italic>RUF41</italic>
) were identified with red pericarp color, while all other ILs in both libraries had white pericarp (Fig. <xref rid="Fig4" ref-type="fig">4</xref>
a, Online Resource 7). When the functional indel marker previously developed by Sweeney et al. (<xref ref-type="bibr" rid="CR76">2006</xref>
) was used to determine which lines carried the wild-type allele and which carried the derived allele at <italic>RC,</italic>
both <italic>MER</italic>
and <italic>RUF,</italic>
as well as the two <italic>CUR/MER</italic>
ILs and the seven <italic>CUR/RUF</italic>
ILs with red pericarp were confirmed to carried the wild-type (non-deletion) allele (Fig. <xref rid="Fig4" ref-type="fig">4</xref>
b), while the <italic>CUR</italic>
recurrent parent, the eight randomly selected white pericarp ILs and two white-seeded control varieties, IR64 (ssp <italic>indica</italic>
) and Azucena (ssp <italic>tropical japonica</italic>
), all carried the derived (14-bp deletion), recessive allele (Fig. <xref rid="Fig4" ref-type="fig">4</xref>
b and Online Resource 7).<fig id="Fig4"><label>Fig. 4</label>
<caption><p>Chromosome 7 donor introgressions <bold>a</bold>
Chromosome 7 zoom-in. Genotypic introgression of 12 different IL and parents in chromosome 7, the recurrent genome is colored in <italic>gray</italic>
and the donor genome in <italic>red</italic>
. The phenotype of each IL is shown in the <italic>right border</italic>
<bold>b</bold>
PCR products to detect the functional 14-bp indel marker in the <italic>Rc</italic>
locus (Sweeney et al. <xref ref-type="bibr" rid="CR76">2006</xref>
) from seven colored-pericarp ILs, and four <italic>white colored</italic>
-pericarp, the parents <italic>CUR</italic>
, <italic>RUF</italic>
, <italic>MER</italic>
and two controls lines IR64 and Azucena. <bold>c</bold>
Summary of significant regions associated with pericarp color (LOD > 3.1) using logistic regression (SMA-LR) analysis. (Color figure online)</p>
</caption>
<graphic xlink:href="11032_2015_276_Fig4_HTML" id="MO4"></graphic>
</fig>
</p>
<p>The two red <italic>CUR/MER</italic>
ILs shared a wild introgression on chromosome 7 in the region containing <italic>RC</italic>
, defined by the GBS-SNP markers S7_12945 and S7_7924008 and mapping to the interval 07:12,945–07:7,924,008 bp on the physical map of rice (MSU7.0, Kawahara et al. <xref ref-type="bibr" rid="CR33">2013</xref>
). To confirm that allelic variation at the <italic>RC</italic>
gene was also predictive of pericarp color in the <italic>CUR/RUF</italic>
ILs, where lines carry multiple donor introgressions in the genetic background, we conducted a SMLRA and identified seven markers significantly associated with pericarp color (LOD > 3.1). All seven SNPs were located on chromosome 7 between positions 07:5,308,812–07:18,659,022 bp (MSU7.0, Kawahara et al. <xref ref-type="bibr" rid="CR33">2013</xref>
) (Fig. <xref rid="Fig4" ref-type="fig">4</xref>
c). The <italic>RC</italic>
gene is located at 07:6,061,890–6,068,318 bp and is contained in the overlapping segment shared by these lines (Fig. <xref rid="Fig4" ref-type="fig">4</xref>
a). In both populations, the functional marker in <italic>RC</italic>
is a perfect predictor of pericarp color in our IL libraries.</p>
</sec>
</sec>
<sec id="Sec17"><title>Upland field evaluation</title>
<p>When the <italic>CUR/RUF</italic>
ILs were evaluated for four agronomic traits in the field, the distribution of ‘plant height,’ ‘tiller number,’ and ‘panicle number’ was normal, while the distribution of ‘days to flowering’ was skewed toward late flowering (Online Resource 2b). ‘Tiller number’ and ‘panicle number’ were strongly correlated (<italic>r</italic>
= 0.9) (Online Resource 2b). Broad sense heritability (<italic>H</italic>
<sup><italic>2</italic>
</sup>
) estimations showed better repeatability for ‘days to flowering’ (<italic>H</italic>
<sup>2</sup>
= 0.97) and ‘plant height’ (<italic>H</italic>
<sup>2</sup>
= 0.85) than for ‘number of tillers’ (<italic>H</italic>
<sup>2</sup>
= 0.55) and ‘number of panicles’ (<italic>H</italic>
<sup>2</sup>
= 0.51).</p>
<p>Significant differences among IL genotypes (<italic>p</italic>
< 0.05) were observed for all traits (Fig. <xref rid="Fig5" ref-type="fig">5</xref>
). For flowering time, 16 ILs were significantly different from the recurrent parent: two ILs flowered earlier than <italic>CUR</italic>
, while 14 ILs flowered later (<italic>p</italic>
< 0.05; Fig. <xref rid="Fig5" ref-type="fig">5</xref>
a). Nine ILs were significantly taller than <italic>CUR</italic>
(<italic>p</italic>
< 0.05; Fig. <xref rid="Fig5" ref-type="fig">5</xref>
b). Of particular note, IL <italic>RUF27</italic>
had a significantly higher number of both tillers and panicles per linear meter than <italic>CUR</italic>
(<italic>p</italic>
< 0.05; Fig. <xref rid="Fig5" ref-type="fig">5</xref>
c, d). This IL warrants further testing to determine its relevance as a potential donor in breeding.<fig id="Fig5"><label>Fig. 5</label>
<caption><p><italic>CUR/RUF</italic>
upland field evaluation Boxplots showing the distribution of <italic>CUR/RUF</italic>
ILs for four phenotypes. In each, the recurrent parent (<italic>CUR</italic>
) is colored red and ILs significantly higher than <italic>CUR</italic>
(<italic>p</italic>
< 0.05) are <italic>colored orange</italic>
, and lower than <italic>CUR</italic>
(<italic>p</italic>
< 0.05) are <italic>colored green</italic>
. <bold>a</bold>
‘Days to flowering.’ <bold>b</bold>
‘Average plant height.’ <bold>c</bold>
‘Number of tillers.’ <bold>d</bold>
‘Number of panicles’. (Color figure online)</p>
</caption>
<graphic xlink:href="11032_2015_276_Fig5_HTML" id="MO5"></graphic>
</fig>
</p>
<p>When the performance of ILs was compared between plants grown in naturally occurring acid soils and lime-treated (non acid) soils, significant differences were observed for ‘days to flowering’ and ‘plant height,’ but not for ‘number of tillers’ or ‘number of panicles’ (<italic>p</italic>
< 0.05). Overall, plants flowered earlier in acid soils than in limed conditions (<italic>p</italic>
< 0.05). A stepwise regression analysis identified a region on chromosome 3 that was significantly associated with ‘days to flowering’ under both treatments (LOD > 5.53) and one region on chromosome 9 significantly associated with ‘days to flowering’ under limed soil conditions only (LOD > 5.53; Fig. <xref rid="Fig6" ref-type="fig">6</xref>
a, b; Online Resource 8a) For plant height, plants under acid soil conditions were, on average, smaller than those under limed conditions. A stepwise regression analysis identified a region on chromosome 10 that was significantly associated (LOD > 3.51) with ‘plant height’ under both treatments, and a region on chromosome 1 significantly associated with ‘plant height’ under natural acid soil conditions (LOD > 3.51; Fig. <xref rid="Fig6" ref-type="fig">6</xref>
a, b; Online Resource 8b). Based on these examples, we demonstrate that the interspecific ILs developed on this project embody a wide range of phenotypic variation and can be used to dissect the genetics of both simply and quantitatively inherited traits, as well as to broaden the genetic base of elite breeding materials.<fig id="Fig6"><label>Fig. 6</label>
<caption><p>Upland field evaluation summary, <bold>a</bold>
GBS SNP coverage across the <italic>CUR/RUF</italic>
ILs population (<italic>black lines</italic>
in chromosome bars), graphic location of SNPs significantly associated with ‘days to flowering’ (<italic>green lines</italic>
) and ‘plant height’ (<italic>orange lines</italic>
), and published QTL regions that co-localize with the associated SNPs from this study (<italic>red</italic>
and <italic>blue bars</italic>
). <bold>b</bold>
Summary of significant regions associated with plant height (LOD > 3.5), and days to flowering (LOD > 5) using a stepwise regression single-marker analysis (SR-SMA) for days to flowering and plant height. (Color figure online)</p>
</caption>
<graphic xlink:href="11032_2015_276_Fig6_HTML" id="MO6"></graphic>
</fig>
</p>
</sec>
</sec>
<sec id="Sec18" sec-type="discussion"><title>Discussion</title>
<p>We report the development of two sets of interspecific ILs using a drought-tolerant <italic>tropical japonica</italic>
cultivar, Curinga (<italic>CUR</italic>
), as the recurrent parent and two wild donor accessions from the species <italic>O. meridionalis</italic>
(<italic>MER</italic>
) and <italic>O. rufipogon</italic>
(<italic>RUF</italic>
). We demonstrate that the IL populations segregate for traits of interest, and we identified a superior IL, <italic>RUF27,</italic>
that has a higher number of tillers and number of panicles than <italic>CUR</italic>
under upland soil conditions. This new germplasm offers the rice community an opportunity to explore the genetic potential of variation found in two wild rice species in an elite cultivated background and to identify potentially useful pre-breeding materials.</p>
<sec id="Sec19"><title>Genetic divergence of wild and cultivated materials</title>
<p>Despite the fact that the <italic>O. meridionalis</italic>
lineage is estimated to have diverged from the other AA genome species approximately 2 M years ago and remains geographically isolated from both <italic>O. sativa</italic>
and <italic>O. rufipogon,</italic>
we demonstrate that SSR-based linkage maps were collinear in the two interspecific crosses. This made it possible to use the SSR and indel markers for MABC during three generations of backcrossing to construct the IL populations. Nonetheless, we would expect more structural variation, greater disruption of recombination, and more significant sterility barriers between <italic>MER</italic>
and <italic>CUR</italic>
than between <italic>RUF</italic>
and <italic>CUR.</italic>
Consistent with this hypothesis, 26.3 % of the <italic>MER</italic>
genome was missing from the IL library reported here, while only 2.4 % of the <italic>RUF</italic>
genome was not represented in the <italic>CUR/RUF</italic>
population. We also observed fewer and smaller introgressed regions, greater segregation distortion, and had more difficulty making crosses in the <italic>CUR/MER</italic>
than in the <italic>CUR/RUF</italic>
population. Nevertheless, the theoretical percentage of overall recurrent parent genome expected in a random BC<sub>3</sub>
generation line (93.75 %) was very similar to that obtained in the <italic>CUR/MER</italic>
IL library (95 %) reported here.</p>
<p>Linkage analysis identified six regions with strong segregation distortion in the <italic>CUR/MER</italic>
map (Online Resource 5<bold>)</bold>
. Seven of the fragments that were lost during the development of the <italic>CUR/MER</italic>
ILs co-localized with markers showing strong segregation distortion in the BC<sub>1</sub>
F<sub>1</sub>
(Online Resource 6a). In addition four of the regions associated with segregation distortion in these materials, on chromosomes 4, 6, 11, and 12 (Online Resource 5), co-localized with previously reported sterility factors (Kinoshita <xref ref-type="bibr" rid="CR34">1991</xref>
, <xref ref-type="bibr" rid="CR35">1993</xref>
; Rha et al. <xref ref-type="bibr" rid="CR66">1995</xref>
; Matsubara and Khin-Thidar <xref ref-type="bibr" rid="CR52">2003</xref>
). Deviation from expected Mendelian segregation ratios is commonly observed in interspecific crosses of rice (McCouch et al. <xref ref-type="bibr" rid="CR53">1988</xref>
; Xu et al. <xref ref-type="bibr" rid="CR88">1997</xref>
; Lorieux et al. <xref ref-type="bibr" rid="CR47">2000</xref>
; Brondani et al. <xref ref-type="bibr" rid="CR9">2001</xref>
) and is usually associated with the presence of linked sterility factors and post-zygotic reproductive barriers (Sano <xref ref-type="bibr" rid="CR69">1990</xref>
; Koide et al. <xref ref-type="bibr" rid="CR36">2008</xref>
; Garavito et al. <xref ref-type="bibr" rid="CR21">2010</xref>
; Gutierrez et al. <xref ref-type="bibr" rid="CR26">2010</xref>
).</p>
<p>It is noteworthy that many of the missing <italic>MER</italic>
fragments in the <italic>CUR/MER</italic>
ILs were lost during the double haploidization process, rather than during the backcrossing. This suggests a possible sex-dependent transmission-ratio distortion system acting at these loci, such that there was preferential abortion of male gametes possessing the <italic>MER</italic>
alleles in favor of those with the <italic>CUR</italic>
alleles. Another reason why specific donor segments may be underrepresented or lost from the <italic>CUR/MER</italic>
IL population is that they were negatively associated with regeneration ability during the tissue culture process (Xu et al. <xref ref-type="bibr" rid="CR88">1997</xref>
). Li et al. (<xref ref-type="bibr" rid="CR41">2013</xref>
) identified 25 QTLs associated with tissue culture response from an intraspecific cross between the <italic>indica</italic>
variety 93–11 and the <italic>japonica</italic>
variety Nipponbare. Many of the QTLs associated with regeneration ability in tissue culture in chromosome 2 (<italic>qCBT</italic>
-<italic>2a</italic>
, <italic>qCBT</italic>
-<italic>2b</italic>
, and <italic>qRR</italic>
-<italic>7</italic>
), and 6 (<italic>qICC</italic>
-<italic>6</italic>
and <italic>qICF</italic>
-<italic>6</italic>
) (Li et al. <xref ref-type="bibr" rid="CR41">2013</xref>
) colocalize with missing regions in the <italic>CUR/MER</italic>
ILs.</p>
<p>In contrast to the <italic>CUR/MER</italic>
population, segments covering almost the entire <italic>RUF</italic>
genome were successfully transmitted to the <italic>CUR/RUF</italic>
IL library. However, the recovery of the recurrent parent genome (89.9 %) was lower than expected (93.75 %). This is partly due to the low genomic coverage with SSRs, and possibly because the populations used for selection during the cycles of MABC were not large enough to enable us to identify the most desirable combination of target introgression(s) and clean genetic background.</p>
</sec>
<sec id="Sec20"><title>Utility of GBS for enhancing marker density</title>
<p>Currently, GBS is being adopted as an alternative to the use of fixed SNP arrays for the generation of high-density marker data in plant breeding and genetics. This is largely due to the simplification and automation of library preparation production protocols, the high throughput and relatively low cost of sequencing, the ability to simultaneously discover and genotype SNPs, and the reduction in ascertainment bias (Heslot et al. <xref ref-type="bibr" rid="CR28">2013</xref>
). However, the versatility and potential for widespread use of GBS depends upon the bioinformatics tools available to address the relatively high error rate and the data sparsity of GBS. Several bioinformatics pipelines have been developed to overcome these obstacles (Bradbury et al. <xref ref-type="bibr" rid="CR7">2007</xref>
; Spindel et al. <xref ref-type="bibr" rid="CR75">2013</xref>
; Sonah et al. <xref ref-type="bibr" rid="CR73">2013</xref>
). By using GBS, we were able to increase our maker density over 50-fold, compared to a fixed 6K SNP array, and over 600-fold compared to our initial SSR dataset. The ability to rapidly generate high-density SNP datasets in fixed collections of ILs, such as those developed in this study, makes it possible to define the size and positions of both target and background introgressions and to identify small donor introgressions that had been missed using previous, lower density marker datasets.</p>
</sec>
<sec id="Sec21"><title>Phenotypic variation</title>
<p>Wild species are differentiated from cultivated forms of rice by numerous genetic changes and trait variation, including pigmentation of the pericarp. Most wild species, including both <italic>O. meridionalis</italic>
and <italic>O. rufipogon,</italic>
have red pericarp, while in <italic>O. sativa</italic>
cultivars, the pericarp is white or translucent. The <italic>RC</italic>
gene responsible for the change from red to white pericarp is a basic helix-loop-helix transcription factor, and a 14-bp deletion in exon 6 of the <italic>RC</italic>
gene is responsible for the loss of pigmentation in the pericarp tissue (Sweeney et al. <xref ref-type="bibr" rid="CR76">2006</xref>
). The <italic>RC</italic>
gene maps within the introgressed region on chromosome 7 that is associated with red pericarp in the <italic>CUR/MER</italic>
and <italic>CUR/RUF</italic>
populations (Fig. <xref rid="Fig4" ref-type="fig">4</xref>
). Here, we demonstrated that ILs with colored pericarp carry an introgression from the donor parent at the <italic>RC</italic>
locus (Online Resource 7). Genotypic screening using the functional marker in the <italic>RC</italic>
gene confirmed that all the lines with colored pericarp carry at least one <italic>wild-type</italic>
allele at <italic>RC</italic>
, compared with control lines that have white pericarp and are known to carry the 14-bp deletion in Exon 6 of <italic>RC</italic>
(Fig. <xref rid="Fig4" ref-type="fig">4</xref>
b). These results confirmed our mapping results and demonstrated that the colored phenotype for both IL libraries is associated with the <italic>RC</italic>
gene. Proanthocyanidins, the red pigment in rice pericarp, have been associated with some nutritional benefits (Ling et al. <xref ref-type="bibr" rid="CR43">2001</xref>
) that could be exploited by developing niche markets. ILs identified in this study with red pericarp might be of interest for breeding programs interested in developing value-added rice varieties. Some of the red-pericarp ILs identified in this study carry a single, small, well-defined wild introgression at the <italic>RC</italic>
locus on chromosome 7, and the genomic composition of the other ILs is close to 97 % of the RP having all of the agronomic traits of <italic>CUR</italic>
and only a small introgression that causes the colored pericarp phenotype.</p>
<p>Upland rice is grown in rainfed, naturally well-drained soils without surface water accumulation (Ahmadi et al. <xref ref-type="bibr" rid="CR1">2004</xref>
). This agro-ecosystem is particularly prone to stresses such as aluminum toxicity, phosphorus deficiency, drought caused by erratic rainfall, rice blast disease and weeds (Ahmadi et al. <xref ref-type="bibr" rid="CR1">2004</xref>
). The genetic base of upland rice cultivars in Latin America is particularly narrow due to the fact that a small core of adapted progenitors has been used repeatedly in different rice breeding programs (Guimaraes <xref ref-type="bibr" rid="CR25">1993</xref>
; Guimaraees et al. <xref ref-type="bibr" rid="CR24">1996</xref>
). It is therefore important to identify novel allelic variation that can improve the genetic pool of upland varieties. To assess the potential for phenotypic variation among the interspecific ILs developed on this project, we evaluated the 48 <italic>CUR/RUF</italic>
ILs for four agronomic traits, ‘Days to flowering,’ ‘Plant height,’ ‘Tiller number’ and ‘Panicle number’ under upland soil conditions in Meta-Colombia.</p>
<p>While variation coming from the wild donor was often associated with traits that were not considered favorable in the context of plant improvement, the reverse was also true. Thus, an <italic>O. rufipogon</italic>
introgression on the short arm of chromosome 3 was associated with late flowering (Fig. <xref rid="Fig6" ref-type="fig">6</xref>
a, b), consistent with reports using the same wild donor in the cv Jefferson (<italic>tropical japonica</italic>
) genetic background (Xiao et al. <xref ref-type="bibr" rid="CR87">1998</xref>
; Moncada et al. <xref ref-type="bibr" rid="CR57">2001</xref>
; Thomson et al. <xref ref-type="bibr" rid="CR83">2003</xref>
). The <italic>HEADING DATE 9</italic>
(<italic>Hd9</italic>
) locus, known to be involved in photoperiod sensitivity, is located in this region (Lin et al. <xref ref-type="bibr" rid="CR42">2002</xref>
). On average the lines with the <italic>RUF</italic>
introgression at the <italic>Hd9</italic>
locus flowered 15.5 days later than <italic>CUR</italic>
. The MADS-box gene <italic>OsSOC1</italic>
is located within the <italic>Hd9</italic>
interval (chromosome 3: 1,269,856–1,271,783) (Tadege et al. <xref ref-type="bibr" rid="CR78">2003</xref>
) and is a candidate gene that may be responsible for the late flowering phenotype of ILs carrying the <italic>RUF</italic>
allele at this locus. On chromosome 1, a <italic>RUF</italic>
introgression increased the height of ILs under natural acid soil conditions. This region co-localizes with the plant height QTLs, <italic>ph1.1</italic>
(Moncada et al. <xref ref-type="bibr" rid="CR57">2001</xref>
) and <italic>ph1.2</italic>
(Thomson et al. <xref ref-type="bibr" rid="CR83">2003</xref>
) (Fig. <xref rid="Fig6" ref-type="fig">6</xref>
a, b), and contains the <italic>SEMI</italic>
-<italic>DWARF1</italic>
(<italic>SD1</italic>
) gene associated with the green revolution (Sasaki et al. <xref ref-type="bibr" rid="CR71">2002</xref>
). The identification of <italic>RUF</italic>
introgressions associated with late flowering and taller plant height represent throw backs to ancestral traits, while plant breeders have consciously selected for shorter plants with early flowering traits for production in upland ecosystems in South America (Châtel et al. <xref ref-type="bibr" rid="CR10">2008</xref>
).</p>
<p>On the other hand, a <italic>RUF</italic>
introgression on chromosome 10 was associated with reduced plant height under both limed and natural acid soil conditions. This <italic>RUF</italic>
allele contributes transgressive variation for shorter stature that may be of interest to breeders interested in selecting for shorter plants. Similarly, the IL <italic>RUF27</italic>
produced more tillers and more panicles than the recurrent parent, <italic>CUR,</italic>
while it did not differ in days to flowering or plant height. <italic>RUF27</italic>
also had the highest grain yield of any of the ILs in this study, though the difference between <italic>RFU27</italic>
and <italic>CUR</italic>
was not statistically significant. <italic>RUF27</italic>
carries six small introgressions on chromosomes 2, 6, 8, 9, 10 and 12 and it will be interesting to continue backcrossing this line to understand the genetics underlying the higher number of tillers and panicles and to validate the value of this IL for breeding purposes. Further, phenotypic analysis is underway on both populations of ILs under a variety of field and controlled environment conditions to better characterize these lines and their utility as pre-breeding materials.</p>
<p>The ILs described here are available for research purposes via a Material Transfer Agreement from CIAT.</p>
</sec>
</sec>
<sec sec-type="supplementary-material"><title>Electronic supplementary material</title>
<sec id="Sec22"><supplementary-material content-type="local-data" id="MOESM1"><media xlink:href="11032_2015_276_MOESM1_ESM.pdf"><caption><p>Supplementary material 1 (PDF 479 kb)</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="MOESM2"><media xlink:href="11032_2015_276_MOESM2_ESM.pdf"><caption><p>Supplementary material 2 (PDF 776 kb)</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="MOESM3"><media xlink:href="11032_2015_276_MOESM3_ESM.pdf"><caption><p>Supplementary material 3 (PDF 1783 kb)</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="MOESM4"><media xlink:href="11032_2015_276_MOESM4_ESM.pdf"><caption><p>Supplementary material 4 (PDF 2331 kb)</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="MOESM5"><media xlink:href="11032_2015_276_MOESM5_ESM.pdf"><caption><p>Supplementary material 5 (PDF 284 kb)</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="MOESM6"><media xlink:href="11032_2015_276_MOESM6_ESM.pdf"><caption><p>Supplementary material 6 (PDF 106 kb)</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="MOESM7"><media xlink:href="11032_2015_276_MOESM7_ESM.pdf"><caption><p>Supplementary material 7 (PDF 898 kb)</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="MOESM8"><media xlink:href="11032_2015_276_MOESM8_ESM.pdf"><caption><p>Supplementary material 8 (PDF 1893 kb)</p>
</caption>
</media>
</supplementary-material>
</sec>
</sec>
</body>
<back><ack><p>We gratefully acknowledge financial support for the PhD fellowship of JDA from the Monsanto Beachell-Bourlag International Scholars Program, and financial support that made this research possible from the Generation Challenge Program (award # G3005.10 to ML and SMc); CIRAD-CIAT rice collaborative project (to CG); USDA –AFRI award #002010 to SMc; NSF-PGRP award #1026555. This work was undertaken as part of the initiative ‘Adapting Agriculture to Climate Change: Collecting, Protecting and Preparing Crop Wild Relatives’ which is supported by the Government of Norway. The project is managed by the Global Crop Diversity Trust with the Millennium Seed Bank of the Royal Botanic Gardens, Kew and implemented in partnership with national and international gene banks and plant breeding institutes around the world. For further information see the project website: <ext-link ext-link-type="uri" xlink:href="http://www.cwrdiversity.org/">http://www.cwrdiversity.org/</ext-link>
. We are also grateful to Fumio (Gen) Onishi from Cornell University, Francisco Rodriguez Cruz, Marcos Brito, and Jaime Bocanegra from CIAT for technical support, and to Jeanne Kisacky for help formatting.</p>
</ack>
<ref-list id="Bib1"><title>References</title>
<ref id="CR1"><mixed-citation publication-type="other">Ahmadi N, Dzido JL, Vales M, Rakotoarisoa J, Chabanne A (2004) Upland rice for highlands: new varieties and sustainable cropping systems for food security promising prospects for the global challenges of rice production. In: Proceedings of the FAO rice conference: rice is life. International Rice Commission Newsletter. pp 58–65</mixed-citation>
</ref>
<ref id="CR2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ali</surname>
<given-names>ML</given-names>
</name>
<name><surname>Sanchez</surname>
<given-names>PL</given-names>
</name>
<name><surname>Yu</surname>
<given-names>S</given-names>
</name>
<name><surname>Lorieux</surname>
<given-names>M</given-names>
</name>
<name><surname>Eizenga</surname>
<given-names>GC</given-names>
</name>
</person-group>
<article-title>Chromosome segment substitution lines: a powerful tool for the introgression of valuable genes from <italic>Oryza</italic>
wild species into cultivated rice (<italic>O. sativa</italic>
)</article-title>
<source>Rice</source>
<year>2010</year>
<volume>3</volume>
<fpage>218</fpage>
<lpage>234</lpage>
<pub-id pub-id-type="doi">10.1007/s12284-010-9058-3</pub-id>
</element-citation>
</ref>
<ref id="CR3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ando</surname>
<given-names>T</given-names>
</name>
<name><surname>Yamamoto</surname>
<given-names>T</given-names>
</name>
<name><surname>Shimizu</surname>
<given-names>T</given-names>
</name>
<name><surname>Ma</surname>
<given-names>XF</given-names>
</name>
<name><surname>Shomura</surname>
<given-names>A</given-names>
</name>
<name><surname>Takeuchi</surname>
<given-names>Y</given-names>
</name>
<name><surname>Lin</surname>
<given-names>SY</given-names>
</name>
<name><surname>Yano</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>Genetic dissection and pyramiding of quantitative traits for panicle architecture by using chromosomal segment substitution lines in rice</article-title>
<source>Theor Appl Genet</source>
<year>2008</year>
<volume>116</volume>
<fpage>881</fpage>
<lpage>890</lpage>
<pub-id pub-id-type="doi">10.1007/s00122-008-0722-6</pub-id>
<pub-id pub-id-type="pmid">18274726</pub-id>
</element-citation>
</ref>
<ref id="CR4"><mixed-citation publication-type="other">Asano K, Yamasaki M, Takuno S, Miura K, Katagiri S, Ito T, Doi K, Wu J, Ebana K, Matsumoto T, Innan H, Kitano H, Ashikari M, Matsuoka M (2011) Artificial selection for a green revolution gene during <italic>japonica</italic>
rice domestication. Proc Natl Acad Sci. doi:10.1073/pnas.1019490108</mixed-citation>
</ref>
<ref id="CR5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Asíns</surname>
<given-names>MJ</given-names>
</name>
</person-group>
<article-title>Present and future of quantitative trait locus analysis in plant breeding</article-title>
<source>Plant Breeding</source>
<year>2002</year>
<volume>121</volume>
<fpage>281</fpage>
<lpage>291</lpage>
<pub-id pub-id-type="doi">10.1046/j.1439-0523.2002.730285.x</pub-id>
</element-citation>
</ref>
<ref id="CR6"><mixed-citation publication-type="other">Bouman BAM, Barker R, Humphreys E, Tuong TP, Atlin GN, Bennett J, Dawe D, Dittert K, Dobermann A, Facon T, Fujimoto N, Gupta RK, Haefele SM, Hosen Y, Ismail AM, Johnson D, Johnson S, Khan S, Lin S, Masih I, Matsuno Y, Pandey S, Peng S, Thiyagarajan TM, Wassman R (2007) Rice: feeding the billions. In: Water for food, water for life: a comprehensive assessment of water management in agriculture. IWMI, Colombo, pp 515–549</mixed-citation>
</ref>
<ref id="CR7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bradbury</surname>
<given-names>PJ</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>Z</given-names>
</name>
<name><surname>Kroon</surname>
<given-names>DE</given-names>
</name>
<name><surname>Casstevens</surname>
<given-names>TM</given-names>
</name>
<name><surname>Ramdoss</surname>
<given-names>Y</given-names>
</name>
<name><surname>Buckler</surname>
<given-names>ES</given-names>
</name>
</person-group>
<article-title>TASSEL: software for association mapping of complex traits in diverse samples</article-title>
<source>Bioinformatics</source>
<year>2007</year>
<volume>23</volume>
<fpage>2633</fpage>
<lpage>2635</lpage>
<pub-id pub-id-type="doi">10.1093/bioinformatics/btm308</pub-id>
<pub-id pub-id-type="pmid">17586829</pub-id>
</element-citation>
</ref>
<ref id="CR8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Brar</surname>
<given-names>DS</given-names>
</name>
<name><surname>Khush</surname>
<given-names>GS</given-names>
</name>
</person-group>
<article-title>Alien introgression in rice</article-title>
<source>Plant Mol Biol</source>
<year>1997</year>
<volume>35</volume>
<fpage>35</fpage>
<lpage>47</lpage>
<pub-id pub-id-type="doi">10.1023/A:1005825519998</pub-id>
<pub-id pub-id-type="pmid">9291958</pub-id>
</element-citation>
</ref>
<ref id="CR9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Brondani</surname>
<given-names>C</given-names>
</name>
<name><surname>Brondani</surname>
<given-names>R</given-names>
</name>
<name><surname>Rangel</surname>
<given-names>P</given-names>
</name>
<name><surname>Ferreira</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>Development and mapping of <italic>Oryza glumaepatula</italic>
-derived microsatellite markers in the interspecific cross <italic>Oryza glumaepatula</italic>
× <italic>O sativa</italic>
</article-title>
<source>Hereditas</source>
<year>2001</year>
<volume>134</volume>
<fpage>59</fpage>
<lpage>71</lpage>
<pub-id pub-id-type="doi">10.1111/j.1601-5223.2001.00059.x</pub-id>
<pub-id pub-id-type="pmid">11525066</pub-id>
</element-citation>
</ref>
<ref id="CR10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Châtel</surname>
<given-names>M</given-names>
</name>
<name><surname>Ospina</surname>
<given-names>Y</given-names>
</name>
<name><surname>Rodriguez</surname>
<given-names>F</given-names>
</name>
<name><surname>Lozano</surname>
<given-names>VH</given-names>
</name>
<name><surname>Delgado</surname>
<given-names>H</given-names>
</name>
</person-group>
<article-title>Upland rice composite population breeding and selection of promising lines for Colombian savannah ecosystem</article-title>
<source>Pesqui Agropecu Trop (Agric Res Trop)</source>
<year>2008</year>
<volume>38</volume>
<fpage>1</fpage>
<lpage>5</lpage>
</element-citation>
</ref>
<ref id="CR11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chin</surname>
<given-names>JH</given-names>
</name>
<name><surname>Gamuyao</surname>
<given-names>R</given-names>
</name>
<name><surname>Dalid</surname>
<given-names>C</given-names>
</name>
<name><surname>Bustamam</surname>
<given-names>M</given-names>
</name>
<name><surname>Prasetiyono</surname>
<given-names>J</given-names>
</name>
<name><surname>Moeljopawiro</surname>
<given-names>S</given-names>
</name>
<name><surname>Wissuwa</surname>
<given-names>M</given-names>
</name>
<name><surname>Heuer</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>Developing rice with high yield under phosphorus deficiency: <italic>Pup1</italic>
sequence to application</article-title>
<source>Plant Physiol</source>
<year>2011</year>
<volume>156</volume>
<fpage>1202</fpage>
<lpage>1216</lpage>
<pub-id pub-id-type="doi">10.1104/pp.111.175471</pub-id>
<pub-id pub-id-type="pmid">21602323</pub-id>
</element-citation>
</ref>
<ref id="CR12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Collard</surname>
<given-names>BCY</given-names>
</name>
<name><surname>Mackill</surname>
<given-names>DJ</given-names>
</name>
</person-group>
<article-title>Marker-assisted selection: an approach for precision plant breeding in the twenty-first century</article-title>
<source>Philos Trans R Soc Lond B Biol Sci</source>
<year>2008</year>
<volume>363</volume>
<fpage>557</fpage>
<lpage>572</lpage>
<pub-id pub-id-type="doi">10.1098/rstb.2007.2170</pub-id>
<pub-id pub-id-type="pmid">17715053</pub-id>
</element-citation>
</ref>
<ref id="CR13"><mixed-citation publication-type="other">de Morais O, da Castro EM, Soares AA, Guimarães EP, Chatel M, Ospina Y, de Lopes AM, de Pereira JA, Utumi MM, Centeno AC, Fonseca R, Breseghello F, Guimaraes CM, Bassinello PZ, Sitarama Prabhu A, Ferreira E, Gervini de Souza NR, Alves de Souza M, Sousa Reis M, Guimaraes Santos P (2005) BRSMG Curinga: cultivar de arroz de terras altas de ampla adaptacicão para o Brasil. Embrapa Arroz e Feijão. Comunicado Técnico 114:1–8</mixed-citation>
</ref>
<ref id="CR14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Doerge</surname>
<given-names>RW</given-names>
</name>
<name><surname>Churchill</surname>
<given-names>GA</given-names>
</name>
</person-group>
<article-title>Permutation tests for multiple loci affecting a quantitative character</article-title>
<source>Genetics</source>
<year>1996</year>
<volume>142</volume>
<fpage>285</fpage>
<lpage>294</lpage>
<pub-id pub-id-type="pmid">8770605</pub-id>
</element-citation>
</ref>
<ref id="CR15"><mixed-citation publication-type="other">Doi K, Sobrizal, Ikeda K, Sanchez P., Kurakazu T, Nagai Y, Yoshimura A (2003) Developing and evaluating rice chromosome segment substitution lines. IRRI, Rice science: innovations and impact for livelihood, pp 289–296</mixed-citation>
</ref>
<ref id="CR16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dunnett</surname>
<given-names>CW</given-names>
</name>
</person-group>
<article-title>Pairwise multiple comparisons in the homogeneous variance, unequal sample size case</article-title>
<source>J Am Stat Assoc</source>
<year>1980</year>
<volume>75</volume>
<fpage>789</fpage>
<lpage>795</lpage>
<pub-id pub-id-type="doi">10.1080/01621459.1980.10477551</pub-id>
</element-citation>
</ref>
<ref id="CR17"><mixed-citation publication-type="other">Ebitani T, Takeushi Y, Nonoue Y, Yamamoto T, Takeuchi K, Yano M (2005) Chromosome segment substitution lines carrying overlapping chromosome segments of <italic>indica</italic>
rice cultivar “Kasalath” in a genetic background of <italic>japonica</italic>
elite cultivar “Koshihikari.” Breed Sci 55(1):65–73</mixed-citation>
</ref>
<ref id="CR18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Elshire</surname>
<given-names>RJ</given-names>
</name>
<name><surname>Glaubitz</surname>
<given-names>JC</given-names>
</name>
<name><surname>Sun</surname>
<given-names>Q</given-names>
</name>
<name><surname>Poland</surname>
<given-names>JA</given-names>
</name>
<name><surname>Kawamoto</surname>
<given-names>K</given-names>
</name>
<name><surname>Buckler</surname>
<given-names>ES</given-names>
</name>
<name><surname>Mitchell</surname>
<given-names>SE</given-names>
</name>
</person-group>
<article-title>A robust, simple genotyping-by-sequencing (GBS) approach for high diversity species</article-title>
<source>PLoS ONE</source>
<year>2011</year>
<volume>6</volume>
<fpage>e19379</fpage>
<pub-id pub-id-type="doi">10.1371/journal.pone.0019379</pub-id>
<pub-id pub-id-type="pmid">21573248</pub-id>
</element-citation>
</ref>
<ref id="CR19"><mixed-citation publication-type="other">Food and Agricultural Organization of the United Nations (2003) The international year of rice 2004: concept paper. pp 1–24</mixed-citation>
</ref>
<ref id="CR20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gao</surname>
<given-names>L-Z</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>C-H</given-names>
</name>
<name><surname>Li</surname>
<given-names>D-Y</given-names>
</name>
<name><surname>Pan</surname>
<given-names>D-J</given-names>
</name>
<name><surname>Jia</surname>
<given-names>J-Z</given-names>
</name>
<name><surname>Dong</surname>
<given-names>Y-S</given-names>
</name>
</person-group>
<article-title>Genetic diversity within <italic>Oryza rufipogon</italic>
germplasms preserved in Chinese field gene banks of wild rice as revealed by microsatellite markers</article-title>
<source>Biodivers Conserv</source>
<year>2006</year>
<volume>15</volume>
<fpage>4059</fpage>
<lpage>4077</lpage>
<pub-id pub-id-type="doi">10.1007/s10531-005-3135-8</pub-id>
</element-citation>
</ref>
<ref id="CR21"><mixed-citation publication-type="other">Garavito A, Guyot R, Lozano J, Gavory F, Samain S, Panaud O, Tohme J, Ghesquiere A, Lorieux M (2010) A genetic model for the female sterility barrier between asian and african cultivated rice species. Genetics. doi:10.1534/genetics.110.116772</mixed-citation>
</ref>
<ref id="CR22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Godfray</surname>
<given-names>HCJ</given-names>
</name>
<name><surname>Beddington</surname>
<given-names>JR</given-names>
</name>
<name><surname>Crute</surname>
<given-names>IR</given-names>
</name>
<name><surname>Haddad</surname>
<given-names>L</given-names>
</name>
<name><surname>Lawrence</surname>
<given-names>D</given-names>
</name>
<name><surname>Muir</surname>
<given-names>JF</given-names>
</name>
<name><surname>Pretty</surname>
<given-names>J</given-names>
</name>
<name><surname>Robinson</surname>
<given-names>S</given-names>
</name>
<name><surname>Thomas</surname>
<given-names>SM</given-names>
</name>
<name><surname>Toulmin</surname>
<given-names>C</given-names>
</name>
</person-group>
<article-title>Food security: the challenge of feeding 9 billion people</article-title>
<source>Science</source>
<year>2010</year>
<volume>327</volume>
<fpage>812</fpage>
<lpage>818</lpage>
<pub-id pub-id-type="doi">10.1126/science.1185383</pub-id>
<pub-id pub-id-type="pmid">20110467</pub-id>
</element-citation>
</ref>
<ref id="CR23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gu</surname>
<given-names>X-Y</given-names>
</name>
<name><surname>Foley</surname>
<given-names>ME</given-names>
</name>
<name><surname>Horvath</surname>
<given-names>DP</given-names>
</name>
<name><surname>Anderson</surname>
<given-names>JV</given-names>
</name>
<name><surname>Feng</surname>
<given-names>J</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>L</given-names>
</name>
<name><surname>Mowry</surname>
<given-names>CR</given-names>
</name>
<name><surname>Ye</surname>
<given-names>H</given-names>
</name>
<name><surname>Suttle</surname>
<given-names>JC</given-names>
</name>
<name><surname>Kadowaki</surname>
<given-names>K</given-names>
</name>
<name><surname>Chen</surname>
<given-names>Z</given-names>
</name>
</person-group>
<article-title>Association between seed dormancy and pericarp color is controlled by a pleiotropic gene that regulates abscisic acid and flavonoid synthesis in weedy red rice</article-title>
<source>Genetics</source>
<year>2011</year>
<volume>189</volume>
<fpage>1515</fpage>
<lpage>1524</lpage>
<pub-id pub-id-type="doi">10.1534/genetics.111.131169</pub-id>
<pub-id pub-id-type="pmid">21954164</pub-id>
</element-citation>
</ref>
<ref id="CR25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Guimaraes</surname>
<given-names>EP</given-names>
</name>
</person-group>
<article-title>Genealogy of Brazilian upland rice varieties</article-title>
<source>Int Rice Res Notes</source>
<year>1993</year>
<volume>18</volume>
<fpage>6</fpage>
</element-citation>
</ref>
<ref id="CR24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Guimaraees</surname>
<given-names>EP</given-names>
</name>
<name><surname>Borrero</surname>
<given-names>J</given-names>
</name>
<name><surname>Ospina-Rey</surname>
<given-names>Y</given-names>
</name>
</person-group>
<article-title>Genetic diversity of upland rice germplasm distributed in Latin America</article-title>
<source>Pesqu Agropecu Bras</source>
<year>1996</year>
<volume>31</volume>
<fpage>187</fpage>
<lpage>194</lpage>
</element-citation>
</ref>
<ref id="CR26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gutierrez</surname>
<given-names>A</given-names>
</name>
<name><surname>Carabali</surname>
<given-names>J</given-names>
</name>
<name><surname>Giraldo</surname>
<given-names>O</given-names>
</name>
<name><surname>Martinez</surname>
<given-names>C</given-names>
</name>
<name><surname>Correa</surname>
<given-names>F</given-names>
</name>
<name><surname>Prado</surname>
<given-names>G</given-names>
</name>
<name><surname>Tohme</surname>
<given-names>J</given-names>
</name>
<name><surname>Lorieux</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>Identification of a rice stripe necrosis virus resistance locus and yield component QTLs using <italic>Oryza sativa</italic>
× <italic>O. glaberrima</italic>
introgression lines</article-title>
<source>BMC Plant Biol</source>
<year>2010</year>
<volume>10</volume>
<fpage>6</fpage>
<pub-id pub-id-type="doi">10.1186/1471-2229-10-6</pub-id>
<pub-id pub-id-type="pmid">20064202</pub-id>
</element-citation>
</ref>
<ref id="CR27"><mixed-citation publication-type="other">Hallauer AR, Carena MJ, Miranda Filho J (2010) Quantitative genetics in maize breeding. Springer, Berlin</mixed-citation>
</ref>
<ref id="CR28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Heslot</surname>
<given-names>N</given-names>
</name>
<name><surname>Rutkoski</surname>
<given-names>J</given-names>
</name>
<name><surname>Poland</surname>
<given-names>J</given-names>
</name>
<name><surname>Jannink</surname>
<given-names>J-L</given-names>
</name>
<name><surname>Sorrells</surname>
<given-names>ME</given-names>
</name>
</person-group>
<article-title>Impact of marker ascertainment bias on genomic selection accuracy and estimates of genetic diversity</article-title>
<source>PLoS ONE</source>
<year>2013</year>
<volume>8</volume>
<fpage>e74612</fpage>
<pub-id pub-id-type="doi">10.1371/journal.pone.0074612</pub-id>
<pub-id pub-id-type="pmid">24040295</pub-id>
</element-citation>
</ref>
<ref id="CR29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hospital</surname>
<given-names>F</given-names>
</name>
<name><surname>Moreau</surname>
<given-names>L</given-names>
</name>
<name><surname>Lacoudre</surname>
<given-names>F</given-names>
</name>
<name><surname>Charcosset</surname>
<given-names>A</given-names>
</name>
<name><surname>Gallais</surname>
<given-names>A</given-names>
</name>
</person-group>
<article-title>More on the efficiency of marker-assisted selection</article-title>
<source>Theor Appl Genet</source>
<year>1997</year>
<volume>95</volume>
<fpage>1181</fpage>
<lpage>1189</lpage>
<pub-id pub-id-type="doi">10.1007/s001220050679</pub-id>
</element-citation>
</ref>
<ref id="CR30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Imai</surname>
<given-names>I</given-names>
</name>
<name><surname>Kimball</surname>
<given-names>J</given-names>
</name>
<name><surname>Conway</surname>
<given-names>B</given-names>
</name>
<name><surname>Yeater</surname>
<given-names>K</given-names>
</name>
<name><surname>McCouch</surname>
<given-names>S</given-names>
</name>
<name><surname>McClung</surname>
<given-names>A</given-names>
</name>
</person-group>
<article-title>Validation of yield-enhancing quantitative trait loci from a low-yielding wild ancestor of rice</article-title>
<source>Mol Breed</source>
<year>2013</year>
<volume>32</volume>
<fpage>101</fpage>
<lpage>120</lpage>
<pub-id pub-id-type="doi">10.1007/s11032-013-9855-7</pub-id>
</element-citation>
</ref>
<ref id="CR31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Inukai</surname>
<given-names>T</given-names>
</name>
<name><surname>Zeigler</surname>
<given-names>RS</given-names>
</name>
<name><surname>Sarkarung</surname>
<given-names>S</given-names>
</name>
<name><surname>Bronson</surname>
<given-names>M</given-names>
</name>
<name><surname>Dung</surname>
<given-names>LV</given-names>
</name>
<name><surname>Kinoshita</surname>
<given-names>T</given-names>
</name>
<name><surname>Nelson</surname>
<given-names>RJ</given-names>
</name>
</person-group>
<article-title>Development of pre-isogenic lines for rice blast-resistance by marker-aided selection from a recombinant inbred population</article-title>
<source>Theoret Appl Genetics</source>
<year>1996</year>
<volume>93</volume>
<fpage>560</fpage>
<lpage>567</lpage>
<pub-id pub-id-type="doi">10.1007/BF00417948</pub-id>
<pub-id pub-id-type="pmid">24162348</pub-id>
</element-citation>
</ref>
<ref id="CR32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kanbe</surname>
<given-names>T</given-names>
</name>
<name><surname>Sasaki</surname>
<given-names>H</given-names>
</name>
<name><surname>Aoki</surname>
<given-names>N</given-names>
</name>
<name><surname>Yamagishi</surname>
<given-names>T</given-names>
</name>
<name><surname>Ebitani</surname>
<given-names>T</given-names>
</name>
<name><surname>Yano</surname>
<given-names>M</given-names>
</name>
<name><surname>Ohsugi</surname>
<given-names>R</given-names>
</name>
</person-group>
<article-title>Identification of QTLs for improvement of plant type in rice (<italic>Oryza sativa L.</italic>
) using Koshihikari/Kasalath chromosome segment substitution lines and backcross progeny F<sub>2</sub>
population (genetic resources evaluation)</article-title>
<source>Plant Prod Sci</source>
<year>2008</year>
<volume>11</volume>
<fpage>447</fpage>
<lpage>456</lpage>
<pub-id pub-id-type="doi">10.1626/pps.11.447</pub-id>
</element-citation>
</ref>
<ref id="CR33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kawahara</surname>
<given-names>Y</given-names>
</name>
<name><surname>de la Bastide</surname>
<given-names>M</given-names>
</name>
<name><surname>Hamilton</surname>
<given-names>J</given-names>
</name>
<name><surname>Kanamori</surname>
<given-names>H</given-names>
</name>
<name><surname>McCombie</surname>
<given-names>WR</given-names>
</name>
<name><surname>Ouyang</surname>
<given-names>S</given-names>
</name>
<name><surname>Schwartz</surname>
<given-names>D</given-names>
</name>
<name><surname>Tanaka</surname>
<given-names>T</given-names>
</name>
<name><surname>Wu</surname>
<given-names>J</given-names>
</name>
<name><surname>Zhou</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>Improvement of the <italic>Oryza sativa Nipponbare</italic>
reference genome using next generation sequence and optical map data</article-title>
<source>Rice</source>
<year>2013</year>
<volume>6</volume>
<fpage>1</fpage>
<lpage>10</lpage>
<pub-id pub-id-type="doi">10.1186/1939-8433-6-4</pub-id>
<pub-id pub-id-type="pmid">24280096</pub-id>
</element-citation>
</ref>
<ref id="CR34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kinoshita</surname>
<given-names>T</given-names>
</name>
</person-group>
<article-title>Report of the committee on gene symbolization, nomenclature and linkage groups</article-title>
<source>Rice Genet Newsl</source>
<year>1991</year>
<volume>8</volume>
<fpage>2</fpage>
<lpage>37</lpage>
</element-citation>
</ref>
<ref id="CR35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kinoshita</surname>
<given-names>T</given-names>
</name>
</person-group>
<article-title>Report of the committee on gene symbolization, nomenclature and linkage groups</article-title>
<source>Rice Genet Newsl</source>
<year>1993</year>
<volume>10</volume>
<fpage>7</fpage>
<lpage>39</lpage>
</element-citation>
</ref>
<ref id="CR36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Koide</surname>
<given-names>Y</given-names>
</name>
<name><surname>Onishi</surname>
<given-names>K</given-names>
</name>
<name><surname>Nishimoto</surname>
<given-names>D</given-names>
</name>
<name><surname>Baruah</surname>
<given-names>AR</given-names>
</name>
<name><surname>Kanazawa</surname>
<given-names>A</given-names>
</name>
<name><surname>Sano</surname>
<given-names>Y</given-names>
</name>
</person-group>
<article-title>Sex-independent transmission ratio distortion system responsible for reproductive barriers between Asian and African rice species</article-title>
<source>New Phytol</source>
<year>2008</year>
<volume>179</volume>
<fpage>888</fpage>
<lpage>900</lpage>
<pub-id pub-id-type="doi">10.1111/j.1469-8137.2008.02490.x</pub-id>
<pub-id pub-id-type="pmid">18507773</pub-id>
</element-citation>
</ref>
<ref id="CR37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kosambi</surname>
<given-names>DD</given-names>
</name>
</person-group>
<article-title>The estimation of map distances from recombination values</article-title>
<source>Ann Eugen</source>
<year>1943</year>
<volume>12</volume>
<fpage>172</fpage>
<lpage>175</lpage>
<pub-id pub-id-type="doi">10.1111/j.1469-1809.1943.tb02321.x</pub-id>
</element-citation>
</ref>
<ref id="CR38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kubo</surname>
<given-names>T</given-names>
</name>
<name><surname>Aida</surname>
<given-names>Y</given-names>
</name>
<name><surname>Nakamura</surname>
<given-names>K</given-names>
</name>
<name><surname>Tsunematsu</surname>
<given-names>H</given-names>
</name>
<name><surname>Doi</surname>
<given-names>K</given-names>
</name>
<name><surname>Yoshimura</surname>
<given-names>A</given-names>
</name>
</person-group>
<article-title>Reciprocal chromosome segment substitution series derived from japonica and indica cross of rice (<italic>Oryza sativa</italic>
L.)</article-title>
<source>Breed Sci</source>
<year>2002</year>
<volume>52</volume>
<fpage>319</fpage>
<lpage>325</lpage>
<pub-id pub-id-type="doi">10.1270/jsbbs.52.319</pub-id>
</element-citation>
</ref>
<ref id="CR39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lentini</surname>
<given-names>Z</given-names>
</name>
<name><surname>Reyes</surname>
<given-names>P</given-names>
</name>
<name><surname>Martínez</surname>
<given-names>CP</given-names>
</name>
<name><surname>Roca</surname>
<given-names>WM</given-names>
</name>
</person-group>
<article-title>Androgenesis of highly recalcitrant rice genotypes with maltose and silver nitrate</article-title>
<source>Plant Sci</source>
<year>1995</year>
<volume>110</volume>
<fpage>127</fpage>
<lpage>138</lpage>
<pub-id pub-id-type="doi">10.1016/0168-9452(95)04180-3</pub-id>
</element-citation>
</ref>
<ref id="CR40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname>
<given-names>H</given-names>
</name>
<name><surname>Ye</surname>
<given-names>G</given-names>
</name>
<name><surname>Wang</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>A modified algorithm for the improvement of composite interval mapping</article-title>
<source>Genetics</source>
<year>2007</year>
<volume>175</volume>
<fpage>361</fpage>
<lpage>374</lpage>
<pub-id pub-id-type="doi">10.1534/genetics.106.066811</pub-id>
<pub-id pub-id-type="pmid">17110476</pub-id>
</element-citation>
</ref>
<ref id="CR41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname>
<given-names>S</given-names>
</name>
<name><surname>Yan</surname>
<given-names>S</given-names>
</name>
<name><surname>Wang</surname>
<given-names>A-h</given-names>
</name>
<name><surname>Zou</surname>
<given-names>G</given-names>
</name>
<name><surname>Huang</surname>
<given-names>X</given-names>
</name>
<name><surname>Han</surname>
<given-names>B</given-names>
</name>
<name><surname>Qian</surname>
<given-names>Q</given-names>
</name>
<name><surname>Tao</surname>
<given-names>Y</given-names>
</name>
</person-group>
<article-title>Identification of QTLs associated with tissue culture response through sequencing-based genotyping of RILs derived from 93-11 × <italic>Nipponbare</italic>
in rice (<italic>Oryza sativa</italic>
)</article-title>
<source>Plant Cell Rep</source>
<year>2013</year>
<volume>32</volume>
<fpage>103</fpage>
<lpage>116</lpage>
<pub-id pub-id-type="doi">10.1007/s00299-012-1345-6</pub-id>
<pub-id pub-id-type="pmid">23064615</pub-id>
</element-citation>
</ref>
<ref id="CR42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lin</surname>
<given-names>H</given-names>
</name>
<name><surname>Ashikari</surname>
<given-names>M</given-names>
</name>
<name><surname>Yamanouchi</surname>
<given-names>U</given-names>
</name>
<name><surname>Sasaki</surname>
<given-names>T</given-names>
</name>
<name><surname>Yano</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>Identification and characterization of a quantitative trait locus, <italic>Hd9</italic>
, controlling heading date in rice</article-title>
<source>Breed Sci</source>
<year>2002</year>
<volume>52</volume>
<fpage>35</fpage>
<lpage>41</lpage>
<pub-id pub-id-type="doi">10.1270/jsbbs.52.35</pub-id>
</element-citation>
</ref>
<ref id="CR43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ling</surname>
<given-names>WH</given-names>
</name>
<name><surname>Cheng</surname>
<given-names>QX</given-names>
</name>
<name><surname>Ma</surname>
<given-names>J</given-names>
</name>
<name><surname>Wang</surname>
<given-names>T</given-names>
</name>
</person-group>
<article-title>Red and black rice decrease atherosclerotic plaque formation and increase antioxidant status in rabbits</article-title>
<source>J Nutr</source>
<year>2001</year>
<volume>131</volume>
<fpage>1421</fpage>
<lpage>1426</lpage>
<pub-id pub-id-type="pmid">11340093</pub-id>
</element-citation>
</ref>
<ref id="CR44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Liu</surname>
<given-names>G</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>Z</given-names>
</name>
<name><surname>Zhu</surname>
<given-names>H</given-names>
</name>
<name><surname>Zhao</surname>
<given-names>F</given-names>
</name>
<name><surname>Ding</surname>
<given-names>X</given-names>
</name>
<name><surname>Zeng</surname>
<given-names>R</given-names>
</name>
<name><surname>Li</surname>
<given-names>W</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>G</given-names>
</name>
</person-group>
<article-title>Detection of QTLs with additive effects and additive-by-environment interaction effects on panicle number in rice (<italic>Oryza sativa L</italic>
.) with single-segment substitution lines</article-title>
<source>Theor Appl Genet</source>
<year>2008</year>
<volume>116</volume>
<fpage>923</fpage>
<lpage>931</lpage>
<pub-id pub-id-type="doi">10.1007/s00122-008-0724-4</pub-id>
<pub-id pub-id-type="pmid">18274724</pub-id>
</element-citation>
</ref>
<ref id="CR45"><mixed-citation publication-type="other">Lorieux M (2005) CSSL finder: a free program for managing introgression lines. <ext-link ext-link-type="uri" xlink:href="http://mapdisto.free.fr/CSSLFinder/">http://mapdisto.free.fr/CSSLFinder/</ext-link>
</mixed-citation>
</ref>
<ref id="CR46"><mixed-citation publication-type="other">Lorieux M (2012) MapDisto: fast and efficient computation of genetic linkage maps. Mol Breed 30:1231–1235. doi:10.1007/s11032-012-9706-y. <ext-link ext-link-type="uri" xlink:href="http://mapdisto.free.fr/CSSLFinder/">http://mapdisto.free.fr/CSSLFinder/</ext-link>
</mixed-citation>
</ref>
<ref id="CR47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lorieux</surname>
<given-names>M</given-names>
</name>
<name><surname>Ndjiondjop</surname>
<given-names>M-N</given-names>
</name>
<name><surname>Ghesquière</surname>
<given-names>A</given-names>
</name>
</person-group>
<article-title>A first interspecific <italic>Oryza sativa</italic>
× <italic>Oryza glaberrima</italic>
microsatellite-based genetic linkage map</article-title>
<source>Theor Appl Genet</source>
<year>2000</year>
<volume>100</volume>
<fpage>593</fpage>
<lpage>601</lpage>
</element-citation>
</ref>
<ref id="CR48"><mixed-citation publication-type="other">Lorieux M, Tohme J, McCouch SR, Brondani C, Gridley H, Martinez CP, Diago M (2004) Exploring natural genetic variation: developing genomic resources and introgression lines for four AA genome rice relatives. A proposal to the Generation Challenge Program Standard Grant, pp 1–43</mixed-citation>
</ref>
<ref id="CR49"><mixed-citation publication-type="other">Lu B-R, Silitonga T (1999) Wild rice <italic>Oryza meridionalis</italic>
was first found in Indonesia (notes from field). Int Rice Res Notes 24:28–30</mixed-citation>
</ref>
<ref id="CR50"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Maas</surname>
<given-names>LF</given-names>
</name>
<name><surname>McClung</surname>
<given-names>A</given-names>
</name>
<name><surname>McCouch</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>Dissection of a QTL reveals an adaptive, interacting gene complex associated with transgressive variation for flowering time in rice</article-title>
<source>Theor Appl Genet</source>
<year>2010</year>
<volume>120</volume>
<fpage>895</fpage>
<lpage>908</lpage>
<pub-id pub-id-type="doi">10.1007/s00122-009-1219-7</pub-id>
<pub-id pub-id-type="pmid">19949767</pub-id>
</element-citation>
</ref>
<ref id="CR51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Marri</surname>
<given-names>PR</given-names>
</name>
<name><surname>Sarla</surname>
<given-names>N</given-names>
</name>
<name><surname>Reddy</surname>
<given-names>LV</given-names>
</name>
<name><surname>Siddiq</surname>
<given-names>EA</given-names>
</name>
</person-group>
<article-title>Identification and mapping of yield and yield related QTLs from an Indian accession of <italic>Oryza rufipogon</italic>
</article-title>
<source>BMC Genet</source>
<year>2005</year>
<volume>6</volume>
<fpage>33</fpage>
<pub-id pub-id-type="doi">10.1186/1471-2156-6-33</pub-id>
<pub-id pub-id-type="pmid">15949048</pub-id>
</element-citation>
</ref>
<ref id="CR52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Matsubara</surname>
<given-names>K</given-names>
</name>
<name><surname>Khin-Thidar</surname>
<given-names>Sano Y</given-names>
</name>
</person-group>
<article-title>A gene block causing cross-incompatibility hidden in wild and cultivated rice</article-title>
<source>Genetics</source>
<year>2003</year>
<volume>165</volume>
<fpage>343</fpage>
<lpage>352</lpage>
<pub-id pub-id-type="pmid">14504241</pub-id>
</element-citation>
</ref>
<ref id="CR53"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>McCouch</surname>
<given-names>SR</given-names>
</name>
<name><surname>Kochert</surname>
<given-names>G</given-names>
</name>
<name><surname>Yu</surname>
<given-names>ZH</given-names>
</name>
<name><surname>Wang</surname>
<given-names>ZY</given-names>
</name>
<name><surname>Khush</surname>
<given-names>GS</given-names>
</name>
<name><surname>Coffman</surname>
<given-names>WR</given-names>
</name>
<name><surname>Tanksley</surname>
<given-names>SD</given-names>
</name>
</person-group>
<article-title>Molecular mapping of rice chromosomes</article-title>
<source>Theoret Appl Genetics</source>
<year>1988</year>
<volume>76</volume>
<fpage>815</fpage>
<lpage>829</lpage>
<pub-id pub-id-type="doi">10.1007/BF00273666</pub-id>
<pub-id pub-id-type="pmid">24232389</pub-id>
</element-citation>
</ref>
<ref id="CR54"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>McCouch</surname>
<given-names>SR</given-names>
</name>
<name><surname>Teytelman</surname>
<given-names>L</given-names>
</name>
<name><surname>Xu</surname>
<given-names>Y</given-names>
</name>
<name><surname>Lobos</surname>
<given-names>KB</given-names>
</name>
<name><surname>Clare</surname>
<given-names>K</given-names>
</name>
<name><surname>Walton</surname>
<given-names>M</given-names>
</name>
<name><surname>Fu</surname>
<given-names>B</given-names>
</name>
<name><surname>Maghirang</surname>
<given-names>R</given-names>
</name>
<name><surname>Li</surname>
<given-names>Z</given-names>
</name>
<name><surname>Xing</surname>
<given-names>Y</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>Q</given-names>
</name>
<name><surname>Kono</surname>
<given-names>I</given-names>
</name>
<name><surname>Yano</surname>
<given-names>M</given-names>
</name>
<name><surname>Fjellstrom</surname>
<given-names>R</given-names>
</name>
<name><surname>DeClerck</surname>
<given-names>G</given-names>
</name>
<name><surname>Schneider</surname>
<given-names>D</given-names>
</name>
<name><surname>Cartinhour</surname>
<given-names>S</given-names>
</name>
<name><surname>Ware</surname>
<given-names>D</given-names>
</name>
<name><surname>Stein</surname>
<given-names>L</given-names>
</name>
</person-group>
<article-title>Development and mapping of 2240 new SSR markers for rice (<italic>Oryza sativa L</italic>
.)</article-title>
<source>DNA Res</source>
<year>2002</year>
<volume>9</volume>
<fpage>199</fpage>
<lpage>207</lpage>
<pub-id pub-id-type="doi">10.1093/dnares/9.6.199</pub-id>
<pub-id pub-id-type="pmid">12597276</pub-id>
</element-citation>
</ref>
<ref id="CR55"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>McCouch</surname>
<given-names>SR</given-names>
</name>
<name><surname>Sweeney</surname>
<given-names>M</given-names>
</name>
<name><surname>Li</surname>
<given-names>J</given-names>
</name>
<name><surname>Jiang</surname>
<given-names>H</given-names>
</name>
<name><surname>Thomson</surname>
<given-names>M</given-names>
</name>
<name><surname>Septiningsih</surname>
<given-names>E</given-names>
</name>
<name><surname>Edwards</surname>
<given-names>J</given-names>
</name>
<name><surname>Moncada</surname>
<given-names>P</given-names>
</name>
<name><surname>Xiao</surname>
<given-names>J</given-names>
</name>
<name><surname>Garris</surname>
<given-names>A</given-names>
</name>
<name><surname>Tai</surname>
<given-names>T</given-names>
</name>
<name><surname>Martinez</surname>
<given-names>C</given-names>
</name>
<name><surname>Tohme</surname>
<given-names>J</given-names>
</name>
<name><surname>Sugiono</surname>
<given-names>M</given-names>
</name>
<name><surname>McClung</surname>
<given-names>A</given-names>
</name>
<name><surname>Yuan</surname>
<given-names>LP</given-names>
</name>
<name><surname>Ahn</surname>
<given-names>S-N</given-names>
</name>
</person-group>
<article-title>Through the genetic bottleneck: <italic>O. rufipogon</italic>
as a source of trait-enhancing alleles for <italic>O. sativa</italic>
</article-title>
<source>Euphytica</source>
<year>2007</year>
<volume>154</volume>
<fpage>317</fpage>
<lpage>339</lpage>
<pub-id pub-id-type="doi">10.1007/s10681-006-9210-8</pub-id>
</element-citation>
</ref>
<ref id="CR56"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>McCouch</surname>
<given-names>S</given-names>
</name>
<name><surname>Baute</surname>
<given-names>GJ</given-names>
</name>
<name><surname>Bradeen</surname>
<given-names>J</given-names>
</name>
<name><surname>Bramel</surname>
<given-names>P</given-names>
</name>
<name><surname>Bretting</surname>
<given-names>PK</given-names>
</name>
<name><surname>Buckler</surname>
<given-names>E</given-names>
</name>
<name><surname>Burke</surname>
<given-names>JM</given-names>
</name>
<name><surname>Charest</surname>
<given-names>D</given-names>
</name>
<name><surname>Cloutier</surname>
<given-names>S</given-names>
</name>
<name><surname>Cole</surname>
<given-names>G</given-names>
</name>
<name><surname>Dempewolf</surname>
<given-names>H</given-names>
</name>
<name><surname>Dingkuhn</surname>
<given-names>M</given-names>
</name>
<name><surname>Feuillet</surname>
<given-names>C</given-names>
</name>
<name><surname>Gepts</surname>
<given-names>P</given-names>
</name>
<name><surname>Grattapaglia</surname>
<given-names>D</given-names>
</name>
<name><surname>Guarino</surname>
<given-names>L</given-names>
</name>
<name><surname>Jackson</surname>
<given-names>S</given-names>
</name>
<name><surname>Knapp</surname>
<given-names>S</given-names>
</name>
<name><surname>Langridge</surname>
<given-names>P</given-names>
</name>
<name><surname>Lawton-Rauh</surname>
<given-names>A</given-names>
</name>
<name><surname>Lijua</surname>
<given-names>Q</given-names>
</name>
<name><surname>Lusty</surname>
<given-names>C</given-names>
</name>
<name><surname>Michael</surname>
<given-names>T</given-names>
</name>
<name><surname>Myles</surname>
<given-names>S</given-names>
</name>
<name><surname>Naito</surname>
<given-names>K</given-names>
</name>
<name><surname>Nelson</surname>
<given-names>RL</given-names>
</name>
<name><surname>Pontarollo</surname>
<given-names>R</given-names>
</name>
<name><surname>Richards</surname>
<given-names>CM</given-names>
</name>
<name><surname>Rieseberg</surname>
<given-names>L</given-names>
</name>
<name><surname>Ross-Ibarra</surname>
<given-names>J</given-names>
</name>
<name><surname>Rounsley</surname>
<given-names>S</given-names>
</name>
<name><surname>Hamilton</surname>
<given-names>RS</given-names>
</name>
<name><surname>Schurr</surname>
<given-names>U</given-names>
</name>
<name><surname>Stein</surname>
<given-names>N</given-names>
</name>
<name><surname>Tomooka</surname>
<given-names>N</given-names>
</name>
<name><surname>van der Knaap</surname>
<given-names>E</given-names>
</name>
<name><surname>van Tassel</surname>
<given-names>D</given-names>
</name>
<name><surname>Toll</surname>
<given-names>J</given-names>
</name>
<name><surname>Valls</surname>
<given-names>J</given-names>
</name>
<name><surname>Varshney</surname>
<given-names>RK</given-names>
</name>
<name><surname>Ward</surname>
<given-names>J</given-names>
</name>
<name><surname>Waugh</surname>
<given-names>R</given-names>
</name>
<name><surname>Wenzl</surname>
<given-names>P</given-names>
</name>
<name><surname>Zamir</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Agriculture: feeding the future</article-title>
<source>Nature</source>
<year>2013</year>
<volume>499</volume>
<fpage>23</fpage>
<lpage>24</lpage>
<pub-id pub-id-type="doi">10.1038/499023a</pub-id>
<pub-id pub-id-type="pmid">23823779</pub-id>
</element-citation>
</ref>
<ref id="CR57"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Moncada</surname>
<given-names>P</given-names>
</name>
<name><surname>Martínez</surname>
<given-names>CP</given-names>
</name>
<name><surname>Borrero</surname>
<given-names>J</given-names>
</name>
<name><surname>Chatel</surname>
<given-names>M</given-names>
</name>
<name><surname>Gauch</surname>
<given-names>H</given-names>
<suffix>Jr</suffix>
</name>
<name><surname>Guimaraes</surname>
<given-names>E</given-names>
</name>
<name><surname>Tohme</surname>
<given-names>J</given-names>
</name>
<name><surname>McCouch</surname>
<given-names>SR</given-names>
</name>
</person-group>
<article-title>Quantitative trait loci for yield and yield components in an <italic>Oryza sativa</italic>
× <italic>Oryza rufipogon</italic>
<italic>BC</italic>
<sub><italic>2</italic>
</sub>
<italic>F</italic>
<sub><italic>2</italic>
</sub>
population evaluated in an upland environment</article-title>
<source>Theor Appl Genet</source>
<year>2001</year>
<volume>102</volume>
<fpage>41</fpage>
<lpage>52</lpage>
<pub-id pub-id-type="doi">10.1007/s001220051616</pub-id>
</element-citation>
</ref>
<ref id="CR58"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ng</surname>
<given-names>NQ</given-names>
</name>
<name><surname>Hawkes</surname>
<given-names>JG</given-names>
</name>
<name><surname>Williams</surname>
<given-names>JT</given-names>
</name>
<name><surname>Chang</surname>
<given-names>TT</given-names>
</name>
</person-group>
<article-title>The recognition of a new species of rice (<italic>Oryza</italic>
) from Australia</article-title>
<source>Bot J Linn Soc</source>
<year>1981</year>
<volume>82</volume>
<fpage>327</fpage>
<lpage>330</lpage>
<pub-id pub-id-type="doi">10.1111/j.1095-8339.1981.tb00964.x</pub-id>
</element-citation>
</ref>
<ref id="CR59"><mixed-citation publication-type="other">Ogawa S, Selvaraj MG, Fernando AJ, Lorieux M, Ishitani M, McCouch S, Arbelaez JD (2014) <italic>N</italic>
- and <italic>P</italic>
-mediated seminal root elongation response in rice seedlings. Plant Soil 1–13. doi:10.1007/s11104-013-1955-y</mixed-citation>
</ref>
<ref id="CR60"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Orjuela</surname>
<given-names>J</given-names>
</name>
<name><surname>Garavito</surname>
<given-names>A</given-names>
</name>
<name><surname>Bouniol</surname>
<given-names>M</given-names>
</name>
<name><surname>Arbelaez</surname>
<given-names>J</given-names>
</name>
<name><surname>Moreno</surname>
<given-names>L</given-names>
</name>
<name><surname>Kimball</surname>
<given-names>J</given-names>
</name>
<name><surname>Wilson</surname>
<given-names>G</given-names>
</name>
<name><surname>Rami</surname>
<given-names>J-F</given-names>
</name>
<name><surname>Tohme</surname>
<given-names>J</given-names>
</name>
<name><surname>McCouch</surname>
<given-names>S</given-names>
</name>
<name><surname>Lorieux</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>A universal core genetic map for rice</article-title>
<source>Theor Appl Genet</source>
<year>2009</year>
<pub-id pub-id-type="pmid">19847389</pub-id>
</element-citation>
</ref>
<ref id="CR61"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Panaud</surname>
<given-names>O</given-names>
</name>
<name><surname>Chen</surname>
<given-names>X</given-names>
</name>
<name><surname>McCouch</surname>
<given-names>SR</given-names>
</name>
</person-group>
<article-title>Development of microsatellite markers and characterization of simple sequence length polymorphism (SSLP) in rice (<italic>Oryza sativa L</italic>
.)</article-title>
<source>Mol Gen Genet</source>
<year>1996</year>
<volume>252</volume>
<fpage>597</fpage>
<lpage>607</lpage>
<pub-id pub-id-type="pmid">8914521</pub-id>
</element-citation>
</ref>
<ref id="CR62"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Park</surname>
<given-names>KC</given-names>
</name>
<name><surname>Kim</surname>
<given-names>NH</given-names>
</name>
<name><surname>Cho</surname>
<given-names>YS</given-names>
</name>
<name><surname>Kang</surname>
<given-names>KH</given-names>
</name>
<name><surname>Lee</surname>
<given-names>JK</given-names>
</name>
<name><surname>Kim</surname>
<given-names>N-S</given-names>
</name>
</person-group>
<article-title>Genetic variations of AA genome <italic>Oryza</italic>
species measured by <italic>MITE</italic>
-<italic>AFLP</italic>
</article-title>
<source>Theor Appl Genet</source>
<year>2003</year>
<volume>107</volume>
<fpage>203</fpage>
<lpage>209</lpage>
<pub-id pub-id-type="doi">10.1007/s00122-003-1252-x</pub-id>
<pub-id pub-id-type="pmid">12845436</pub-id>
</element-citation>
</ref>
<ref id="CR63"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Periyannan</surname>
<given-names>S</given-names>
</name>
<name><surname>Moore</surname>
<given-names>J</given-names>
</name>
<name><surname>Ayliffe</surname>
<given-names>M</given-names>
</name>
<name><surname>Bansal</surname>
<given-names>U</given-names>
</name>
<name><surname>Wang</surname>
<given-names>X</given-names>
</name>
<name><surname>Huang</surname>
<given-names>L</given-names>
</name>
<name><surname>Deal</surname>
<given-names>K</given-names>
</name>
<name><surname>Luo</surname>
<given-names>M</given-names>
</name>
<name><surname>Kong</surname>
<given-names>X</given-names>
</name>
<name><surname>Bariana</surname>
<given-names>H</given-names>
</name>
<name><surname>Mago</surname>
<given-names>R</given-names>
</name>
<name><surname>McIntosh</surname>
<given-names>R</given-names>
</name>
<name><surname>Dodds</surname>
<given-names>P</given-names>
</name>
<name><surname>Dvorak</surname>
<given-names>J</given-names>
</name>
<name><surname>Lagudah</surname>
<given-names>E</given-names>
</name>
</person-group>
<article-title>The gene <italic>Sr33</italic>
, an ortholog of barley <italic>Mla</italic>
genes, encodes resistance to wheat stem rust race <italic>Ug99</italic>
</article-title>
<source>Science</source>
<year>2013</year>
<pub-id pub-id-type="pmid">23811228</pub-id>
</element-citation>
</ref>
<ref id="CR64"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ray</surname>
<given-names>DK</given-names>
</name>
<name><surname>Mueller</surname>
<given-names>ND</given-names>
</name>
<name><surname>West</surname>
<given-names>PC</given-names>
</name>
<name><surname>Foley</surname>
<given-names>JA</given-names>
</name>
</person-group>
<article-title>Yield trends are insufficient to double global crop production by 2050</article-title>
<source>PLoS ONE</source>
<year>2013</year>
<volume>8</volume>
<fpage>e66428</fpage>
<pub-id pub-id-type="doi">10.1371/journal.pone.0066428</pub-id>
<pub-id pub-id-type="pmid">23840465</pub-id>
</element-citation>
</ref>
<ref id="CR65"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ren</surname>
<given-names>F</given-names>
</name>
<name><surname>Lu</surname>
<given-names>B-R</given-names>
</name>
<name><surname>Li</surname>
<given-names>S</given-names>
</name>
<name><surname>Huang</surname>
<given-names>J</given-names>
</name>
<name><surname>Zhu</surname>
<given-names>Y</given-names>
</name>
</person-group>
<article-title>A comparative study of genetic relationships among the <italic>AA</italic>
-genome <italic>Oryza</italic>
species using RAPD and SSR markers</article-title>
<source>Theor Appl Genet</source>
<year>2003</year>
<volume>108</volume>
<fpage>113</fpage>
<lpage>120</lpage>
<pub-id pub-id-type="doi">10.1007/s00122-003-1414-x</pub-id>
<pub-id pub-id-type="pmid">14504744</pub-id>
</element-citation>
</ref>
<ref id="CR66"><mixed-citation publication-type="other">Rha ES, Thseng FS, Wu ST (1995) Distorted segregation of marker genes in wide crosses of rice. J Agric Assoc China 170:104–123</mixed-citation>
</ref>
<ref id="CR67"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Romero</surname>
<given-names>LE</given-names>
</name>
<name><surname>Lozano</surname>
<given-names>I</given-names>
</name>
<name><surname>Garavito</surname>
<given-names>A</given-names>
</name>
<name><surname>Carabali</surname>
<given-names>SJ</given-names>
</name>
<name><surname>Triana</surname>
<given-names>M</given-names>
</name>
<name><surname>Villareal</surname>
<given-names>N</given-names>
</name>
<name><surname>Reyes</surname>
<given-names>L</given-names>
</name>
<name><surname>Duque</surname>
<given-names>MC</given-names>
</name>
<name><surname>Martinez</surname>
<given-names>CP</given-names>
</name>
<name><surname>Calvert</surname>
<given-names>L</given-names>
</name>
<name><surname>Lorieux</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>Major QTLs control resistance to rice hoja blanca virus and its vector <italic>Tagosodes orizicolus</italic>
</article-title>
<source>G3</source>
<year>2014</year>
<volume>4</volume>
<fpage>133</fpage>
<lpage>142</lpage>
<pub-id pub-id-type="doi">10.1534/g3.113.009373</pub-id>
<pub-id pub-id-type="pmid">24240781</pub-id>
</element-citation>
</ref>
<ref id="CR68"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Saintenac</surname>
<given-names>C</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>W</given-names>
</name>
<name><surname>Salcedo</surname>
<given-names>A</given-names>
</name>
<name><surname>Rouse</surname>
<given-names>MN</given-names>
</name>
<name><surname>Trick</surname>
<given-names>HN</given-names>
</name>
<name><surname>Akhunov</surname>
<given-names>E</given-names>
</name>
<name><surname>Dubcovsky</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>Identification of wheat gene <italic>Sr35</italic>
that confers resistance to <italic>Ug99</italic>
stem rust race group</article-title>
<source>Science</source>
<year>2013</year>
<volume>341</volume>
<fpage>783</fpage>
<lpage>786</lpage>
<pub-id pub-id-type="doi">10.1126/science.1239022</pub-id>
<pub-id pub-id-type="pmid">23811222</pub-id>
</element-citation>
</ref>
<ref id="CR69"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sano</surname>
<given-names>Y</given-names>
</name>
</person-group>
<article-title>The genic nature of gamete eliminator in rice</article-title>
<source>Genetics</source>
<year>1990</year>
<volume>125</volume>
<fpage>183</fpage>
<lpage>191</lpage>
<pub-id pub-id-type="pmid">2341030</pub-id>
</element-citation>
</ref>
<ref id="CR70"><mixed-citation publication-type="other">Sarkarung S (1991) A simplified crossing method for rice breeding: a manual. CIAT, Cali</mixed-citation>
</ref>
<ref id="CR71"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sasaki</surname>
<given-names>A</given-names>
</name>
<name><surname>Ashikari</surname>
<given-names>M</given-names>
</name>
<name><surname>Ueguchi-Tanaka</surname>
<given-names>M</given-names>
</name>
<name><surname>Itoh</surname>
<given-names>H</given-names>
</name>
<name><surname>Nishimura</surname>
<given-names>A</given-names>
</name>
<name><surname>Swapan</surname>
<given-names>D</given-names>
</name>
<name><surname>Ishiyama</surname>
<given-names>K</given-names>
</name>
<name><surname>Saito</surname>
<given-names>T</given-names>
</name>
<name><surname>Kobayashi</surname>
<given-names>M</given-names>
</name>
<name><surname>Khush</surname>
<given-names>GS</given-names>
</name>
<name><surname>Kitano</surname>
<given-names>H</given-names>
</name>
<name><surname>Matsuoka</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>Green revolution: a mutant gibberellin-synthesis gene in rice</article-title>
<source>Nature</source>
<year>2002</year>
<volume>416</volume>
<fpage>701</fpage>
<lpage>702</lpage>
<pub-id pub-id-type="doi">10.1038/416701a</pub-id>
<pub-id pub-id-type="pmid">11961544</pub-id>
</element-citation>
</ref>
<ref id="CR72"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Septiningsih</surname>
<given-names>EM</given-names>
</name>
<name><surname>Trijatmiko</surname>
<given-names>KR</given-names>
</name>
<name><surname>Moeljopawiro</surname>
<given-names>S</given-names>
</name>
<name><surname>McCouch</surname>
<given-names>SR</given-names>
</name>
</person-group>
<article-title>Identification of quantitative trait loci for grain quality in an advanced backcross population derived from the <italic>Oryza sativa</italic>
variety IR64 and the wild relative <italic>O. rufipogon</italic>
</article-title>
<source>Theor Appl Genet</source>
<year>2003</year>
<volume>107</volume>
<fpage>1433</fpage>
<lpage>1441</lpage>
<pub-id pub-id-type="doi">10.1007/s00122-003-1376-z</pub-id>
<pub-id pub-id-type="pmid">14513216</pub-id>
</element-citation>
</ref>
<ref id="CR73"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sonah</surname>
<given-names>H</given-names>
</name>
<name><surname>Bastien</surname>
<given-names>M</given-names>
</name>
<name><surname>Iquira</surname>
<given-names>E</given-names>
</name>
<name><surname>Tardivel</surname>
<given-names>A</given-names>
</name>
<name><surname>Légaré</surname>
<given-names>G</given-names>
</name>
<name><surname>Boyle</surname>
<given-names>B</given-names>
</name>
<name><surname>Normandeau</surname>
<given-names>É</given-names>
</name>
<name><surname>Laroche</surname>
<given-names>J</given-names>
</name>
<name><surname>Larose</surname>
<given-names>S</given-names>
</name>
<name><surname>Jean</surname>
<given-names>M</given-names>
</name>
<name><surname>Belzile</surname>
<given-names>F</given-names>
</name>
</person-group>
<article-title>An improved genotyping by sequencing (GBS) approach offering increased versatility and efficiency of SNP discovery and genotyping</article-title>
<source>PLoS ONE</source>
<year>2013</year>
<volume>8</volume>
<fpage>e54603</fpage>
<pub-id pub-id-type="doi">10.1371/journal.pone.0054603</pub-id>
<pub-id pub-id-type="pmid">23372741</pub-id>
</element-citation>
</ref>
<ref id="CR74"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Song</surname>
<given-names>W-Y</given-names>
</name>
<name><surname>Wang</surname>
<given-names>G-L</given-names>
</name>
<name><surname>Chen</surname>
<given-names>L-L</given-names>
</name>
<name><surname>Kim</surname>
<given-names>H-S</given-names>
</name>
<name><surname>Pi</surname>
<given-names>L-Y</given-names>
</name>
<name><surname>Holsten</surname>
<given-names>T</given-names>
</name>
<name><surname>Gardner</surname>
<given-names>J</given-names>
</name>
<name><surname>Wang</surname>
<given-names>B</given-names>
</name>
<name><surname>Zhai</surname>
<given-names>W-X</given-names>
</name>
<name><surname>Zhu</surname>
<given-names>L-H</given-names>
</name>
<name><surname>Fauquet</surname>
<given-names>C</given-names>
</name>
<name><surname>Ronald</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>A receptor kinase-like protein encoded by the rice disease resistance gene, <italic>Xa21</italic>
</article-title>
<source>Science</source>
<year>1995</year>
<volume>270</volume>
<fpage>1804</fpage>
<lpage>1806</lpage>
<pub-id pub-id-type="doi">10.1126/science.270.5243.1804</pub-id>
<pub-id pub-id-type="pmid">8525370</pub-id>
</element-citation>
</ref>
<ref id="CR75"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Spindel</surname>
<given-names>J</given-names>
</name>
<name><surname>Wright</surname>
<given-names>M</given-names>
</name>
<name><surname>Chen</surname>
<given-names>C</given-names>
</name>
<name><surname>Cobb</surname>
<given-names>J</given-names>
</name>
<name><surname>Gage</surname>
<given-names>J</given-names>
</name>
<name><surname>Harrington</surname>
<given-names>S</given-names>
</name>
<name><surname>Lorieux</surname>
<given-names>M</given-names>
</name>
<name><surname>Ahmadi</surname>
<given-names>N</given-names>
</name>
<name><surname>McCouch</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>Bridging the genotyping gap: using genotyping by sequencing (GBS) to add high-density SNP markers and new value to traditional bi-parental mapping and breeding populations</article-title>
<source>Theor Appl Genet</source>
<year>2013</year>
<pub-id pub-id-type="pmid">23918062</pub-id>
</element-citation>
</ref>
<ref id="CR76"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sweeney</surname>
<given-names>MT</given-names>
</name>
<name><surname>Thomson</surname>
<given-names>MJ</given-names>
</name>
<name><surname>Pfeil</surname>
<given-names>BE</given-names>
</name>
<name><surname>McCouch</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>Caught red-handed: <italic>Rc</italic>
encodes a basic helix-loop-helix protein conditioning red pericarp in rice</article-title>
<source>Plant Cell</source>
<year>2006</year>
<volume>18</volume>
<fpage>283</fpage>
<lpage>294</lpage>
<pub-id pub-id-type="doi">10.1105/tpc.105.038430</pub-id>
<pub-id pub-id-type="pmid">16399804</pub-id>
</element-citation>
</ref>
<ref id="CR77"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sweeney</surname>
<given-names>MT</given-names>
</name>
<name><surname>Thomson</surname>
<given-names>MJ</given-names>
</name>
<name><surname>Cho</surname>
<given-names>YG</given-names>
</name>
<name><surname>Park</surname>
<given-names>YJ</given-names>
</name>
<name><surname>Williamson</surname>
<given-names>SH</given-names>
</name>
<name><surname>Bustamante</surname>
<given-names>CD</given-names>
</name>
<name><surname>McCouch</surname>
<given-names>SR</given-names>
</name>
</person-group>
<article-title>Global dissemination of a single mutation conferring white pericarp in rice</article-title>
<source>PLoS Genet</source>
<year>2007</year>
<volume>3</volume>
<fpage>e133</fpage>
<pub-id pub-id-type="doi">10.1371/journal.pgen.0030133</pub-id>
<pub-id pub-id-type="pmid">17696613</pub-id>
</element-citation>
</ref>
<ref id="CR78"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tadege</surname>
<given-names>M</given-names>
</name>
<name><surname>Sheldon</surname>
<given-names>CC</given-names>
</name>
<name><surname>Helliwell</surname>
<given-names>CA</given-names>
</name>
<name><surname>Upadhyaya</surname>
<given-names>NM</given-names>
</name>
<name><surname>Dennis</surname>
<given-names>ES</given-names>
</name>
<name><surname>Peacock</surname>
<given-names>WJ</given-names>
</name>
</person-group>
<article-title>Reciprocal control of flowering time by <italic>OsSOC1</italic>
in transgenic Arabidopsis and by <italic>FL</italic>
C in transgenic rice</article-title>
<source>Plant Biotechnol J</source>
<year>2003</year>
<volume>1</volume>
<fpage>361</fpage>
<lpage>369</lpage>
<pub-id pub-id-type="doi">10.1046/j.1467-7652.2003.00034.x</pub-id>
<pub-id pub-id-type="pmid">17166135</pub-id>
</element-citation>
</ref>
<ref id="CR79"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Takahashi</surname>
<given-names>Y</given-names>
</name>
<name><surname>Shomura</surname>
<given-names>A</given-names>
</name>
<name><surname>Sasaki</surname>
<given-names>T</given-names>
</name>
<name><surname>Yano</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title><italic>Hd6</italic>
, a rice quantitative trait locus involved in photoperiod sensitivity, encodes the α subunit of protein kinase CK2</article-title>
<source>PNAS</source>
<year>2001</year>
<volume>98</volume>
<fpage>7922</fpage>
<lpage>7927</lpage>
<pub-id pub-id-type="doi">10.1073/pnas.111136798</pub-id>
<pub-id pub-id-type="pmid">11416158</pub-id>
</element-citation>
</ref>
<ref id="CR80"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tanksley</surname>
<given-names>SD</given-names>
</name>
<name><surname>McCouch</surname>
<given-names>SR</given-names>
</name>
</person-group>
<article-title>Seed banks and molecular maps: unlocking genetic potential from the wild</article-title>
<source>Science</source>
<year>1997</year>
<volume>277</volume>
<fpage>1063</fpage>
<lpage>1066</lpage>
<pub-id pub-id-type="doi">10.1126/science.277.5329.1063</pub-id>
<pub-id pub-id-type="pmid">9262467</pub-id>
</element-citation>
</ref>
<ref id="CR81"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tanksley</surname>
<given-names>SD</given-names>
</name>
<name><surname>Nelson</surname>
<given-names>JC</given-names>
</name>
</person-group>
<article-title>Advanced backcross QTL analysis: a method for the simultaneous discovery and transfer of valuable QTLs from unadapted germplasm into elite breeding lines</article-title>
<source>Theoret Appl Genet</source>
<year>1996</year>
<volume>92</volume>
<fpage>191</fpage>
<lpage>203</lpage>
<pub-id pub-id-type="doi">10.1007/BF00223376</pub-id>
<pub-id pub-id-type="pmid">24166168</pub-id>
</element-citation>
</ref>
<ref id="CR82"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tester</surname>
<given-names>M</given-names>
</name>
<name><surname>Langridge</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>Breeding technologies to increase crop production in a changing world</article-title>
<source>Science</source>
<year>2010</year>
<volume>327</volume>
<fpage>818</fpage>
<lpage>822</lpage>
<pub-id pub-id-type="doi">10.1126/science.1183700</pub-id>
<pub-id pub-id-type="pmid">20150489</pub-id>
</element-citation>
</ref>
<ref id="CR83"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Thomson</surname>
<given-names>MJ</given-names>
</name>
<name><surname>Tai</surname>
<given-names>TH</given-names>
</name>
<name><surname>McClung</surname>
<given-names>AM</given-names>
</name>
<name><surname>Lai</surname>
<given-names>X-H</given-names>
</name>
<name><surname>Hinga</surname>
<given-names>ME</given-names>
</name>
<name><surname>Lobos</surname>
<given-names>KB</given-names>
</name>
<name><surname>Xu</surname>
<given-names>Y</given-names>
</name>
<name><surname>Martinez</surname>
<given-names>CP</given-names>
</name>
<name><surname>McCouch</surname>
<given-names>SR</given-names>
</name>
</person-group>
<article-title>Mapping quantitative trait loci for yield, yield components and morphological traits in an advanced backcross population between <italic>Oryza rufipogon</italic>
and the <italic>Oryza sativa</italic>
cultivar Jefferson</article-title>
<source>Theor Appl Genet</source>
<year>2003</year>
<volume>107</volume>
<fpage>479</fpage>
<lpage>493</lpage>
<pub-id pub-id-type="doi">10.1007/s00122-003-1270-8</pub-id>
<pub-id pub-id-type="pmid">12736777</pub-id>
</element-citation>
</ref>
<ref id="CR84"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Thomson</surname>
<given-names>MJ</given-names>
</name>
<name><surname>Edwards</surname>
<given-names>JD</given-names>
</name>
<name><surname>Septiningsih</surname>
<given-names>EM</given-names>
</name>
<name><surname>Harrington</surname>
<given-names>SE</given-names>
</name>
<name><surname>McCouch</surname>
<given-names>SR</given-names>
</name>
</person-group>
<article-title>Substitution mapping of <italic>dth1.1</italic>
, a flowering-time quantitative trait locus (QTL) associated with transgressive variation in rice, reveals multiple sub-QTL</article-title>
<source>Genetics</source>
<year>2006</year>
<volume>172</volume>
<fpage>2501</fpage>
<lpage>2514</lpage>
<pub-id pub-id-type="doi">10.1534/genetics.105.050500</pub-id>
<pub-id pub-id-type="pmid">16452146</pub-id>
</element-citation>
</ref>
<ref id="CR85"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tian</surname>
<given-names>F</given-names>
</name>
<name><surname>Li</surname>
<given-names>D</given-names>
</name>
<name><surname>Fu</surname>
<given-names>Q</given-names>
</name>
<name><surname>Zhu</surname>
<given-names>Z</given-names>
</name>
<name><surname>Fu</surname>
<given-names>Y</given-names>
</name>
<name><surname>Wang</surname>
<given-names>X</given-names>
</name>
<name><surname>Sun</surname>
<given-names>C</given-names>
</name>
</person-group>
<article-title>Construction of introgression lines carrying wild rice (<italic>Oryza rufipogon Griff.</italic>
) segments in cultivated rice (<italic>Oryza sativa L.</italic>
) background and characterization of introgressed segments associated with yield-related traits</article-title>
<source>Theor Appl Genet</source>
<year>2006</year>
<volume>112</volume>
<fpage>570</fpage>
<lpage>580</lpage>
<pub-id pub-id-type="doi">10.1007/s00122-005-0165-2</pub-id>
<pub-id pub-id-type="pmid">16331476</pub-id>
</element-citation>
</ref>
<ref id="CR86"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname>
<given-names>ZY</given-names>
</name>
<name><surname>Second</surname>
<given-names>G</given-names>
</name>
<name><surname>Tanksley</surname>
<given-names>SD</given-names>
</name>
</person-group>
<article-title>Polymorphism and phylogenetic relationships among species in the genus <italic>Oryza</italic>
as determined by analysis of nuclear RFLPs</article-title>
<source>Theoret Appl Genet</source>
<year>1992</year>
<volume>83</volume>
<fpage>565</fpage>
<lpage>581</lpage>
<pub-id pub-id-type="doi">10.1007/BF00226900</pub-id>
<pub-id pub-id-type="pmid">24202673</pub-id>
</element-citation>
</ref>
<ref id="CR87"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Xiao</surname>
<given-names>J</given-names>
</name>
<name><surname>Li</surname>
<given-names>J</given-names>
</name>
<name><surname>Grandillo</surname>
<given-names>S</given-names>
</name>
<name><surname>Ahn</surname>
<given-names>SN</given-names>
</name>
<name><surname>Yuan</surname>
<given-names>L</given-names>
</name>
<name><surname>Tanksley</surname>
<given-names>SD</given-names>
</name>
<name><surname>McCouch</surname>
<given-names>SR</given-names>
</name>
</person-group>
<article-title>Identification of trait-improving quantitative trait loci alleles from a wild rice relative, <italic>Oryza rufipogon</italic>
</article-title>
<source>Genetics</source>
<year>1998</year>
<volume>150</volume>
<fpage>899</fpage>
<lpage>909</lpage>
<pub-id pub-id-type="pmid">9755218</pub-id>
</element-citation>
</ref>
<ref id="CR88"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Xu</surname>
<given-names>Y</given-names>
</name>
<name><surname>Zhu</surname>
<given-names>L</given-names>
</name>
<name><surname>Xiao</surname>
<given-names>J</given-names>
</name>
<name><surname>Huang</surname>
<given-names>N</given-names>
</name>
<name><surname>McCouch</surname>
<given-names>SR</given-names>
</name>
</person-group>
<article-title>Chromosomal regions associated with segregation distortion of molecular markers in <italic>F</italic>
<sub><italic>2</italic>
</sub>
, backcross, doubled haploid, and recombinant inbred populations in rice (<italic>Oryza sativa L.</italic>
)</article-title>
<source>Mol Gen Genet</source>
<year>1997</year>
<volume>253</volume>
<fpage>535</fpage>
<lpage>545</lpage>
<pub-id pub-id-type="doi">10.1007/s004380050355</pub-id>
<pub-id pub-id-type="pmid">9065686</pub-id>
</element-citation>
</ref>
<ref id="CR89"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Xu</surname>
<given-names>J</given-names>
</name>
<name><surname>Zhao</surname>
<given-names>Q</given-names>
</name>
<name><surname>Du</surname>
<given-names>P</given-names>
</name>
<name><surname>Xu</surname>
<given-names>C</given-names>
</name>
<name><surname>Wang</surname>
<given-names>B</given-names>
</name>
<name><surname>Feng</surname>
<given-names>Q</given-names>
</name>
<name><surname>Liu</surname>
<given-names>Q</given-names>
</name>
<name><surname>Tang</surname>
<given-names>S</given-names>
</name>
<name><surname>Gu</surname>
<given-names>M</given-names>
</name>
<name><surname>Han</surname>
<given-names>B</given-names>
</name>
<name><surname>Liang</surname>
<given-names>G</given-names>
</name>
</person-group>
<article-title>Developing high throughput genotyped chromosome segment substitution lines based on population whole-genome re-sequencing in rice (<italic>Oryza sativa L.</italic>
)</article-title>
<source>BMC Genom</source>
<year>2010</year>
<volume>11</volume>
<fpage>656</fpage>
<pub-id pub-id-type="doi">10.1186/1471-2164-11-656</pub-id>
</element-citation>
</ref>
<ref id="CR90"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yano</surname>
<given-names>M</given-names>
</name>
<name><surname>Katayose</surname>
<given-names>Y</given-names>
</name>
<name><surname>Ashikari</surname>
<given-names>M</given-names>
</name>
<name><surname>Yamanouchi</surname>
<given-names>U</given-names>
</name>
<name><surname>Monna</surname>
<given-names>L</given-names>
</name>
<name><surname>Fuse</surname>
<given-names>T</given-names>
</name>
<name><surname>Baba</surname>
<given-names>T</given-names>
</name>
<name><surname>Yamamoto</surname>
<given-names>K</given-names>
</name>
<name><surname>Umehara</surname>
<given-names>Y</given-names>
</name>
<name><surname>Nagamura</surname>
<given-names>Y</given-names>
</name>
<name><surname>Sasaki</surname>
<given-names>T</given-names>
</name>
</person-group>
<article-title><italic>Hd1</italic>
, a major photoperiod sensitivity quantitative trait locus in rice, is closely related to the arabidopsis flowering time gene <italic>CONSTANS</italic>
</article-title>
<source>Plant Cell</source>
<year>2000</year>
<volume>12</volume>
<fpage>2473</fpage>
<lpage>2483</lpage>
<pub-id pub-id-type="doi">10.1105/tpc.12.12.2473</pub-id>
<pub-id pub-id-type="pmid">11148291</pub-id>
</element-citation>
</ref>
<ref id="CR91"><mixed-citation publication-type="other">Yoshimura A, Nagayama H, Sobrizal, Kurakazu T, Sanchez PL, Doi K, Yamagata Y, Yasui H (2010) Introgression lines of rice (<italic>Oryza sativa</italic>
L.) carrying a donor genome from the wild species, <italic>O. glumaepatula</italic>
Steud. and <italic>O. meridionalis</italic>
Ng. Breed Sci 60:597–603. doi:10.1270/jsbbs.60.597</mixed-citation>
</ref>
<ref id="CR92"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zamir</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Improving plant breeding with exotic genetic libraries</article-title>
<source>Nat Rev Genet</source>
<year>2001</year>
<volume>2</volume>
<fpage>983</fpage>
<lpage>989</lpage>
<pub-id pub-id-type="doi">10.1038/35103590</pub-id>
<pub-id pub-id-type="pmid">11733751</pub-id>
</element-citation>
</ref>
<ref id="CR93"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhu</surname>
<given-names>Q</given-names>
</name>
<name><surname>Ge</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>Phylogenetic relationships among <italic>A</italic>
-genome species of the genus <italic>Oryza</italic>
revealed by intron sequences of four nuclear genes</article-title>
<source>New Phytol</source>
<year>2005</year>
<volume>167</volume>
<fpage>249</fpage>
<lpage>265</lpage>
<pub-id pub-id-type="doi">10.1111/j.1469-8137.2005.01406.x</pub-id>
<pub-id pub-id-type="pmid">15948847</pub-id>
</element-citation>
</ref>
<ref id="CR94"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhu</surname>
<given-names>T</given-names>
</name>
<name><surname>Xu</surname>
<given-names>P-Z</given-names>
</name>
<name><surname>Liu</surname>
<given-names>J-P</given-names>
</name>
<name><surname>Peng</surname>
<given-names>S</given-names>
</name>
<name><surname>Mo</surname>
<given-names>X-C</given-names>
</name>
<name><surname>Gao</surname>
<given-names>L-Z</given-names>
</name>
</person-group>
<article-title>Phylogenetic relationships and genome divergence among the <italic>AA</italic>
- genome species of the genus <italic>Oryza</italic>
as revealed by 53 nuclear genes and 16 intergenic regions</article-title>
<source>Mol Phylogenet Evol</source>
<year>2014</year>
<volume>70</volume>
<fpage>348</fpage>
<lpage>361</lpage>
<pub-id pub-id-type="doi">10.1016/j.ympev.2013.10.008</pub-id>
<pub-id pub-id-type="pmid">24148990</pub-id>
</element-citation>
</ref>
</ref-list>
</back>
</pmc>
</record>
Pour manipuler ce document sous Unix (Dilib)
EXPLOR_STEP=$WICRI_ROOT/Wicri/Asie/explor/AustralieFrV1/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000D789 | SxmlIndent | more
Ou
HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 000D789 | SxmlIndent | more
Pour mettre un lien sur cette page dans le réseau Wicri
{{Explor lien |wiki= Wicri/Asie |area= AustralieFrV1 |flux= Pmc |étape= Corpus |type= RBID |clé= |texte= }}
![]() | This area was generated with Dilib version V0.6.33. | ![]() |