Mitochondrial genetic diversity, selection and recombination in a canine transmissible cancer
Identifieur interne : 000647 ( Pmc/Corpus ); précédent : 000646; suivant : 000648Mitochondrial genetic diversity, selection and recombination in a canine transmissible cancer
Auteurs : Andrea Strakova ; Máire Ní Leathlobhair ; Guo-Dong Wang ; Ting-Ting Yin ; Ilona Airikkala-Otter ; Janice L. Allen ; Karen M. Allum ; Leontine Bansse-Issa ; Jocelyn L. Bisson ; Artemio Castillo Domracheva ; Karina F. De Castro ; Anne M. Corrigan ; Hugh R. Cran ; Jane T. Crawford ; Stephen M. Cutter ; Laura Delgadillo Keenan ; Edward M. Donelan ; Ibikunle A. Faramade ; Erika Flores Reynoso ; Eleni Fotopoulou ; Skye N. Fruean ; Fanny Gallardo-Arrieta ; Olga Glebova ; Rodrigo F. H Felin Manrique ; Joaquim Jgp Henriques ; Natalia Ignatenko ; Debbie Koenig ; Marta Lanza-Perea ; Remo Lobetti ; Adriana M. Lopez Quintana ; Thibault Losfelt ; Gabriele Marino ; Inigo Martincorena ; Sim N Martínez Casta Eda ; Mayra F. Martínez-L Pez ; Michael Meyer ; Berna Nakanwagi ; Andrigo B. De Nardi ; Winifred Neunzig ; Sally J. Nixon ; Marsden M. Onsare ; Antonio Ortega-Pacheco ; Maria C. Peleteiro ; Ruth J. Pye ; John F. Reece ; Jose Rojas Gutierrez ; Haleema Sadia ; Sheila K. Schmeling ; Olga Shamanova ; Richard K. Ssuna ; Audrey E. Steenland-Smit ; Alla Svitich ; Ismail Thoya Ngoka ; Bogdan A. Vi Laru ; Anna P. De Vos ; Johan P. De Vos ; Oliver Walkinton ; David C. Wedge ; Alvaro S. Wehrle-Martinez ; Mirjam G. Van Der Wel ; Sophie Ae Widdowson ; Elizabeth P. MurchisonSource :
- eLife [ 2050-084X ] ; ????.
Abstract
Canine transmissible venereal tumour (CTVT) is a clonally transmissible cancer that originated approximately 11,000 years ago and affects dogs worldwide. Despite the clonal origin of the CTVT nuclear genome, CTVT mitochondrial genomes (mtDNAs) have been acquired by periodic capture from transient hosts. We sequenced 449 complete mtDNAs from a global population of CTVTs, and show that mtDNA horizontal transfer has occurred at least five times, delineating five tumour clades whose distributions track two millennia of dog global migration. Negative selection has operated to prevent accumulation of deleterious mutations in captured mtDNA, and recombination has caused occasional mtDNA re-assortment. These findings implicate functional mtDNA as a driver of CTVT global metastatic spread, further highlighting the important role of mtDNA in cancer evolution.
Url:
DOI: 10.7554/eLife.14552
PubMed: 27185408
PubMed Central: 4869914
Links to Exploration step
PMC:4869914Le document en format XML
<record><TEI><teiHeader><fileDesc><titleStmt><title xml:lang="en">Mitochondrial genetic diversity, selection and recombination in a canine transmissible cancer</title>
<author><name sortKey="Strakova, Andrea" sort="Strakova, Andrea" uniqKey="Strakova A" first="Andrea" last="Strakova">Andrea Strakova</name>
<affiliation><nlm:aff id="aff1"><institution content-type="dept">Department of Veterinary Medicine</institution>
,<institution>University of Cambridge</institution>
,<addr-line>Cambridge</addr-line>
,<country>United Kingdom</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Ni Leathlobhair, Maire" sort="Ni Leathlobhair, Maire" uniqKey="Ni Leathlobhair M" first="Máire" last="Ní Leathlobhair">Máire Ní Leathlobhair</name>
<affiliation><nlm:aff id="aff1"><institution content-type="dept">Department of Veterinary Medicine</institution>
,<institution>University of Cambridge</institution>
,<addr-line>Cambridge</addr-line>
,<country>United Kingdom</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Wang, Guo Dong" sort="Wang, Guo Dong" uniqKey="Wang G" first="Guo-Dong" last="Wang">Guo-Dong Wang</name>
<affiliation><nlm:aff id="aff2"><institution content-type="dept">State Key Laboratory of Genetic Resources and Evolution, Yunnan Laboratory of Molecular Biology of Domestic Animals, Kunming Institute of Zoology</institution>
,<institution>Chinese Academy of Sciences</institution>
,<addr-line>Kunming</addr-line>
,<country>China</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Yin, Ting Ting" sort="Yin, Ting Ting" uniqKey="Yin T" first="Ting-Ting" last="Yin">Ting-Ting Yin</name>
<affiliation><nlm:aff id="aff2"><institution content-type="dept">State Key Laboratory of Genetic Resources and Evolution, Yunnan Laboratory of Molecular Biology of Domestic Animals, Kunming Institute of Zoology</institution>
,<institution>Chinese Academy of Sciences</institution>
,<addr-line>Kunming</addr-line>
,<country>China</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Airikkala Otter, Ilona" sort="Airikkala Otter, Ilona" uniqKey="Airikkala Otter I" first="Ilona" last="Airikkala-Otter">Ilona Airikkala-Otter</name>
<affiliation><nlm:aff id="aff3"><institution content-type="dept">International Training Center</institution>
,<institution>Worldwide Veterinary Service</institution>
,<addr-line>Aruvankadu</addr-line>
,<country>India</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Allen, Janice L" sort="Allen, Janice L" uniqKey="Allen J" first="Janice L" last="Allen">Janice L. Allen</name>
<affiliation><nlm:aff id="aff4"><institution>Animal Management in Rural and Remote Indigenous Communities</institution>
,<addr-line>Darwin</addr-line>
,<country>Australia</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Allum, Karen M" sort="Allum, Karen M" uniqKey="Allum K" first="Karen M" last="Allum">Karen M. Allum</name>
<affiliation><nlm:aff id="aff5"><institution>World Vets</institution>
,<addr-line>Fargo</addr-line>
,<country>United States</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Bansse Issa, Leontine" sort="Bansse Issa, Leontine" uniqKey="Bansse Issa L" first="Leontine" last="Bansse-Issa">Leontine Bansse-Issa</name>
<affiliation><nlm:aff id="aff6"><institution>Stichting Dierenbescherming Suriname</institution>
,<addr-line>Paramaribo</addr-line>
,<country>Suriname</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Bisson, Jocelyn L" sort="Bisson, Jocelyn L" uniqKey="Bisson J" first="Jocelyn L" last="Bisson">Jocelyn L. Bisson</name>
<affiliation><nlm:aff id="aff1"><institution content-type="dept">Department of Veterinary Medicine</institution>
,<institution>University of Cambridge</institution>
,<addr-line>Cambridge</addr-line>
,<country>United Kingdom</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Castillo Domracheva, Artemio" sort="Castillo Domracheva, Artemio" uniqKey="Castillo Domracheva A" first="Artemio" last="Castillo Domracheva">Artemio Castillo Domracheva</name>
<affiliation><nlm:aff id="aff7"><institution content-type="dept">Corozal Veterinary Hospital</institution>
,<institution>University of Panama</institution>
,<addr-line>Panama City</addr-line>
,<country>Panama</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="De Castro, Karina F" sort="De Castro, Karina F" uniqKey="De Castro K" first="Karina F" last="De Castro">Karina F. De Castro</name>
<affiliation><nlm:aff id="aff8"><institution content-type="dept">Department of Clinical and Veterinary Surgery</institution>
,<institution>São Paulo State University</institution>
,<addr-line>São Paulo</addr-line>
,<country>Brazil</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Corrigan, Anne M" sort="Corrigan, Anne M" uniqKey="Corrigan A" first="Anne M" last="Corrigan">Anne M. Corrigan</name>
<affiliation><nlm:aff id="aff9"><institution>St. George's University</institution>
,<addr-line>True Blue</addr-line>
,<country>Grenada</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Cran, Hugh R" sort="Cran, Hugh R" uniqKey="Cran H" first="Hugh R" last="Cran">Hugh R. Cran</name>
<affiliation><nlm:aff id="aff10"><institution>The Nakuru District Veterinary Scheme Ltd</institution>
,<addr-line>Nakuru</addr-line>
,<country>Kenya</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Crawford, Jane T" sort="Crawford, Jane T" uniqKey="Crawford J" first="Jane T" last="Crawford">Jane T. Crawford</name>
<affiliation><nlm:aff id="aff11"><institution>Animal Medical Centre</institution>
,<addr-line>Belize City</addr-line>
,<country>Belize</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Cutter, Stephen M" sort="Cutter, Stephen M" uniqKey="Cutter S" first="Stephen M" last="Cutter">Stephen M. Cutter</name>
<affiliation><nlm:aff id="aff4"><institution>Animal Management in Rural and Remote Indigenous Communities</institution>
,<addr-line>Darwin</addr-line>
,<country>Australia</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Delgadillo Keenan, Laura" sort="Delgadillo Keenan, Laura" uniqKey="Delgadillo Keenan L" first="Laura" last="Delgadillo Keenan">Laura Delgadillo Keenan</name>
<affiliation><nlm:aff id="aff12"><institution>Veterinary clinic Sr. Dog's</institution>
,<addr-line>Guadalajara</addr-line>
,<country>Mexico</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Donelan, Edward M" sort="Donelan, Edward M" uniqKey="Donelan E" first="Edward M" last="Donelan">Edward M. Donelan</name>
<affiliation><nlm:aff id="aff4"><institution>Animal Management in Rural and Remote Indigenous Communities</institution>
,<addr-line>Darwin</addr-line>
,<country>Australia</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Faramade, Ibikunle A" sort="Faramade, Ibikunle A" uniqKey="Faramade I" first="Ibikunle A" last="Faramade">Ibikunle A. Faramade</name>
<affiliation><nlm:aff id="aff13"><institution>National Veterinary Research Institute</institution>
,<addr-line>Vom</addr-line>
,<country>Nigeria</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Flores Reynoso, Erika" sort="Flores Reynoso, Erika" uniqKey="Flores Reynoso E" first="Erika" last="Flores Reynoso">Erika Flores Reynoso</name>
<affiliation><nlm:aff id="aff14"><institution>International Fund for Animal Welfare</institution>
,<addr-line>Quintana Roo</addr-line>
,<country>Mexico</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Fotopoulou, Eleni" sort="Fotopoulou, Eleni" uniqKey="Fotopoulou E" first="Eleni" last="Fotopoulou">Eleni Fotopoulou</name>
<affiliation><nlm:aff id="aff15"><institution>Intermunicipal Stray Animals Care Centre</institution>
,<addr-line>Perama</addr-line>
,<country>Greece</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Fruean, Skye N" sort="Fruean, Skye N" uniqKey="Fruean S" first="Skye N" last="Fruean">Skye N. Fruean</name>
<affiliation><nlm:aff id="aff16"><institution>Animal Protection Society of Samoa</institution>
,<addr-line>Apia</addr-line>
,<country>Samoa</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Gallardo Arrieta, Fanny" sort="Gallardo Arrieta, Fanny" uniqKey="Gallardo Arrieta F" first="Fanny" last="Gallardo-Arrieta">Fanny Gallardo-Arrieta</name>
<affiliation><nlm:aff id="aff17"><institution content-type="dept">Faculty of Veterinary Science</institution>
,<institution>University of Zulia</institution>
,<addr-line>Maracaibo</addr-line>
,<country>Venezuela</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Glebova, Olga" sort="Glebova, Olga" uniqKey="Glebova O" first="Olga" last="Glebova">Olga Glebova</name>
<affiliation><nlm:aff id="aff18"><institution>Veterinary clinic BIOCONTROL</institution>
,<addr-line>Moscow</addr-line>
,<country>Russia</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="H Felin Manrique, Rodrigo F" sort="H Felin Manrique, Rodrigo F" uniqKey="H Felin Manrique R" first="Rodrigo F" last="H Felin Manrique">Rodrigo F. H Felin Manrique</name>
<affiliation><nlm:aff id="aff19"><institution>Veterinary clinic El Roble</institution>
,<addr-line>Santiago de Chile</addr-line>
,<country>Chile</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Henriques, Joaquim Jgp" sort="Henriques, Joaquim Jgp" uniqKey="Henriques J" first="Joaquim Jgp" last="Henriques">Joaquim Jgp Henriques</name>
<affiliation><nlm:aff id="aff20"><institution content-type="dept">OnevetGroup</institution>
,<institution>Centro Veterinário Berna</institution>
,<addr-line>Lisboa</addr-line>
,<country>Portugal</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Ignatenko, Natalia" sort="Ignatenko, Natalia" uniqKey="Ignatenko N" first="Natalia" last="Ignatenko">Natalia Ignatenko</name>
<affiliation><nlm:aff id="aff21"><institution>Veterinary clinic Zoovetservis</institution>
,<addr-line>Kiev</addr-line>
,<country>Ukraine</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Koenig, Debbie" sort="Koenig, Debbie" uniqKey="Koenig D" first="Debbie" last="Koenig">Debbie Koenig</name>
<affiliation><nlm:aff id="aff5"><institution>World Vets</institution>
,<addr-line>Fargo</addr-line>
,<country>United States</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Lanza Perea, Marta" sort="Lanza Perea, Marta" uniqKey="Lanza Perea M" first="Marta" last="Lanza-Perea">Marta Lanza-Perea</name>
<affiliation><nlm:aff id="aff9"><institution>St. George's University</institution>
,<addr-line>True Blue</addr-line>
,<country>Grenada</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Lobetti, Remo" sort="Lobetti, Remo" uniqKey="Lobetti R" first="Remo" last="Lobetti">Remo Lobetti</name>
<affiliation><nlm:aff id="aff22"><institution>Bryanston Veterinary Hospital</institution>
,<addr-line>Bryanston</addr-line>
,<country>South Africa</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Lopez Quintana, Adriana M" sort="Lopez Quintana, Adriana M" uniqKey="Lopez Quintana A" first="Adriana M" last="Lopez Quintana">Adriana M. Lopez Quintana</name>
<affiliation><nlm:aff id="aff23"><institution>Veterinary Clinic Lopez Quintana</institution>
,<addr-line>Maldonado</addr-line>
,<country>Uruguay</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Losfelt, Thibault" sort="Losfelt, Thibault" uniqKey="Losfelt T" first="Thibault" last="Losfelt">Thibault Losfelt</name>
<affiliation><nlm:aff id="aff24"><institution>Clinique Veterinaire de Grand Fond</institution>
,<addr-line>Saint Gilles les Bains</addr-line>
,<country>France</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Marino, Gabriele" sort="Marino, Gabriele" uniqKey="Marino G" first="Gabriele" last="Marino">Gabriele Marino</name>
<affiliation><nlm:aff id="aff25"><institution content-type="dept">Department of Veterinary Sciences</institution>
,<institution>University of Messina</institution>
,<addr-line>Messina</addr-line>
,<country>Italy</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Martincorena, Inigo" sort="Martincorena, Inigo" uniqKey="Martincorena I" first="Inigo" last="Martincorena">Inigo Martincorena</name>
<affiliation><nlm:aff id="aff26"><institution>Wellcome Trust Sanger Institute</institution>
,<addr-line>Hinxton</addr-line>
,<country>United Kingdom</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Martinez Casta Eda, Sim N" sort="Martinez Casta Eda, Sim N" uniqKey="Martinez Casta Eda S" first="Sim N" last="Martínez Casta Eda">Sim N Martínez Casta Eda</name>
<affiliation><nlm:aff id="aff27"><institution content-type="dept">Facultad de Medicina Veterinaria y Zootecnia</institution>
,<institution>Universidad Autónoma del Estado de México</institution>
,<addr-line>Toluca</addr-line>
,<country>Mexico</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Martinez L Pez, Mayra F" sort="Martinez L Pez, Mayra F" uniqKey="Martinez L Pez M" first="Mayra F" last="Martínez-L Pez">Mayra F. Martínez-L Pez</name>
<affiliation><nlm:aff id="aff28"><institution content-type="dept">School of Veterinary Medicine</institution>
,<institution>Universidad de las Américas</institution>
,<addr-line>Quito</addr-line>
,<country>Ecuador</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Meyer, Michael" sort="Meyer, Michael" uniqKey="Meyer M" first="Michael" last="Meyer">Michael Meyer</name>
<affiliation><nlm:aff id="aff29"><institution>Touray & Meyer Vet Clinic</institution>
,<addr-line>Serrekunda</addr-line>
,<country>Gambia</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Nakanwagi, Berna" sort="Nakanwagi, Berna" uniqKey="Nakanwagi B" first="Berna" last="Nakanwagi">Berna Nakanwagi</name>
<affiliation><nlm:aff id="aff30"><institution>The Kampala Veterinary Surgery</institution>
,<addr-line>Kampala</addr-line>
,<country>Uganda</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="De Nardi, Andrigo B" sort="De Nardi, Andrigo B" uniqKey="De Nardi A" first="Andrigo B" last="De Nardi">Andrigo B. De Nardi</name>
<affiliation><nlm:aff id="aff8"><institution content-type="dept">Department of Clinical and Veterinary Surgery</institution>
,<institution>São Paulo State University</institution>
,<addr-line>São Paulo</addr-line>
,<country>Brazil</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Neunzig, Winifred" sort="Neunzig, Winifred" uniqKey="Neunzig W" first="Winifred" last="Neunzig">Winifred Neunzig</name>
<affiliation><nlm:aff id="aff5"><institution>World Vets</institution>
,<addr-line>Fargo</addr-line>
,<country>United States</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Nixon, Sally J" sort="Nixon, Sally J" uniqKey="Nixon S" first="Sally J" last="Nixon">Sally J. Nixon</name>
<affiliation><nlm:aff id="aff31"><institution>Vets Beyond Borders</institution>
,<addr-line>The Rocks</addr-line>
,<country>Australia</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Onsare, Marsden M" sort="Onsare, Marsden M" uniqKey="Onsare M" first="Marsden M" last="Onsare">Marsden M. Onsare</name>
<affiliation><nlm:aff id="aff32"><institution>Aniworld veterinary clinic</institution>
,<addr-line>Kisumu</addr-line>
,<country>Kenya</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Ortega Pacheco, Antonio" sort="Ortega Pacheco, Antonio" uniqKey="Ortega Pacheco A" first="Antonio" last="Ortega-Pacheco">Antonio Ortega-Pacheco</name>
<affiliation><nlm:aff id="aff33"><institution content-type="dept">Faculty of Veterinary Medicine</institution>
,<institution>Autonomous University of Yucatan</institution>
,<addr-line>Merida</addr-line>
,<country>Mexico</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Peleteiro, Maria C" sort="Peleteiro, Maria C" uniqKey="Peleteiro M" first="Maria C" last="Peleteiro">Maria C. Peleteiro</name>
<affiliation><nlm:aff id="aff34"><institution content-type="dept">Interdisciplinary Centre of Research in Animal Health, Faculty of Veterinary Medicine</institution>
,<institution>University of Lisbon</institution>
,<addr-line>Lisboa</addr-line>
,<country>Portugal</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Pye, Ruth J" sort="Pye, Ruth J" uniqKey="Pye R" first="Ruth J" last="Pye">Ruth J. Pye</name>
<affiliation><nlm:aff id="aff31"><institution>Vets Beyond Borders</institution>
,<addr-line>The Rocks</addr-line>
,<country>Australia</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Reece, John F" sort="Reece, John F" uniqKey="Reece J" first="John F" last="Reece">John F. Reece</name>
<affiliation><nlm:aff id="aff35"><institution>Help in Suffering</institution>
,<addr-line>Jaipur</addr-line>
,<country>India</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Rojas Gutierrez, Jose" sort="Rojas Gutierrez, Jose" uniqKey="Rojas Gutierrez J" first="Jose" last="Rojas Gutierrez">Jose Rojas Gutierrez</name>
<affiliation><nlm:aff id="aff36"><institution>Veterinary clinic Dr José Rojas</institution>
,<addr-line>Los Andes</addr-line>
,<country>Chile</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Sadia, Haleema" sort="Sadia, Haleema" uniqKey="Sadia H" first="Haleema" last="Sadia">Haleema Sadia</name>
<affiliation><nlm:aff id="aff37"><institution>University of Veterinary and Animal Sciences</institution>
,<addr-line>Lahore</addr-line>
,<country>Pakistan</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Schmeling, Sheila K" sort="Schmeling, Sheila K" uniqKey="Schmeling S" first="Sheila K" last="Schmeling">Sheila K. Schmeling</name>
<affiliation><nlm:aff id="aff38"><institution>Corozal Veterinary Clinic</institution>
,<addr-line>Corozal Town</addr-line>
,<country>Belize</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Shamanova, Olga" sort="Shamanova, Olga" uniqKey="Shamanova O" first="Olga" last="Shamanova">Olga Shamanova</name>
<affiliation><nlm:aff id="aff39"><institution>Veterinary clinic Vetmaster</institution>
,<addr-line>Ramenskoye</addr-line>
,<country>Russia</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Ssuna, Richard K" sort="Ssuna, Richard K" uniqKey="Ssuna R" first="Richard K" last="Ssuna">Richard K. Ssuna</name>
<affiliation><nlm:aff id="aff40"><institution>Lilongwe Society for Protection and Care of Animals</institution>
,<addr-line>Lilongwe</addr-line>
,<country>Malawi</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Steenland Smit, Audrey E" sort="Steenland Smit, Audrey E" uniqKey="Steenland Smit A" first="Audrey E" last="Steenland-Smit">Audrey E. Steenland-Smit</name>
<affiliation><nlm:aff id="aff6"><institution>Stichting Dierenbescherming Suriname</institution>
,<addr-line>Paramaribo</addr-line>
,<country>Suriname</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Svitich, Alla" sort="Svitich, Alla" uniqKey="Svitich A" first="Alla" last="Svitich">Alla Svitich</name>
<affiliation><nlm:aff id="aff41"><institution>State Hospital of Veterinary Medicine</institution>
,<addr-line>Dniprodzerzhynsk</addr-line>
,<country>Ukraine</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Thoya Ngoka, Ismail" sort="Thoya Ngoka, Ismail" uniqKey="Thoya Ngoka I" first="Ismail" last="Thoya Ngoka">Ismail Thoya Ngoka</name>
<affiliation><nlm:aff id="aff42"><institution>Kenya Society for Protection and Care of Animals</institution>
,<addr-line>Nairobi</addr-line>
,<country>Kenya</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Vi Laru, Bogdan A" sort="Vi Laru, Bogdan A" uniqKey="Vi Laru B" first="Bogdan A" last="Vi Laru">Bogdan A. Vi Laru</name>
<affiliation><nlm:aff id="aff43"><institution content-type="dept">Clinical Sciences Department</institution>
,<institution>Faculty of Veterinary Medicine</institution>
,<addr-line>Bucharest</addr-line>
,<country>Romania</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="De Vos, Anna P" sort="De Vos, Anna P" uniqKey="De Vos A" first="Anna P" last="De Vos">Anna P. De Vos</name>
<affiliation><nlm:aff id="aff44"><institution>Ladybrand Animal Clinic</institution>
,<addr-line>Ladybrand</addr-line>
,<country>South Africa</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="De Vos, Johan P" sort="De Vos, Johan P" uniqKey="De Vos J" first="Johan P" last="De Vos">Johan P. De Vos</name>
<affiliation><nlm:aff id="aff45"><institution>Veterinary Oncology Referral Centre De Ottenhorst</institution>
,<addr-line>Terneuzen</addr-line>
,<country>Netherlands</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Walkinton, Oliver" sort="Walkinton, Oliver" uniqKey="Walkinton O" first="Oliver" last="Walkinton">Oliver Walkinton</name>
<affiliation><nlm:aff id="aff31"><institution>Vets Beyond Borders</institution>
,<addr-line>The Rocks</addr-line>
,<country>Australia</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Wedge, David C" sort="Wedge, David C" uniqKey="Wedge D" first="David C" last="Wedge">David C. Wedge</name>
<affiliation><nlm:aff id="aff26"><institution>Wellcome Trust Sanger Institute</institution>
,<addr-line>Hinxton</addr-line>
,<country>United Kingdom</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Wehrle Martinez, Alvaro S" sort="Wehrle Martinez, Alvaro S" uniqKey="Wehrle Martinez A" first="Alvaro S" last="Wehrle-Martinez">Alvaro S. Wehrle-Martinez</name>
<affiliation><nlm:aff id="aff46"><institution content-type="dept">Faculty of Veterinary Sciences</institution>
,<institution>National University of Asuncion</institution>
,<addr-line>San Lorenzo</addr-line>
,<country>Paraguay</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Van Der Wel, Mirjam G" sort="Van Der Wel, Mirjam G" uniqKey="Van Der Wel M" first="Mirjam G" last="Van Der Wel">Mirjam G. Van Der Wel</name>
<affiliation><nlm:aff id="aff47"><institution>Animal Anti Cruelty League</institution>
,<addr-line>Port Elizabeth</addr-line>
,<country>South Africa</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Widdowson, Sophie Ae" sort="Widdowson, Sophie Ae" uniqKey="Widdowson S" first="Sophie Ae" last="Widdowson">Sophie Ae Widdowson</name>
<affiliation><nlm:aff id="aff40"><institution>Lilongwe Society for Protection and Care of Animals</institution>
,<addr-line>Lilongwe</addr-line>
,<country>Malawi</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Murchison, Elizabeth P" sort="Murchison, Elizabeth P" uniqKey="Murchison E" first="Elizabeth P" last="Murchison">Elizabeth P. Murchison</name>
<affiliation><nlm:aff id="aff1"><institution content-type="dept">Department of Veterinary Medicine</institution>
,<institution>University of Cambridge</institution>
,<addr-line>Cambridge</addr-line>
,<country>United Kingdom</country>
</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt><idno type="wicri:source">PMC</idno>
<idno type="pmid">27185408</idno>
<idno type="pmc">4869914</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4869914</idno>
<idno type="RBID">PMC:4869914</idno>
<idno type="doi">10.7554/eLife.14552</idno>
<date when="????">????</date>
<idno type="wicri:Area/Pmc/Corpus">000647</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000647</idno>
</publicationStmt>
<sourceDesc><biblStruct><analytic><title xml:lang="en" level="a" type="main">Mitochondrial genetic diversity, selection and recombination in a canine transmissible cancer</title>
<author><name sortKey="Strakova, Andrea" sort="Strakova, Andrea" uniqKey="Strakova A" first="Andrea" last="Strakova">Andrea Strakova</name>
<affiliation><nlm:aff id="aff1"><institution content-type="dept">Department of Veterinary Medicine</institution>
,<institution>University of Cambridge</institution>
,<addr-line>Cambridge</addr-line>
,<country>United Kingdom</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Ni Leathlobhair, Maire" sort="Ni Leathlobhair, Maire" uniqKey="Ni Leathlobhair M" first="Máire" last="Ní Leathlobhair">Máire Ní Leathlobhair</name>
<affiliation><nlm:aff id="aff1"><institution content-type="dept">Department of Veterinary Medicine</institution>
,<institution>University of Cambridge</institution>
,<addr-line>Cambridge</addr-line>
,<country>United Kingdom</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Wang, Guo Dong" sort="Wang, Guo Dong" uniqKey="Wang G" first="Guo-Dong" last="Wang">Guo-Dong Wang</name>
<affiliation><nlm:aff id="aff2"><institution content-type="dept">State Key Laboratory of Genetic Resources and Evolution, Yunnan Laboratory of Molecular Biology of Domestic Animals, Kunming Institute of Zoology</institution>
,<institution>Chinese Academy of Sciences</institution>
,<addr-line>Kunming</addr-line>
,<country>China</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Yin, Ting Ting" sort="Yin, Ting Ting" uniqKey="Yin T" first="Ting-Ting" last="Yin">Ting-Ting Yin</name>
<affiliation><nlm:aff id="aff2"><institution content-type="dept">State Key Laboratory of Genetic Resources and Evolution, Yunnan Laboratory of Molecular Biology of Domestic Animals, Kunming Institute of Zoology</institution>
,<institution>Chinese Academy of Sciences</institution>
,<addr-line>Kunming</addr-line>
,<country>China</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Airikkala Otter, Ilona" sort="Airikkala Otter, Ilona" uniqKey="Airikkala Otter I" first="Ilona" last="Airikkala-Otter">Ilona Airikkala-Otter</name>
<affiliation><nlm:aff id="aff3"><institution content-type="dept">International Training Center</institution>
,<institution>Worldwide Veterinary Service</institution>
,<addr-line>Aruvankadu</addr-line>
,<country>India</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Allen, Janice L" sort="Allen, Janice L" uniqKey="Allen J" first="Janice L" last="Allen">Janice L. Allen</name>
<affiliation><nlm:aff id="aff4"><institution>Animal Management in Rural and Remote Indigenous Communities</institution>
,<addr-line>Darwin</addr-line>
,<country>Australia</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Allum, Karen M" sort="Allum, Karen M" uniqKey="Allum K" first="Karen M" last="Allum">Karen M. Allum</name>
<affiliation><nlm:aff id="aff5"><institution>World Vets</institution>
,<addr-line>Fargo</addr-line>
,<country>United States</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Bansse Issa, Leontine" sort="Bansse Issa, Leontine" uniqKey="Bansse Issa L" first="Leontine" last="Bansse-Issa">Leontine Bansse-Issa</name>
<affiliation><nlm:aff id="aff6"><institution>Stichting Dierenbescherming Suriname</institution>
,<addr-line>Paramaribo</addr-line>
,<country>Suriname</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Bisson, Jocelyn L" sort="Bisson, Jocelyn L" uniqKey="Bisson J" first="Jocelyn L" last="Bisson">Jocelyn L. Bisson</name>
<affiliation><nlm:aff id="aff1"><institution content-type="dept">Department of Veterinary Medicine</institution>
,<institution>University of Cambridge</institution>
,<addr-line>Cambridge</addr-line>
,<country>United Kingdom</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Castillo Domracheva, Artemio" sort="Castillo Domracheva, Artemio" uniqKey="Castillo Domracheva A" first="Artemio" last="Castillo Domracheva">Artemio Castillo Domracheva</name>
<affiliation><nlm:aff id="aff7"><institution content-type="dept">Corozal Veterinary Hospital</institution>
,<institution>University of Panama</institution>
,<addr-line>Panama City</addr-line>
,<country>Panama</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="De Castro, Karina F" sort="De Castro, Karina F" uniqKey="De Castro K" first="Karina F" last="De Castro">Karina F. De Castro</name>
<affiliation><nlm:aff id="aff8"><institution content-type="dept">Department of Clinical and Veterinary Surgery</institution>
,<institution>São Paulo State University</institution>
,<addr-line>São Paulo</addr-line>
,<country>Brazil</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Corrigan, Anne M" sort="Corrigan, Anne M" uniqKey="Corrigan A" first="Anne M" last="Corrigan">Anne M. Corrigan</name>
<affiliation><nlm:aff id="aff9"><institution>St. George's University</institution>
,<addr-line>True Blue</addr-line>
,<country>Grenada</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Cran, Hugh R" sort="Cran, Hugh R" uniqKey="Cran H" first="Hugh R" last="Cran">Hugh R. Cran</name>
<affiliation><nlm:aff id="aff10"><institution>The Nakuru District Veterinary Scheme Ltd</institution>
,<addr-line>Nakuru</addr-line>
,<country>Kenya</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Crawford, Jane T" sort="Crawford, Jane T" uniqKey="Crawford J" first="Jane T" last="Crawford">Jane T. Crawford</name>
<affiliation><nlm:aff id="aff11"><institution>Animal Medical Centre</institution>
,<addr-line>Belize City</addr-line>
,<country>Belize</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Cutter, Stephen M" sort="Cutter, Stephen M" uniqKey="Cutter S" first="Stephen M" last="Cutter">Stephen M. Cutter</name>
<affiliation><nlm:aff id="aff4"><institution>Animal Management in Rural and Remote Indigenous Communities</institution>
,<addr-line>Darwin</addr-line>
,<country>Australia</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Delgadillo Keenan, Laura" sort="Delgadillo Keenan, Laura" uniqKey="Delgadillo Keenan L" first="Laura" last="Delgadillo Keenan">Laura Delgadillo Keenan</name>
<affiliation><nlm:aff id="aff12"><institution>Veterinary clinic Sr. Dog's</institution>
,<addr-line>Guadalajara</addr-line>
,<country>Mexico</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Donelan, Edward M" sort="Donelan, Edward M" uniqKey="Donelan E" first="Edward M" last="Donelan">Edward M. Donelan</name>
<affiliation><nlm:aff id="aff4"><institution>Animal Management in Rural and Remote Indigenous Communities</institution>
,<addr-line>Darwin</addr-line>
,<country>Australia</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Faramade, Ibikunle A" sort="Faramade, Ibikunle A" uniqKey="Faramade I" first="Ibikunle A" last="Faramade">Ibikunle A. Faramade</name>
<affiliation><nlm:aff id="aff13"><institution>National Veterinary Research Institute</institution>
,<addr-line>Vom</addr-line>
,<country>Nigeria</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Flores Reynoso, Erika" sort="Flores Reynoso, Erika" uniqKey="Flores Reynoso E" first="Erika" last="Flores Reynoso">Erika Flores Reynoso</name>
<affiliation><nlm:aff id="aff14"><institution>International Fund for Animal Welfare</institution>
,<addr-line>Quintana Roo</addr-line>
,<country>Mexico</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Fotopoulou, Eleni" sort="Fotopoulou, Eleni" uniqKey="Fotopoulou E" first="Eleni" last="Fotopoulou">Eleni Fotopoulou</name>
<affiliation><nlm:aff id="aff15"><institution>Intermunicipal Stray Animals Care Centre</institution>
,<addr-line>Perama</addr-line>
,<country>Greece</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Fruean, Skye N" sort="Fruean, Skye N" uniqKey="Fruean S" first="Skye N" last="Fruean">Skye N. Fruean</name>
<affiliation><nlm:aff id="aff16"><institution>Animal Protection Society of Samoa</institution>
,<addr-line>Apia</addr-line>
,<country>Samoa</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Gallardo Arrieta, Fanny" sort="Gallardo Arrieta, Fanny" uniqKey="Gallardo Arrieta F" first="Fanny" last="Gallardo-Arrieta">Fanny Gallardo-Arrieta</name>
<affiliation><nlm:aff id="aff17"><institution content-type="dept">Faculty of Veterinary Science</institution>
,<institution>University of Zulia</institution>
,<addr-line>Maracaibo</addr-line>
,<country>Venezuela</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Glebova, Olga" sort="Glebova, Olga" uniqKey="Glebova O" first="Olga" last="Glebova">Olga Glebova</name>
<affiliation><nlm:aff id="aff18"><institution>Veterinary clinic BIOCONTROL</institution>
,<addr-line>Moscow</addr-line>
,<country>Russia</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="H Felin Manrique, Rodrigo F" sort="H Felin Manrique, Rodrigo F" uniqKey="H Felin Manrique R" first="Rodrigo F" last="H Felin Manrique">Rodrigo F. H Felin Manrique</name>
<affiliation><nlm:aff id="aff19"><institution>Veterinary clinic El Roble</institution>
,<addr-line>Santiago de Chile</addr-line>
,<country>Chile</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Henriques, Joaquim Jgp" sort="Henriques, Joaquim Jgp" uniqKey="Henriques J" first="Joaquim Jgp" last="Henriques">Joaquim Jgp Henriques</name>
<affiliation><nlm:aff id="aff20"><institution content-type="dept">OnevetGroup</institution>
,<institution>Centro Veterinário Berna</institution>
,<addr-line>Lisboa</addr-line>
,<country>Portugal</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Ignatenko, Natalia" sort="Ignatenko, Natalia" uniqKey="Ignatenko N" first="Natalia" last="Ignatenko">Natalia Ignatenko</name>
<affiliation><nlm:aff id="aff21"><institution>Veterinary clinic Zoovetservis</institution>
,<addr-line>Kiev</addr-line>
,<country>Ukraine</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Koenig, Debbie" sort="Koenig, Debbie" uniqKey="Koenig D" first="Debbie" last="Koenig">Debbie Koenig</name>
<affiliation><nlm:aff id="aff5"><institution>World Vets</institution>
,<addr-line>Fargo</addr-line>
,<country>United States</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Lanza Perea, Marta" sort="Lanza Perea, Marta" uniqKey="Lanza Perea M" first="Marta" last="Lanza-Perea">Marta Lanza-Perea</name>
<affiliation><nlm:aff id="aff9"><institution>St. George's University</institution>
,<addr-line>True Blue</addr-line>
,<country>Grenada</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Lobetti, Remo" sort="Lobetti, Remo" uniqKey="Lobetti R" first="Remo" last="Lobetti">Remo Lobetti</name>
<affiliation><nlm:aff id="aff22"><institution>Bryanston Veterinary Hospital</institution>
,<addr-line>Bryanston</addr-line>
,<country>South Africa</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Lopez Quintana, Adriana M" sort="Lopez Quintana, Adriana M" uniqKey="Lopez Quintana A" first="Adriana M" last="Lopez Quintana">Adriana M. Lopez Quintana</name>
<affiliation><nlm:aff id="aff23"><institution>Veterinary Clinic Lopez Quintana</institution>
,<addr-line>Maldonado</addr-line>
,<country>Uruguay</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Losfelt, Thibault" sort="Losfelt, Thibault" uniqKey="Losfelt T" first="Thibault" last="Losfelt">Thibault Losfelt</name>
<affiliation><nlm:aff id="aff24"><institution>Clinique Veterinaire de Grand Fond</institution>
,<addr-line>Saint Gilles les Bains</addr-line>
,<country>France</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Marino, Gabriele" sort="Marino, Gabriele" uniqKey="Marino G" first="Gabriele" last="Marino">Gabriele Marino</name>
<affiliation><nlm:aff id="aff25"><institution content-type="dept">Department of Veterinary Sciences</institution>
,<institution>University of Messina</institution>
,<addr-line>Messina</addr-line>
,<country>Italy</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Martincorena, Inigo" sort="Martincorena, Inigo" uniqKey="Martincorena I" first="Inigo" last="Martincorena">Inigo Martincorena</name>
<affiliation><nlm:aff id="aff26"><institution>Wellcome Trust Sanger Institute</institution>
,<addr-line>Hinxton</addr-line>
,<country>United Kingdom</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Martinez Casta Eda, Sim N" sort="Martinez Casta Eda, Sim N" uniqKey="Martinez Casta Eda S" first="Sim N" last="Martínez Casta Eda">Sim N Martínez Casta Eda</name>
<affiliation><nlm:aff id="aff27"><institution content-type="dept">Facultad de Medicina Veterinaria y Zootecnia</institution>
,<institution>Universidad Autónoma del Estado de México</institution>
,<addr-line>Toluca</addr-line>
,<country>Mexico</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Martinez L Pez, Mayra F" sort="Martinez L Pez, Mayra F" uniqKey="Martinez L Pez M" first="Mayra F" last="Martínez-L Pez">Mayra F. Martínez-L Pez</name>
<affiliation><nlm:aff id="aff28"><institution content-type="dept">School of Veterinary Medicine</institution>
,<institution>Universidad de las Américas</institution>
,<addr-line>Quito</addr-line>
,<country>Ecuador</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Meyer, Michael" sort="Meyer, Michael" uniqKey="Meyer M" first="Michael" last="Meyer">Michael Meyer</name>
<affiliation><nlm:aff id="aff29"><institution>Touray & Meyer Vet Clinic</institution>
,<addr-line>Serrekunda</addr-line>
,<country>Gambia</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Nakanwagi, Berna" sort="Nakanwagi, Berna" uniqKey="Nakanwagi B" first="Berna" last="Nakanwagi">Berna Nakanwagi</name>
<affiliation><nlm:aff id="aff30"><institution>The Kampala Veterinary Surgery</institution>
,<addr-line>Kampala</addr-line>
,<country>Uganda</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="De Nardi, Andrigo B" sort="De Nardi, Andrigo B" uniqKey="De Nardi A" first="Andrigo B" last="De Nardi">Andrigo B. De Nardi</name>
<affiliation><nlm:aff id="aff8"><institution content-type="dept">Department of Clinical and Veterinary Surgery</institution>
,<institution>São Paulo State University</institution>
,<addr-line>São Paulo</addr-line>
,<country>Brazil</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Neunzig, Winifred" sort="Neunzig, Winifred" uniqKey="Neunzig W" first="Winifred" last="Neunzig">Winifred Neunzig</name>
<affiliation><nlm:aff id="aff5"><institution>World Vets</institution>
,<addr-line>Fargo</addr-line>
,<country>United States</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Nixon, Sally J" sort="Nixon, Sally J" uniqKey="Nixon S" first="Sally J" last="Nixon">Sally J. Nixon</name>
<affiliation><nlm:aff id="aff31"><institution>Vets Beyond Borders</institution>
,<addr-line>The Rocks</addr-line>
,<country>Australia</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Onsare, Marsden M" sort="Onsare, Marsden M" uniqKey="Onsare M" first="Marsden M" last="Onsare">Marsden M. Onsare</name>
<affiliation><nlm:aff id="aff32"><institution>Aniworld veterinary clinic</institution>
,<addr-line>Kisumu</addr-line>
,<country>Kenya</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Ortega Pacheco, Antonio" sort="Ortega Pacheco, Antonio" uniqKey="Ortega Pacheco A" first="Antonio" last="Ortega-Pacheco">Antonio Ortega-Pacheco</name>
<affiliation><nlm:aff id="aff33"><institution content-type="dept">Faculty of Veterinary Medicine</institution>
,<institution>Autonomous University of Yucatan</institution>
,<addr-line>Merida</addr-line>
,<country>Mexico</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Peleteiro, Maria C" sort="Peleteiro, Maria C" uniqKey="Peleteiro M" first="Maria C" last="Peleteiro">Maria C. Peleteiro</name>
<affiliation><nlm:aff id="aff34"><institution content-type="dept">Interdisciplinary Centre of Research in Animal Health, Faculty of Veterinary Medicine</institution>
,<institution>University of Lisbon</institution>
,<addr-line>Lisboa</addr-line>
,<country>Portugal</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Pye, Ruth J" sort="Pye, Ruth J" uniqKey="Pye R" first="Ruth J" last="Pye">Ruth J. Pye</name>
<affiliation><nlm:aff id="aff31"><institution>Vets Beyond Borders</institution>
,<addr-line>The Rocks</addr-line>
,<country>Australia</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Reece, John F" sort="Reece, John F" uniqKey="Reece J" first="John F" last="Reece">John F. Reece</name>
<affiliation><nlm:aff id="aff35"><institution>Help in Suffering</institution>
,<addr-line>Jaipur</addr-line>
,<country>India</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Rojas Gutierrez, Jose" sort="Rojas Gutierrez, Jose" uniqKey="Rojas Gutierrez J" first="Jose" last="Rojas Gutierrez">Jose Rojas Gutierrez</name>
<affiliation><nlm:aff id="aff36"><institution>Veterinary clinic Dr José Rojas</institution>
,<addr-line>Los Andes</addr-line>
,<country>Chile</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Sadia, Haleema" sort="Sadia, Haleema" uniqKey="Sadia H" first="Haleema" last="Sadia">Haleema Sadia</name>
<affiliation><nlm:aff id="aff37"><institution>University of Veterinary and Animal Sciences</institution>
,<addr-line>Lahore</addr-line>
,<country>Pakistan</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Schmeling, Sheila K" sort="Schmeling, Sheila K" uniqKey="Schmeling S" first="Sheila K" last="Schmeling">Sheila K. Schmeling</name>
<affiliation><nlm:aff id="aff38"><institution>Corozal Veterinary Clinic</institution>
,<addr-line>Corozal Town</addr-line>
,<country>Belize</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Shamanova, Olga" sort="Shamanova, Olga" uniqKey="Shamanova O" first="Olga" last="Shamanova">Olga Shamanova</name>
<affiliation><nlm:aff id="aff39"><institution>Veterinary clinic Vetmaster</institution>
,<addr-line>Ramenskoye</addr-line>
,<country>Russia</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Ssuna, Richard K" sort="Ssuna, Richard K" uniqKey="Ssuna R" first="Richard K" last="Ssuna">Richard K. Ssuna</name>
<affiliation><nlm:aff id="aff40"><institution>Lilongwe Society for Protection and Care of Animals</institution>
,<addr-line>Lilongwe</addr-line>
,<country>Malawi</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Steenland Smit, Audrey E" sort="Steenland Smit, Audrey E" uniqKey="Steenland Smit A" first="Audrey E" last="Steenland-Smit">Audrey E. Steenland-Smit</name>
<affiliation><nlm:aff id="aff6"><institution>Stichting Dierenbescherming Suriname</institution>
,<addr-line>Paramaribo</addr-line>
,<country>Suriname</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Svitich, Alla" sort="Svitich, Alla" uniqKey="Svitich A" first="Alla" last="Svitich">Alla Svitich</name>
<affiliation><nlm:aff id="aff41"><institution>State Hospital of Veterinary Medicine</institution>
,<addr-line>Dniprodzerzhynsk</addr-line>
,<country>Ukraine</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Thoya Ngoka, Ismail" sort="Thoya Ngoka, Ismail" uniqKey="Thoya Ngoka I" first="Ismail" last="Thoya Ngoka">Ismail Thoya Ngoka</name>
<affiliation><nlm:aff id="aff42"><institution>Kenya Society for Protection and Care of Animals</institution>
,<addr-line>Nairobi</addr-line>
,<country>Kenya</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Vi Laru, Bogdan A" sort="Vi Laru, Bogdan A" uniqKey="Vi Laru B" first="Bogdan A" last="Vi Laru">Bogdan A. Vi Laru</name>
<affiliation><nlm:aff id="aff43"><institution content-type="dept">Clinical Sciences Department</institution>
,<institution>Faculty of Veterinary Medicine</institution>
,<addr-line>Bucharest</addr-line>
,<country>Romania</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="De Vos, Anna P" sort="De Vos, Anna P" uniqKey="De Vos A" first="Anna P" last="De Vos">Anna P. De Vos</name>
<affiliation><nlm:aff id="aff44"><institution>Ladybrand Animal Clinic</institution>
,<addr-line>Ladybrand</addr-line>
,<country>South Africa</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="De Vos, Johan P" sort="De Vos, Johan P" uniqKey="De Vos J" first="Johan P" last="De Vos">Johan P. De Vos</name>
<affiliation><nlm:aff id="aff45"><institution>Veterinary Oncology Referral Centre De Ottenhorst</institution>
,<addr-line>Terneuzen</addr-line>
,<country>Netherlands</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Walkinton, Oliver" sort="Walkinton, Oliver" uniqKey="Walkinton O" first="Oliver" last="Walkinton">Oliver Walkinton</name>
<affiliation><nlm:aff id="aff31"><institution>Vets Beyond Borders</institution>
,<addr-line>The Rocks</addr-line>
,<country>Australia</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Wedge, David C" sort="Wedge, David C" uniqKey="Wedge D" first="David C" last="Wedge">David C. Wedge</name>
<affiliation><nlm:aff id="aff26"><institution>Wellcome Trust Sanger Institute</institution>
,<addr-line>Hinxton</addr-line>
,<country>United Kingdom</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Wehrle Martinez, Alvaro S" sort="Wehrle Martinez, Alvaro S" uniqKey="Wehrle Martinez A" first="Alvaro S" last="Wehrle-Martinez">Alvaro S. Wehrle-Martinez</name>
<affiliation><nlm:aff id="aff46"><institution content-type="dept">Faculty of Veterinary Sciences</institution>
,<institution>National University of Asuncion</institution>
,<addr-line>San Lorenzo</addr-line>
,<country>Paraguay</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Van Der Wel, Mirjam G" sort="Van Der Wel, Mirjam G" uniqKey="Van Der Wel M" first="Mirjam G" last="Van Der Wel">Mirjam G. Van Der Wel</name>
<affiliation><nlm:aff id="aff47"><institution>Animal Anti Cruelty League</institution>
,<addr-line>Port Elizabeth</addr-line>
,<country>South Africa</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Widdowson, Sophie Ae" sort="Widdowson, Sophie Ae" uniqKey="Widdowson S" first="Sophie Ae" last="Widdowson">Sophie Ae Widdowson</name>
<affiliation><nlm:aff id="aff40"><institution>Lilongwe Society for Protection and Care of Animals</institution>
,<addr-line>Lilongwe</addr-line>
,<country>Malawi</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Murchison, Elizabeth P" sort="Murchison, Elizabeth P" uniqKey="Murchison E" first="Elizabeth P" last="Murchison">Elizabeth P. Murchison</name>
<affiliation><nlm:aff id="aff1"><institution content-type="dept">Department of Veterinary Medicine</institution>
,<institution>University of Cambridge</institution>
,<addr-line>Cambridge</addr-line>
,<country>United Kingdom</country>
</nlm:aff>
</affiliation>
</author>
</analytic>
<series><title level="j">eLife</title>
<idno type="eISSN">2050-084X</idno>
<imprint><date when="????">????</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc><textClass></textClass>
</profileDesc>
</teiHeader>
<front><div type="abstract" xml:lang="en"><p>Canine transmissible venereal tumour (CTVT) is a clonally transmissible cancer that originated approximately 11,000 years ago and affects dogs worldwide. Despite the clonal origin of the CTVT nuclear genome, CTVT mitochondrial genomes (mtDNAs) have been acquired by periodic capture from transient hosts. We sequenced 449 complete mtDNAs from a global population of CTVTs, and show that mtDNA horizontal transfer has occurred at least five times, delineating five tumour clades whose distributions track two millennia of dog global migration. Negative selection has operated to prevent accumulation of deleterious mutations in captured mtDNA, and recombination has caused occasional mtDNA re-assortment. These findings implicate functional mtDNA as a driver of CTVT global metastatic spread, further highlighting the important role of mtDNA in cancer evolution.</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.001">http://dx.doi.org/10.7554/eLife.14552.001</ext-link>
</p>
</div>
</front>
<back><div1 type="bibliography"><listBibl><biblStruct><analytic><author><name sortKey="Alexandrov, Lb" uniqKey="Alexandrov L">LB Alexandrov</name>
</author>
<author><name sortKey="Nik Zainal, S" uniqKey="Nik Zainal S">S Nik-Zainal</name>
</author>
<author><name sortKey="Wedge, Dc" uniqKey="Wedge D">DC Wedge</name>
</author>
<author><name sortKey="Aparicio, Sa" uniqKey="Aparicio S">SA Aparicio</name>
</author>
<author><name sortKey="Behjati, S" uniqKey="Behjati S">S Behjati</name>
</author>
<author><name sortKey="Biankin, Av" uniqKey="Biankin A">AV Biankin</name>
</author>
<author><name sortKey="Bignell, Gr" uniqKey="Bignell G">GR Bignell</name>
</author>
<author><name sortKey="Bolli, N" uniqKey="Bolli N">N Bolli</name>
</author>
<author><name sortKey="Borg, A" uniqKey="Borg A">A Borg</name>
</author>
<author><name sortKey="B Rresen Dale, Al" uniqKey="B Rresen Dale A">AL Børresen-Dale</name>
</author>
<author><name sortKey="Boyault, S" uniqKey="Boyault S">S Boyault</name>
</author>
<author><name sortKey="Burkhardt, B" uniqKey="Burkhardt B">B Burkhardt</name>
</author>
<author><name sortKey="Butler, Ap" uniqKey="Butler A">AP Butler</name>
</author>
<author><name sortKey="Caldas, C" uniqKey="Caldas C">C Caldas</name>
</author>
<author><name sortKey="Davies, Hr" uniqKey="Davies H">HR Davies</name>
</author>
<author><name sortKey="Desmedt, C" uniqKey="Desmedt C">C Desmedt</name>
</author>
<author><name sortKey="Eils, R" uniqKey="Eils R">R Eils</name>
</author>
<author><name sortKey="Eyfjord, Je" uniqKey="Eyfjord J">JE Eyfjörd</name>
</author>
<author><name sortKey="Foekens, Ja" uniqKey="Foekens J">JA Foekens</name>
</author>
<author><name sortKey="Greaves, M" uniqKey="Greaves M">M Greaves</name>
</author>
<author><name sortKey="Hosoda, F" uniqKey="Hosoda F">F Hosoda</name>
</author>
<author><name sortKey="Hutter, B" uniqKey="Hutter B">B Hutter</name>
</author>
<author><name sortKey="Ilicic, T" uniqKey="Ilicic T">T Ilicic</name>
</author>
<author><name sortKey="Imbeaud, S" uniqKey="Imbeaud S">S Imbeaud</name>
</author>
<author><name sortKey="Imielinski, M" uniqKey="Imielinski M">M Imielinski</name>
</author>
<author><name sortKey="Imielinsk, M" uniqKey="Imielinsk M">M Imielinsk</name>
</author>
<author><name sortKey="J Ger, N" uniqKey="J Ger N">N Jäger</name>
</author>
<author><name sortKey="Jones, Dt" uniqKey="Jones D">DT Jones</name>
</author>
<author><name sortKey="Jones, D" uniqKey="Jones D">D Jones</name>
</author>
<author><name sortKey="Knappskog, S" uniqKey="Knappskog S">S Knappskog</name>
</author>
<author><name sortKey="Kool, M" uniqKey="Kool M">M Kool</name>
</author>
<author><name sortKey="Lakhani, Sr" uniqKey="Lakhani S">SR Lakhani</name>
</author>
<author><name sortKey="L Pez Otin, C" uniqKey="L Pez Otin C">C López-Otín</name>
</author>
<author><name sortKey="Martin, S" uniqKey="Martin S">S Martin</name>
</author>
<author><name sortKey="Munshi, Nc" uniqKey="Munshi N">NC Munshi</name>
</author>
<author><name sortKey="Nakamura, H" uniqKey="Nakamura H">H Nakamura</name>
</author>
<author><name sortKey="Northcott, Pa" uniqKey="Northcott P">PA Northcott</name>
</author>
<author><name sortKey="Pajic, M" uniqKey="Pajic M">M Pajic</name>
</author>
<author><name sortKey="Papaemmanuil, E" uniqKey="Papaemmanuil E">E Papaemmanuil</name>
</author>
<author><name sortKey="Paradiso, A" uniqKey="Paradiso A">A Paradiso</name>
</author>
<author><name sortKey="Pearson, Jv" uniqKey="Pearson J">JV Pearson</name>
</author>
<author><name sortKey="Puente, Xs" uniqKey="Puente X">XS Puente</name>
</author>
<author><name sortKey="Raine, K" uniqKey="Raine K">K Raine</name>
</author>
<author><name sortKey="Ramakrishna, M" uniqKey="Ramakrishna M">M Ramakrishna</name>
</author>
<author><name sortKey="Richardson, Al" uniqKey="Richardson A">AL Richardson</name>
</author>
<author><name sortKey="Richter, J" uniqKey="Richter J">J Richter</name>
</author>
<author><name sortKey="Rosenstiel, P" uniqKey="Rosenstiel P">P Rosenstiel</name>
</author>
<author><name sortKey="Schlesner, M" uniqKey="Schlesner M">M Schlesner</name>
</author>
<author><name sortKey="Schumacher, Tn" uniqKey="Schumacher T">TN Schumacher</name>
</author>
<author><name sortKey="Span, Pn" uniqKey="Span P">PN Span</name>
</author>
<author><name sortKey="Teague, Jw" uniqKey="Teague J">JW Teague</name>
</author>
<author><name sortKey="Totoki, Y" uniqKey="Totoki Y">Y Totoki</name>
</author>
<author><name sortKey="Tutt, An" uniqKey="Tutt A">AN Tutt</name>
</author>
<author><name sortKey="Valdes Mas, R" uniqKey="Valdes Mas R">R Valdés-Mas</name>
</author>
<author><name sortKey="Van Buuren, Mm" uniqKey="Van Buuren M">MM van Buuren</name>
</author>
<author><name sortKey="Van T Veer, L" uniqKey="Van T Veer L">L van 't Veer</name>
</author>
<author><name sortKey="Vincent Salomon, A" uniqKey="Vincent Salomon A">A Vincent-Salomon</name>
</author>
<author><name sortKey="Waddell, N" uniqKey="Waddell N">N Waddell</name>
</author>
<author><name sortKey="Yates, Lr" uniqKey="Yates L">LR Yates</name>
</author>
<author><name sortKey="Zucman Rossi, J" uniqKey="Zucman Rossi J">J Zucman-Rossi</name>
</author>
<author><name sortKey="Futreal, Pa" uniqKey="Futreal P">PA Futreal</name>
</author>
<author><name sortKey="Mcdermott, U" uniqKey="Mcdermott U">U McDermott</name>
</author>
<author><name sortKey="Lichter, P" uniqKey="Lichter P">P Lichter</name>
</author>
<author><name sortKey="Meyerson, M" uniqKey="Meyerson M">M Meyerson</name>
</author>
<author><name sortKey="Grimmond, Sm" uniqKey="Grimmond S">SM Grimmond</name>
</author>
<author><name sortKey="Siebert, R" uniqKey="Siebert R">R Siebert</name>
</author>
<author><name sortKey="Campo, E" uniqKey="Campo E">E Campo</name>
</author>
<author><name sortKey="Shibata, T" uniqKey="Shibata T">T Shibata</name>
</author>
<author><name sortKey="Pfister, Sm" uniqKey="Pfister S">SM Pfister</name>
</author>
<author><name sortKey="Campbell, Pj" uniqKey="Campbell P">PJ Campbell</name>
</author>
<author><name sortKey="Stratton, Mr" uniqKey="Stratton M">MR Stratton</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Bergthorsson, U" uniqKey="Bergthorsson U">U Bergthorsson</name>
</author>
<author><name sortKey="Adams, Kl" uniqKey="Adams K">KL Adams</name>
</author>
<author><name sortKey="Thomason, B" uniqKey="Thomason B">B Thomason</name>
</author>
<author><name sortKey="Palmer, Jd" uniqKey="Palmer J">JD Palmer</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Boni, Mf" uniqKey="Boni M">MF Boni</name>
</author>
<author><name sortKey="Posada, D" uniqKey="Posada D">D Posada</name>
</author>
<author><name sortKey="Feldman, Mw" uniqKey="Feldman M">MW Feldman</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Cohen, D" uniqKey="Cohen D">D Cohen</name>
</author>
<author><name sortKey="Steel, Gg" uniqKey="Steel G">GG Steel</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Coupland, P" uniqKey="Coupland P">P Coupland</name>
</author>
<author><name sortKey="Chandra, T" uniqKey="Chandra T">T Chandra</name>
</author>
<author><name sortKey="Quail, M" uniqKey="Quail M">M Quail</name>
</author>
<author><name sortKey="Reik, W" uniqKey="Reik W">W Reik</name>
</author>
<author><name sortKey="Swerdlow, H" uniqKey="Swerdlow H">H Swerdlow</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Darriba, D" uniqKey="Darriba D">D Darriba</name>
</author>
<author><name sortKey="Taboada, Gl" uniqKey="Taboada G">GL Taboada</name>
</author>
<author><name sortKey="Doallo, R" uniqKey="Doallo R">R Doallo</name>
</author>
<author><name sortKey="Posada, D" uniqKey="Posada D">D Posada</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Decker, B" uniqKey="Decker B">B Decker</name>
</author>
<author><name sortKey="Davis, Bw" uniqKey="Davis B">BW Davis</name>
</author>
<author><name sortKey="Rimbault, M" uniqKey="Rimbault M">M Rimbault</name>
</author>
<author><name sortKey="Long, Ah" uniqKey="Long A">AH Long</name>
</author>
<author><name sortKey="Karlins, E" uniqKey="Karlins E">E Karlins</name>
</author>
<author><name sortKey="Jagannathan, V" uniqKey="Jagannathan V">V Jagannathan</name>
</author>
<author><name sortKey="Reiman, R" uniqKey="Reiman R">R Reiman</name>
</author>
<author><name sortKey="Parker, Hg" uniqKey="Parker H">HG Parker</name>
</author>
<author><name sortKey="Drogemuller, C" uniqKey="Drogemuller C">C Drögemüller</name>
</author>
<author><name sortKey="Corneveaux, Jj" uniqKey="Corneveaux J">JJ Corneveaux</name>
</author>
<author><name sortKey="Chapman, Es" uniqKey="Chapman E">ES Chapman</name>
</author>
<author><name sortKey="Trent, Jm" uniqKey="Trent J">JM Trent</name>
</author>
<author><name sortKey="Leeb, T" uniqKey="Leeb T">T Leeb</name>
</author>
<author><name sortKey="Huentelman, Mj" uniqKey="Huentelman M">MJ Huentelman</name>
</author>
<author><name sortKey="Wayne, Rk" uniqKey="Wayne R">RK Wayne</name>
</author>
<author><name sortKey="Karyadi, Dm" uniqKey="Karyadi D">DM Karyadi</name>
</author>
<author><name sortKey="Ostrander, Ea" uniqKey="Ostrander E">EA Ostrander</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Fregel, R" uniqKey="Fregel R">R Fregel</name>
</author>
<author><name sortKey="Suarez, Nm" uniqKey="Suarez N">NM Suárez</name>
</author>
<author><name sortKey="Betancor, E" uniqKey="Betancor E">E Betancor</name>
</author>
<author><name sortKey="Gonzalez, Am" uniqKey="Gonzalez A">AM González</name>
</author>
<author><name sortKey="Cabrera, Vm" uniqKey="Cabrera V">VM Cabrera</name>
</author>
<author><name sortKey="Pestano, J" uniqKey="Pestano J">J Pestano</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Gantenbein, B" uniqKey="Gantenbein B">B Gantenbein</name>
</author>
<author><name sortKey="Fet, V" uniqKey="Fet V">V Fet</name>
</author>
<author><name sortKey="Gantenbein Ritter, Ia" uniqKey="Gantenbein Ritter I">IA Gantenbein-Ritter</name>
</author>
<author><name sortKey="Balloux, F" uniqKey="Balloux F">F Balloux</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Gibbs, Mj" uniqKey="Gibbs M">MJ Gibbs</name>
</author>
<author><name sortKey="Armstrong, Js" uniqKey="Armstrong J">JS Armstrong</name>
</author>
<author><name sortKey="Gibbs, Aj" uniqKey="Gibbs A">AJ Gibbs</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Guindon, S" uniqKey="Guindon S">S Guindon</name>
</author>
<author><name sortKey="Dufayard, Jf" uniqKey="Dufayard J">JF Dufayard</name>
</author>
<author><name sortKey="Lefort, V" uniqKey="Lefort V">V Lefort</name>
</author>
<author><name sortKey="Anisimova, M" uniqKey="Anisimova M">M Anisimova</name>
</author>
<author><name sortKey="Hordijk, W" uniqKey="Hordijk W">W Hordijk</name>
</author>
<author><name sortKey="Gascuel, O" uniqKey="Gascuel O">O Gascuel</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Hoarau, G" uniqKey="Hoarau G">G Hoarau</name>
</author>
<author><name sortKey="Holla, S" uniqKey="Holla S">S Holla</name>
</author>
<author><name sortKey="Lescasse, R" uniqKey="Lescasse R">R Lescasse</name>
</author>
<author><name sortKey="Stam, Wt" uniqKey="Stam W">WT Stam</name>
</author>
<author><name sortKey="Olsen, Jl" uniqKey="Olsen J">JL Olsen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Hordijk, W" uniqKey="Hordijk W">W Hordijk</name>
</author>
<author><name sortKey="Gascuel, O" uniqKey="Gascuel O">O Gascuel</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Huson, Dh" uniqKey="Huson D">DH Huson</name>
</author>
<author><name sortKey="Scornavacca, C" uniqKey="Scornavacca C">C Scornavacca</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ju, Ys" uniqKey="Ju Y">YS Ju</name>
</author>
<author><name sortKey="Alexandrov, Lb" uniqKey="Alexandrov L">LB Alexandrov</name>
</author>
<author><name sortKey="Gerstung, M" uniqKey="Gerstung M">M Gerstung</name>
</author>
<author><name sortKey="Martincorena, I" uniqKey="Martincorena I">I Martincorena</name>
</author>
<author><name sortKey="Nik Zainal, S" uniqKey="Nik Zainal S">S Nik-Zainal</name>
</author>
<author><name sortKey="Ramakrishna, M" uniqKey="Ramakrishna M">M Ramakrishna</name>
</author>
<author><name sortKey="Davies, Hr" uniqKey="Davies H">HR Davies</name>
</author>
<author><name sortKey="Papaemmanuil, E" uniqKey="Papaemmanuil E">E Papaemmanuil</name>
</author>
<author><name sortKey="Gundem, G" uniqKey="Gundem G">G Gundem</name>
</author>
<author><name sortKey="Shlien, A" uniqKey="Shlien A">A Shlien</name>
</author>
<author><name sortKey="Bolli, N" uniqKey="Bolli N">N Bolli</name>
</author>
<author><name sortKey="Behjati, S" uniqKey="Behjati S">S Behjati</name>
</author>
<author><name sortKey="Tarpey, Ps" uniqKey="Tarpey P">PS Tarpey</name>
</author>
<author><name sortKey="Nangalia, J" uniqKey="Nangalia J">J Nangalia</name>
</author>
<author><name sortKey="Massie, Ce" uniqKey="Massie C">CE Massie</name>
</author>
<author><name sortKey="Butler, Ap" uniqKey="Butler A">AP Butler</name>
</author>
<author><name sortKey="Teague, Jw" uniqKey="Teague J">JW Teague</name>
</author>
<author><name sortKey="Vassiliou, Gs" uniqKey="Vassiliou G">GS Vassiliou</name>
</author>
<author><name sortKey="Green, Ar" uniqKey="Green A">AR Green</name>
</author>
<author><name sortKey="Du, M Q" uniqKey="Du M">M-Q Du</name>
</author>
<author><name sortKey="Unnikrishnan, A" uniqKey="Unnikrishnan A">A Unnikrishnan</name>
</author>
<author><name sortKey="Pimanda, Je" uniqKey="Pimanda J">JE Pimanda</name>
</author>
<author><name sortKey="Teh, Bt" uniqKey="Teh B">BT Teh</name>
</author>
<author><name sortKey="Munshi, N" uniqKey="Munshi N">N Munshi</name>
</author>
<author><name sortKey="Greaves, M" uniqKey="Greaves M">M Greaves</name>
</author>
<author><name sortKey="Vyas, P" uniqKey="Vyas P">P Vyas</name>
</author>
<author><name sortKey="El Naggar, Ak" uniqKey="El Naggar A">AK El-Naggar</name>
</author>
<author><name sortKey="Santarius, T" uniqKey="Santarius T">T Santarius</name>
</author>
<author><name sortKey="Collins, Vp" uniqKey="Collins V">VP Collins</name>
</author>
<author><name sortKey="Grundy, R" uniqKey="Grundy R">R Grundy</name>
</author>
<author><name sortKey="Taylor, Ja" uniqKey="Taylor J">JA Taylor</name>
</author>
<author><name sortKey="Hayes, Dn" uniqKey="Hayes D">DN Hayes</name>
</author>
<author><name sortKey="Malkin, D" uniqKey="Malkin D">D Malkin</name>
</author>
<author><name sortKey="Foster, Cs" uniqKey="Foster C">CS Foster</name>
</author>
<author><name sortKey="Warren, Ay" uniqKey="Warren A">AY Warren</name>
</author>
<author><name sortKey="Whitaker, Hc" uniqKey="Whitaker H">HC Whitaker</name>
</author>
<author><name sortKey="Brewer, D" uniqKey="Brewer D">D Brewer</name>
</author>
<author><name sortKey="Eeles, R" uniqKey="Eeles R">R Eeles</name>
</author>
<author><name sortKey="Cooper, C" uniqKey="Cooper C">C Cooper</name>
</author>
<author><name sortKey="Neal, D" uniqKey="Neal D">D Neal</name>
</author>
<author><name sortKey="Visakorpi, T" uniqKey="Visakorpi T">T Visakorpi</name>
</author>
<author><name sortKey="Isaacs, Wb" uniqKey="Isaacs W">WB Isaacs</name>
</author>
<author><name sortKey="Bova, Gs" uniqKey="Bova G">GS Bova</name>
</author>
<author><name sortKey="Flanagan, Am" uniqKey="Flanagan A">AM Flanagan</name>
</author>
<author><name sortKey="Futreal, Pa" uniqKey="Futreal P">PA Futreal</name>
</author>
<author><name sortKey="Lynch, Ag" uniqKey="Lynch A">AG Lynch</name>
</author>
<author><name sortKey="Chinnery, Pf" uniqKey="Chinnery P">PF Chinnery</name>
</author>
<author><name sortKey="Mcdermott, U" uniqKey="Mcdermott U">U McDermott</name>
</author>
<author><name sortKey="Stratton, Mr" uniqKey="Stratton M">MR Stratton</name>
</author>
<author><name sortKey="Campbell, Pj" uniqKey="Campbell P">PJ Campbell</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ju, Ys" uniqKey="Ju Y">YS Ju</name>
</author>
<author><name sortKey="Tubio, Jm" uniqKey="Tubio J">JM Tubio</name>
</author>
<author><name sortKey="Mifsud, W" uniqKey="Mifsud W">W Mifsud</name>
</author>
<author><name sortKey="Fu, B" uniqKey="Fu B">B Fu</name>
</author>
<author><name sortKey="Davies, Hr" uniqKey="Davies H">HR Davies</name>
</author>
<author><name sortKey="Ramakrishna, M" uniqKey="Ramakrishna M">M Ramakrishna</name>
</author>
<author><name sortKey="Li, Y" uniqKey="Li Y">Y Li</name>
</author>
<author><name sortKey="Yates, L" uniqKey="Yates L">L Yates</name>
</author>
<author><name sortKey="Gundem, G" uniqKey="Gundem G">G Gundem</name>
</author>
<author><name sortKey="Tarpey, Ps" uniqKey="Tarpey P">PS Tarpey</name>
</author>
<author><name sortKey="Behjati, S" uniqKey="Behjati S">S Behjati</name>
</author>
<author><name sortKey="Papaemmanuil, E" uniqKey="Papaemmanuil E">E Papaemmanuil</name>
</author>
<author><name sortKey="Martin, S" uniqKey="Martin S">S Martin</name>
</author>
<author><name sortKey="Fullam, A" uniqKey="Fullam A">A Fullam</name>
</author>
<author><name sortKey="Gerstung, M" uniqKey="Gerstung M">M Gerstung</name>
</author>
<author><name sortKey="Nangalia, J" uniqKey="Nangalia J">J Nangalia</name>
</author>
<author><name sortKey="Green, Ar" uniqKey="Green A">AR Green</name>
</author>
<author><name sortKey="Caldas, C" uniqKey="Caldas C">C Caldas</name>
</author>
<author><name sortKey="Borg, " uniqKey="Borg ">Å Borg</name>
</author>
<author><name sortKey="Tutt, A" uniqKey="Tutt A">A Tutt</name>
</author>
<author><name sortKey="Lee, Mt" uniqKey="Lee M">MT Lee</name>
</author>
<author><name sortKey="Van T Veer, Lj" uniqKey="Van T Veer L">LJ van't Veer</name>
</author>
<author><name sortKey="Tan, Bk" uniqKey="Tan B">BK Tan</name>
</author>
<author><name sortKey="Aparicio, S" uniqKey="Aparicio S">S Aparicio</name>
</author>
<author><name sortKey="Span, Pn" uniqKey="Span P">PN Span</name>
</author>
<author><name sortKey="Martens, Jw" uniqKey="Martens J">JW Martens</name>
</author>
<author><name sortKey="Knappskog, S" uniqKey="Knappskog S">S Knappskog</name>
</author>
<author><name sortKey="Vincent Salomon, A" uniqKey="Vincent Salomon A">A Vincent-Salomon</name>
</author>
<author><name sortKey="B Rresen Dale, Al" uniqKey="B Rresen Dale A">AL Børresen-Dale</name>
</author>
<author><name sortKey="Eyfjord, Je" uniqKey="Eyfjord J">JE Eyfjörd</name>
</author>
<author><name sortKey="Flanagan, Am" uniqKey="Flanagan A">AM Flanagan</name>
</author>
<author><name sortKey="Foster, C" uniqKey="Foster C">C Foster</name>
</author>
<author><name sortKey="Neal, De" uniqKey="Neal D">DE Neal</name>
</author>
<author><name sortKey="Cooper, C" uniqKey="Cooper C">C Cooper</name>
</author>
<author><name sortKey="Eeles, R" uniqKey="Eeles R">R Eeles</name>
</author>
<author><name sortKey="Lakhani, Sr" uniqKey="Lakhani S">SR Lakhani</name>
</author>
<author><name sortKey="Desmedt, C" uniqKey="Desmedt C">C Desmedt</name>
</author>
<author><name sortKey="Thomas, G" uniqKey="Thomas G">G Thomas</name>
</author>
<author><name sortKey="Richardson, Al" uniqKey="Richardson A">AL Richardson</name>
</author>
<author><name sortKey="Purdie, Ca" uniqKey="Purdie C">CA Purdie</name>
</author>
<author><name sortKey="Thompson, Am" uniqKey="Thompson A">AM Thompson</name>
</author>
<author><name sortKey="Mcdermott, U" uniqKey="Mcdermott U">U McDermott</name>
</author>
<author><name sortKey="Yang, F" uniqKey="Yang F">F Yang</name>
</author>
<author><name sortKey="Nik Zainal, S" uniqKey="Nik Zainal S">S Nik-Zainal</name>
</author>
<author><name sortKey="Campbell, Pj" uniqKey="Campbell P">PJ Campbell</name>
</author>
<author><name sortKey="Stratton, Mr" uniqKey="Stratton M">MR Stratton</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Katzir, N" uniqKey="Katzir N">N Katzir</name>
</author>
<author><name sortKey="Rechavi, G" uniqKey="Rechavi G">G Rechavi</name>
</author>
<author><name sortKey="Cohen, Jb" uniqKey="Cohen J">JB Cohen</name>
</author>
<author><name sortKey="Unger, T" uniqKey="Unger T">T Unger</name>
</author>
<author><name sortKey="Simoni, F" uniqKey="Simoni F">F Simoni</name>
</author>
<author><name sortKey="Segal, S" uniqKey="Segal S">S Segal</name>
</author>
<author><name sortKey="Cohen, D" uniqKey="Cohen D">D Cohen</name>
</author>
<author><name sortKey="Givol, D" uniqKey="Givol D">D Givol</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Katzir, N" uniqKey="Katzir N">N Katzir</name>
</author>
<author><name sortKey="Arman, E" uniqKey="Arman E">E Arman</name>
</author>
<author><name sortKey="Cohen, D" uniqKey="Cohen D">D Cohen</name>
</author>
<author><name sortKey="Givol, D" uniqKey="Givol D">D Givol</name>
</author>
<author><name sortKey="Rechavi, G" uniqKey="Rechavi G">G Rechavi</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kraytsberg, Y" uniqKey="Kraytsberg Y">Y Kraytsberg</name>
</author>
<author><name sortKey="Schwartz, M" uniqKey="Schwartz M">M Schwartz</name>
</author>
<author><name sortKey="Brown, Ta" uniqKey="Brown T">TA Brown</name>
</author>
<author><name sortKey="Ebralidse, K" uniqKey="Ebralidse K">K Ebralidse</name>
</author>
<author><name sortKey="Kunz, Ws" uniqKey="Kunz W">WS Kunz</name>
</author>
<author><name sortKey="Clayton, Da" uniqKey="Clayton D">DA Clayton</name>
</author>
<author><name sortKey="Vissing, J" uniqKey="Vissing J">J Vissing</name>
</author>
<author><name sortKey="Khrapko, K" uniqKey="Khrapko K">K Khrapko</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ladoukakis, Ed" uniqKey="Ladoukakis E">ED Ladoukakis</name>
</author>
<author><name sortKey="Zouros, E" uniqKey="Zouros E">E Zouros</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Li, H" uniqKey="Li H">H Li</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Li, H" uniqKey="Li H">H Li</name>
</author>
<author><name sortKey="Durbin, R" uniqKey="Durbin R">R Durbin</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Li, H" uniqKey="Li H">H Li</name>
</author>
<author><name sortKey="Handsaker, B" uniqKey="Handsaker B">B Handsaker</name>
</author>
<author><name sortKey="Wysoker, A" uniqKey="Wysoker A">A Wysoker</name>
</author>
<author><name sortKey="Fennell, T" uniqKey="Fennell T">T Fennell</name>
</author>
<author><name sortKey="Ruan, J" uniqKey="Ruan J">J Ruan</name>
</author>
<author><name sortKey="Homer, N" uniqKey="Homer N">N Homer</name>
</author>
<author><name sortKey="Marth, G" uniqKey="Marth G">G Marth</name>
</author>
<author><name sortKey="Abecasis, G" uniqKey="Abecasis G">G Abecasis</name>
</author>
<author><name sortKey="Durbin, R" uniqKey="Durbin R">R Durbin</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lindblad Toh, K" uniqKey="Lindblad Toh K">K Lindblad-Toh</name>
</author>
<author><name sortKey="Wade, Cm" uniqKey="Wade C">CM Wade</name>
</author>
<author><name sortKey="Mikkelsen, Ts" uniqKey="Mikkelsen T">TS Mikkelsen</name>
</author>
<author><name sortKey="Karlsson, Ek" uniqKey="Karlsson E">EK Karlsson</name>
</author>
<author><name sortKey="Jaffe, Db" uniqKey="Jaffe D">DB Jaffe</name>
</author>
<author><name sortKey="Kamal, M" uniqKey="Kamal M">M Kamal</name>
</author>
<author><name sortKey="Clamp, M" uniqKey="Clamp M">M Clamp</name>
</author>
<author><name sortKey="Chang, Jl" uniqKey="Chang J">JL Chang</name>
</author>
<author><name sortKey="Kulbokas, Ej" uniqKey="Kulbokas E">EJ Kulbokas</name>
</author>
<author><name sortKey="Zody, Mc" uniqKey="Zody M">MC Zody</name>
</author>
<author><name sortKey="Mauceli, E" uniqKey="Mauceli E">E Mauceli</name>
</author>
<author><name sortKey="Xie, X" uniqKey="Xie X">X Xie</name>
</author>
<author><name sortKey="Breen, M" uniqKey="Breen M">M Breen</name>
</author>
<author><name sortKey="Wayne, Rk" uniqKey="Wayne R">RK Wayne</name>
</author>
<author><name sortKey="Ostrander, Ea" uniqKey="Ostrander E">EA Ostrander</name>
</author>
<author><name sortKey="Ponting, Cp" uniqKey="Ponting C">CP Ponting</name>
</author>
<author><name sortKey="Galibert, F" uniqKey="Galibert F">F Galibert</name>
</author>
<author><name sortKey="Smith, Dr" uniqKey="Smith D">DR Smith</name>
</author>
<author><name sortKey="Dejong, Pj" uniqKey="Dejong P">PJ DeJong</name>
</author>
<author><name sortKey="Kirkness, E" uniqKey="Kirkness E">E Kirkness</name>
</author>
<author><name sortKey="Alvarez, P" uniqKey="Alvarez P">P Alvarez</name>
</author>
<author><name sortKey="Biagi, T" uniqKey="Biagi T">T Biagi</name>
</author>
<author><name sortKey="Brockman, W" uniqKey="Brockman W">W Brockman</name>
</author>
<author><name sortKey="Butler, J" uniqKey="Butler J">J Butler</name>
</author>
<author><name sortKey="Chin, Cw" uniqKey="Chin C">CW Chin</name>
</author>
<author><name sortKey="Cook, A" uniqKey="Cook A">A Cook</name>
</author>
<author><name sortKey="Cuff, J" uniqKey="Cuff J">J Cuff</name>
</author>
<author><name sortKey="Daly, Mj" uniqKey="Daly M">MJ Daly</name>
</author>
<author><name sortKey="Decaprio, D" uniqKey="Decaprio D">D DeCaprio</name>
</author>
<author><name sortKey="Gnerre, S" uniqKey="Gnerre S">S Gnerre</name>
</author>
<author><name sortKey="Grabherr, M" uniqKey="Grabherr M">M Grabherr</name>
</author>
<author><name sortKey="Kellis, M" uniqKey="Kellis M">M Kellis</name>
</author>
<author><name sortKey="Kleber, M" uniqKey="Kleber M">M Kleber</name>
</author>
<author><name sortKey="Bardeleben, C" uniqKey="Bardeleben C">C Bardeleben</name>
</author>
<author><name sortKey="Goodstadt, L" uniqKey="Goodstadt L">L Goodstadt</name>
</author>
<author><name sortKey="Heger, A" uniqKey="Heger A">A Heger</name>
</author>
<author><name sortKey="Hitte, C" uniqKey="Hitte C">C Hitte</name>
</author>
<author><name sortKey="Kim, L" uniqKey="Kim L">L Kim</name>
</author>
<author><name sortKey="Koepfli, Kp" uniqKey="Koepfli K">KP Koepfli</name>
</author>
<author><name sortKey="Parker, Hg" uniqKey="Parker H">HG Parker</name>
</author>
<author><name sortKey="Pollinger, Jp" uniqKey="Pollinger J">JP Pollinger</name>
</author>
<author><name sortKey="Searle, Sm" uniqKey="Searle S">SM Searle</name>
</author>
<author><name sortKey="Sutter, Nb" uniqKey="Sutter N">NB Sutter</name>
</author>
<author><name sortKey="Thomas, R" uniqKey="Thomas R">R Thomas</name>
</author>
<author><name sortKey="Webber, C" uniqKey="Webber C">C Webber</name>
</author>
<author><name sortKey="Baldwin, J" uniqKey="Baldwin J">J Baldwin</name>
</author>
<author><name sortKey="Abebe, A" uniqKey="Abebe A">A Abebe</name>
</author>
<author><name sortKey="Abouelleil, A" uniqKey="Abouelleil A">A Abouelleil</name>
</author>
<author><name sortKey="Aftuck, L" uniqKey="Aftuck L">L Aftuck</name>
</author>
<author><name sortKey="Ait Zahra, M" uniqKey="Ait Zahra M">M Ait-Zahra</name>
</author>
<author><name sortKey="Aldredge, T" uniqKey="Aldredge T">T Aldredge</name>
</author>
<author><name sortKey="Allen, N" uniqKey="Allen N">N Allen</name>
</author>
<author><name sortKey="An, P" uniqKey="An P">P An</name>
</author>
<author><name sortKey="Anderson, S" uniqKey="Anderson S">S Anderson</name>
</author>
<author><name sortKey="Antoine, C" uniqKey="Antoine C">C Antoine</name>
</author>
<author><name sortKey="Arachchi, H" uniqKey="Arachchi H">H Arachchi</name>
</author>
<author><name sortKey="Aslam, A" uniqKey="Aslam A">A Aslam</name>
</author>
<author><name sortKey="Ayotte, L" uniqKey="Ayotte L">L Ayotte</name>
</author>
<author><name sortKey="Bachantsang, P" uniqKey="Bachantsang P">P Bachantsang</name>
</author>
<author><name sortKey="Barry, A" uniqKey="Barry A">A Barry</name>
</author>
<author><name sortKey="Bayul, T" uniqKey="Bayul T">T Bayul</name>
</author>
<author><name sortKey="Benamara, M" uniqKey="Benamara M">M Benamara</name>
</author>
<author><name sortKey="Berlin, A" uniqKey="Berlin A">A Berlin</name>
</author>
<author><name sortKey="Bessette, D" uniqKey="Bessette D">D Bessette</name>
</author>
<author><name sortKey="Blitshteyn, B" uniqKey="Blitshteyn B">B Blitshteyn</name>
</author>
<author><name sortKey="Bloom, T" uniqKey="Bloom T">T Bloom</name>
</author>
<author><name sortKey="Blye, J" uniqKey="Blye J">J Blye</name>
</author>
<author><name sortKey="Boguslavskiy, L" uniqKey="Boguslavskiy L">L Boguslavskiy</name>
</author>
<author><name sortKey="Bonnet, C" uniqKey="Bonnet C">C Bonnet</name>
</author>
<author><name sortKey="Boukhgalter, B" uniqKey="Boukhgalter B">B Boukhgalter</name>
</author>
<author><name sortKey="Brown, A" uniqKey="Brown A">A Brown</name>
</author>
<author><name sortKey="Cahill, P" uniqKey="Cahill P">P Cahill</name>
</author>
<author><name sortKey="Calixte, N" uniqKey="Calixte N">N Calixte</name>
</author>
<author><name sortKey="Camarata, J" uniqKey="Camarata J">J Camarata</name>
</author>
<author><name sortKey="Cheshatsang, Y" uniqKey="Cheshatsang Y">Y Cheshatsang</name>
</author>
<author><name sortKey="Chu, J" uniqKey="Chu J">J Chu</name>
</author>
<author><name sortKey="Citroen, M" uniqKey="Citroen M">M Citroen</name>
</author>
<author><name sortKey="Collymore, A" uniqKey="Collymore A">A Collymore</name>
</author>
<author><name sortKey="Cooke, P" uniqKey="Cooke P">P Cooke</name>
</author>
<author><name sortKey="Dawoe, T" uniqKey="Dawoe T">T Dawoe</name>
</author>
<author><name sortKey="Daza, R" uniqKey="Daza R">R Daza</name>
</author>
<author><name sortKey="Decktor, K" uniqKey="Decktor K">K Decktor</name>
</author>
<author><name sortKey="Degray, S" uniqKey="Degray S">S DeGray</name>
</author>
<author><name sortKey="Dhargay, N" uniqKey="Dhargay N">N Dhargay</name>
</author>
<author><name sortKey="Dooley, K" uniqKey="Dooley K">K Dooley</name>
</author>
<author><name sortKey="Dooley, K" uniqKey="Dooley K">K Dooley</name>
</author>
<author><name sortKey="Dorje, P" uniqKey="Dorje P">P Dorje</name>
</author>
<author><name sortKey="Dorjee, K" uniqKey="Dorjee K">K Dorjee</name>
</author>
<author><name sortKey="Dorris, L" uniqKey="Dorris L">L Dorris</name>
</author>
<author><name sortKey="Duffey, N" uniqKey="Duffey N">N Duffey</name>
</author>
<author><name sortKey="Dupes, A" uniqKey="Dupes A">A Dupes</name>
</author>
<author><name sortKey="Egbiremolen, O" uniqKey="Egbiremolen O">O Egbiremolen</name>
</author>
<author><name sortKey="Elong, R" uniqKey="Elong R">R Elong</name>
</author>
<author><name sortKey="Falk, J" uniqKey="Falk J">J Falk</name>
</author>
<author><name sortKey="Farina, A" uniqKey="Farina A">A Farina</name>
</author>
<author><name sortKey="Faro, S" uniqKey="Faro S">S Faro</name>
</author>
<author><name sortKey="Ferguson, D" uniqKey="Ferguson D">D Ferguson</name>
</author>
<author><name sortKey="Ferreira, P" uniqKey="Ferreira P">P Ferreira</name>
</author>
<author><name sortKey="Fisher, S" uniqKey="Fisher S">S Fisher</name>
</author>
<author><name sortKey="Fitzgerald, M" uniqKey="Fitzgerald M">M FitzGerald</name>
</author>
<author><name sortKey="Foley, K" uniqKey="Foley K">K Foley</name>
</author>
<author><name sortKey="Foley, C" uniqKey="Foley C">C Foley</name>
</author>
<author><name sortKey="Franke, A" uniqKey="Franke A">A Franke</name>
</author>
<author><name sortKey="Friedrich, D" uniqKey="Friedrich D">D Friedrich</name>
</author>
<author><name sortKey="Gage, D" uniqKey="Gage D">D Gage</name>
</author>
<author><name sortKey="Garber, M" uniqKey="Garber M">M Garber</name>
</author>
<author><name sortKey="Gearin, G" uniqKey="Gearin G">G Gearin</name>
</author>
<author><name sortKey="Giannoukos, G" uniqKey="Giannoukos G">G Giannoukos</name>
</author>
<author><name sortKey="Goode, T" uniqKey="Goode T">T Goode</name>
</author>
<author><name sortKey="Goyette, A" uniqKey="Goyette A">A Goyette</name>
</author>
<author><name sortKey="Graham, J" uniqKey="Graham J">J Graham</name>
</author>
<author><name sortKey="Grandbois, E" uniqKey="Grandbois E">E Grandbois</name>
</author>
<author><name sortKey="Gyaltsen, K" uniqKey="Gyaltsen K">K Gyaltsen</name>
</author>
<author><name sortKey="Hafez, N" uniqKey="Hafez N">N Hafez</name>
</author>
<author><name sortKey="Hagopian, D" uniqKey="Hagopian D">D Hagopian</name>
</author>
<author><name sortKey="Hagos, B" uniqKey="Hagos B">B Hagos</name>
</author>
<author><name sortKey="Hall, J" uniqKey="Hall J">J Hall</name>
</author>
<author><name sortKey="Healy, C" uniqKey="Healy C">C Healy</name>
</author>
<author><name sortKey="Hegarty, R" uniqKey="Hegarty R">R Hegarty</name>
</author>
<author><name sortKey="Honan, T" uniqKey="Honan T">T Honan</name>
</author>
<author><name sortKey="Horn, A" uniqKey="Horn A">A Horn</name>
</author>
<author><name sortKey="Houde, N" uniqKey="Houde N">N Houde</name>
</author>
<author><name sortKey="Hughes, L" uniqKey="Hughes L">L Hughes</name>
</author>
<author><name sortKey="Hunnicutt, L" uniqKey="Hunnicutt L">L Hunnicutt</name>
</author>
<author><name sortKey="Husby, M" uniqKey="Husby M">M Husby</name>
</author>
<author><name sortKey="Jester, B" uniqKey="Jester B">B Jester</name>
</author>
<author><name sortKey="Jones, C" uniqKey="Jones C">C Jones</name>
</author>
<author><name sortKey="Kamat, A" uniqKey="Kamat A">A Kamat</name>
</author>
<author><name sortKey="Kanga, B" uniqKey="Kanga B">B Kanga</name>
</author>
<author><name sortKey="Kells, C" uniqKey="Kells C">C Kells</name>
</author>
<author><name sortKey="Khazanovich, D" uniqKey="Khazanovich D">D Khazanovich</name>
</author>
<author><name sortKey="Kieu, Ac" uniqKey="Kieu A">AC Kieu</name>
</author>
<author><name sortKey="Kisner, P" uniqKey="Kisner P">P Kisner</name>
</author>
<author><name sortKey="Kumar, M" uniqKey="Kumar M">M Kumar</name>
</author>
<author><name sortKey="Lance, K" uniqKey="Lance K">K Lance</name>
</author>
<author><name sortKey="Landers, T" uniqKey="Landers T">T Landers</name>
</author>
<author><name sortKey="Lara, M" uniqKey="Lara M">M Lara</name>
</author>
<author><name sortKey="Lee, W" uniqKey="Lee W">W Lee</name>
</author>
<author><name sortKey="Leger, Jp" uniqKey="Leger J">JP Leger</name>
</author>
<author><name sortKey="Lennon, N" uniqKey="Lennon N">N Lennon</name>
</author>
<author><name sortKey="Leuper, L" uniqKey="Leuper L">L Leuper</name>
</author>
<author><name sortKey="Levine, S" uniqKey="Levine S">S LeVine</name>
</author>
<author><name sortKey="Liu, J" uniqKey="Liu J">J Liu</name>
</author>
<author><name sortKey="Liu, X" uniqKey="Liu X">X Liu</name>
</author>
<author><name sortKey="Lokyitsang, Y" uniqKey="Lokyitsang Y">Y Lokyitsang</name>
</author>
<author><name sortKey="Lokyitsang, T" uniqKey="Lokyitsang T">T Lokyitsang</name>
</author>
<author><name sortKey="Lui, A" uniqKey="Lui A">A Lui</name>
</author>
<author><name sortKey="Macdonald, J" uniqKey="Macdonald J">J Macdonald</name>
</author>
<author><name sortKey="Major, J" uniqKey="Major J">J Major</name>
</author>
<author><name sortKey="Marabella, R" uniqKey="Marabella R">R Marabella</name>
</author>
<author><name sortKey="Maru, K" uniqKey="Maru K">K Maru</name>
</author>
<author><name sortKey="Matthews, C" uniqKey="Matthews C">C Matthews</name>
</author>
<author><name sortKey="Mcdonough, S" uniqKey="Mcdonough S">S McDonough</name>
</author>
<author><name sortKey="Mehta, T" uniqKey="Mehta T">T Mehta</name>
</author>
<author><name sortKey="Meldrim, J" uniqKey="Meldrim J">J Meldrim</name>
</author>
<author><name sortKey="Melnikov, A" uniqKey="Melnikov A">A Melnikov</name>
</author>
<author><name sortKey="Meneus, L" uniqKey="Meneus L">L Meneus</name>
</author>
<author><name sortKey="Mihalev, A" uniqKey="Mihalev A">A Mihalev</name>
</author>
<author><name sortKey="Mihova, T" uniqKey="Mihova T">T Mihova</name>
</author>
<author><name sortKey="Miller, K" uniqKey="Miller K">K Miller</name>
</author>
<author><name sortKey="Mittelman, R" uniqKey="Mittelman R">R Mittelman</name>
</author>
<author><name sortKey="Mlenga, V" uniqKey="Mlenga V">V Mlenga</name>
</author>
<author><name sortKey="Mulrain, L" uniqKey="Mulrain L">L Mulrain</name>
</author>
<author><name sortKey="Munson, G" uniqKey="Munson G">G Munson</name>
</author>
<author><name sortKey="Navidi, A" uniqKey="Navidi A">A Navidi</name>
</author>
<author><name sortKey="Naylor, J" uniqKey="Naylor J">J Naylor</name>
</author>
<author><name sortKey="Nguyen, T" uniqKey="Nguyen T">T Nguyen</name>
</author>
<author><name sortKey="Nguyen, N" uniqKey="Nguyen N">N Nguyen</name>
</author>
<author><name sortKey="Nguyen, C" uniqKey="Nguyen C">C Nguyen</name>
</author>
<author><name sortKey="Nguyen, T" uniqKey="Nguyen T">T Nguyen</name>
</author>
<author><name sortKey="Nicol, R" uniqKey="Nicol R">R Nicol</name>
</author>
<author><name sortKey="Norbu, N" uniqKey="Norbu N">N Norbu</name>
</author>
<author><name sortKey="Norbu, C" uniqKey="Norbu C">C Norbu</name>
</author>
<author><name sortKey="Novod, N" uniqKey="Novod N">N Novod</name>
</author>
<author><name sortKey="Nyima, T" uniqKey="Nyima T">T Nyima</name>
</author>
<author><name sortKey="Olandt, P" uniqKey="Olandt P">P Olandt</name>
</author>
<author><name sortKey="O Neill, B" uniqKey="O Neill B">B O'Neill</name>
</author>
<author><name sortKey="O Neill, K" uniqKey="O Neill K">K O'Neill</name>
</author>
<author><name sortKey="Osman, S" uniqKey="Osman S">S Osman</name>
</author>
<author><name sortKey="Oyono, L" uniqKey="Oyono L">L Oyono</name>
</author>
<author><name sortKey="Patti, C" uniqKey="Patti C">C Patti</name>
</author>
<author><name sortKey="Perrin, D" uniqKey="Perrin D">D Perrin</name>
</author>
<author><name sortKey="Phunkhang, P" uniqKey="Phunkhang P">P Phunkhang</name>
</author>
<author><name sortKey="Pierre, F" uniqKey="Pierre F">F Pierre</name>
</author>
<author><name sortKey="Priest, M" uniqKey="Priest M">M Priest</name>
</author>
<author><name sortKey="Rachupka, A" uniqKey="Rachupka A">A Rachupka</name>
</author>
<author><name sortKey="Raghuraman, S" uniqKey="Raghuraman S">S Raghuraman</name>
</author>
<author><name sortKey="Rameau, R" uniqKey="Rameau R">R Rameau</name>
</author>
<author><name sortKey="Ray, V" uniqKey="Ray V">V Ray</name>
</author>
<author><name sortKey="Raymond, C" uniqKey="Raymond C">C Raymond</name>
</author>
<author><name sortKey="Rege, F" uniqKey="Rege F">F Rege</name>
</author>
<author><name sortKey="Rise, C" uniqKey="Rise C">C Rise</name>
</author>
<author><name sortKey="Rogers, J" uniqKey="Rogers J">J Rogers</name>
</author>
<author><name sortKey="Rogov, P" uniqKey="Rogov P">P Rogov</name>
</author>
<author><name sortKey="Sahalie, J" uniqKey="Sahalie J">J Sahalie</name>
</author>
<author><name sortKey="Settipalli, S" uniqKey="Settipalli S">S Settipalli</name>
</author>
<author><name sortKey="Sharpe, T" uniqKey="Sharpe T">T Sharpe</name>
</author>
<author><name sortKey="Shea, T" uniqKey="Shea T">T Shea</name>
</author>
<author><name sortKey="Sheehan, M" uniqKey="Sheehan M">M Sheehan</name>
</author>
<author><name sortKey="Sherpa, N" uniqKey="Sherpa N">N Sherpa</name>
</author>
<author><name sortKey="Shi, J" uniqKey="Shi J">J Shi</name>
</author>
<author><name sortKey="Shih, D" uniqKey="Shih D">D Shih</name>
</author>
<author><name sortKey="Sloan, J" uniqKey="Sloan J">J Sloan</name>
</author>
<author><name sortKey="Smith, C" uniqKey="Smith C">C Smith</name>
</author>
<author><name sortKey="Sparrow, T" uniqKey="Sparrow T">T Sparrow</name>
</author>
<author><name sortKey="Stalker, J" uniqKey="Stalker J">J Stalker</name>
</author>
<author><name sortKey="Stange Thomann, N" uniqKey="Stange Thomann N">N Stange-Thomann</name>
</author>
<author><name sortKey="Stavropoulos, S" uniqKey="Stavropoulos S">S Stavropoulos</name>
</author>
<author><name sortKey="Stone, C" uniqKey="Stone C">C Stone</name>
</author>
<author><name sortKey="Stone, S" uniqKey="Stone S">S Stone</name>
</author>
<author><name sortKey="Sykes, S" uniqKey="Sykes S">S Sykes</name>
</author>
<author><name sortKey="Tchuinga, P" uniqKey="Tchuinga P">P Tchuinga</name>
</author>
<author><name sortKey="Tenzing, P" uniqKey="Tenzing P">P Tenzing</name>
</author>
<author><name sortKey="Tesfaye, S" uniqKey="Tesfaye S">S Tesfaye</name>
</author>
<author><name sortKey="Thoulutsang, D" uniqKey="Thoulutsang D">D Thoulutsang</name>
</author>
<author><name sortKey="Thoulutsang, Y" uniqKey="Thoulutsang Y">Y Thoulutsang</name>
</author>
<author><name sortKey="Topham, K" uniqKey="Topham K">K Topham</name>
</author>
<author><name sortKey="Topping, I" uniqKey="Topping I">I Topping</name>
</author>
<author><name sortKey="Tsamla, T" uniqKey="Tsamla T">T Tsamla</name>
</author>
<author><name sortKey="Vassiliev, H" uniqKey="Vassiliev H">H Vassiliev</name>
</author>
<author><name sortKey="Venkataraman, V" uniqKey="Venkataraman V">V Venkataraman</name>
</author>
<author><name sortKey="Vo, A" uniqKey="Vo A">A Vo</name>
</author>
<author><name sortKey="Wangchuk, T" uniqKey="Wangchuk T">T Wangchuk</name>
</author>
<author><name sortKey="Wangdi, T" uniqKey="Wangdi T">T Wangdi</name>
</author>
<author><name sortKey="Weiand, M" uniqKey="Weiand M">M Weiand</name>
</author>
<author><name sortKey="Wilkinson, J" uniqKey="Wilkinson J">J Wilkinson</name>
</author>
<author><name sortKey="Wilson, A" uniqKey="Wilson A">A Wilson</name>
</author>
<author><name sortKey="Yadav, S" uniqKey="Yadav S">S Yadav</name>
</author>
<author><name sortKey="Yang, S" uniqKey="Yang S">S Yang</name>
</author>
<author><name sortKey="Yang, X" uniqKey="Yang X">X Yang</name>
</author>
<author><name sortKey="Young, G" uniqKey="Young G">G Young</name>
</author>
<author><name sortKey="Yu, Q" uniqKey="Yu Q">Q Yu</name>
</author>
<author><name sortKey="Zainoun, J" uniqKey="Zainoun J">J Zainoun</name>
</author>
<author><name sortKey="Zembek, L" uniqKey="Zembek L">L Zembek</name>
</author>
<author><name sortKey="Zimmer, A" uniqKey="Zimmer A">A Zimmer</name>
</author>
<author><name sortKey="Lander, Es" uniqKey="Lander E">ES Lander</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lunt, Dh" uniqKey="Lunt D">DH Lunt</name>
</author>
<author><name sortKey="Hyman, Bc" uniqKey="Hyman B">BC Hyman</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Martin, D" uniqKey="Martin D">D Martin</name>
</author>
<author><name sortKey="Rybicki, E" uniqKey="Rybicki E">E Rybicki</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Martin, Dp" uniqKey="Martin D">DP Martin</name>
</author>
<author><name sortKey="Murrell, B" uniqKey="Murrell B">B Murrell</name>
</author>
<author><name sortKey="Golden, M" uniqKey="Golden M">M Golden</name>
</author>
<author><name sortKey="Khoosal, A" uniqKey="Khoosal A">A Khoosal</name>
</author>
<author><name sortKey="Muhire, B" uniqKey="Muhire B">B Muhire</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Martincorena, I" uniqKey="Martincorena I">I Martincorena</name>
</author>
<author><name sortKey="Roshan, A" uniqKey="Roshan A">A Roshan</name>
</author>
<author><name sortKey="Gerstung, M" uniqKey="Gerstung M">M Gerstung</name>
</author>
<author><name sortKey="Ellis, P" uniqKey="Ellis P">P Ellis</name>
</author>
<author><name sortKey="Van Loo, P" uniqKey="Van Loo P">P Van Loo</name>
</author>
<author><name sortKey="Mclaren, S" uniqKey="Mclaren S">S McLaren</name>
</author>
<author><name sortKey="Wedge, Dc" uniqKey="Wedge D">DC Wedge</name>
</author>
<author><name sortKey="Fullam, A" uniqKey="Fullam A">A Fullam</name>
</author>
<author><name sortKey="Alexandrov, Lb" uniqKey="Alexandrov L">LB Alexandrov</name>
</author>
<author><name sortKey="Tubio, Jm" uniqKey="Tubio J">JM Tubio</name>
</author>
<author><name sortKey="Stebbings, L" uniqKey="Stebbings L">L Stebbings</name>
</author>
<author><name sortKey="Menzies, A" uniqKey="Menzies A">A Menzies</name>
</author>
<author><name sortKey="Widaa, S" uniqKey="Widaa S">S Widaa</name>
</author>
<author><name sortKey="Stratton, Mr" uniqKey="Stratton M">MR Stratton</name>
</author>
<author><name sortKey="Jones, Ph" uniqKey="Jones P">PH Jones</name>
</author>
<author><name sortKey="Campbell, Pj" uniqKey="Campbell P">PJ Campbell</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Mclaren, W" uniqKey="Mclaren W">W McLaren</name>
</author>
<author><name sortKey="Pritchard, B" uniqKey="Pritchard B">B Pritchard</name>
</author>
<author><name sortKey="Rios, D" uniqKey="Rios D">D Rios</name>
</author>
<author><name sortKey="Chen, Y" uniqKey="Chen Y">Y Chen</name>
</author>
<author><name sortKey="Flicek, P" uniqKey="Flicek P">P Flicek</name>
</author>
<author><name sortKey="Cunningham, F" uniqKey="Cunningham F">F Cunningham</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Murchison, Ep" uniqKey="Murchison E">EP Murchison</name>
</author>
<author><name sortKey="Wedge, Dc" uniqKey="Wedge D">DC Wedge</name>
</author>
<author><name sortKey="Alexandrov, Lb" uniqKey="Alexandrov L">LB Alexandrov</name>
</author>
<author><name sortKey="Fu, B" uniqKey="Fu B">B Fu</name>
</author>
<author><name sortKey="Martincorena, I" uniqKey="Martincorena I">I Martincorena</name>
</author>
<author><name sortKey="Ning, Z" uniqKey="Ning Z">Z Ning</name>
</author>
<author><name sortKey="Tubio, Jm" uniqKey="Tubio J">JM Tubio</name>
</author>
<author><name sortKey="Werner, Ei" uniqKey="Werner E">EI Werner</name>
</author>
<author><name sortKey="Allen, J" uniqKey="Allen J">J Allen</name>
</author>
<author><name sortKey="De Nardi, Ab" uniqKey="De Nardi A">AB De Nardi</name>
</author>
<author><name sortKey="Donelan, Em" uniqKey="Donelan E">EM Donelan</name>
</author>
<author><name sortKey="Marino, G" uniqKey="Marino G">G Marino</name>
</author>
<author><name sortKey="Fassati, A" uniqKey="Fassati A">A Fassati</name>
</author>
<author><name sortKey="Campbell, Pj" uniqKey="Campbell P">PJ Campbell</name>
</author>
<author><name sortKey="Yang, F" uniqKey="Yang F">F Yang</name>
</author>
<author><name sortKey="Burt, A" uniqKey="Burt A">A Burt</name>
</author>
<author><name sortKey="Weiss, Ra" uniqKey="Weiss R">RA Weiss</name>
</author>
<author><name sortKey="Stratton, Mr" uniqKey="Stratton M">MR Stratton</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Murgia, C" uniqKey="Murgia C">C Murgia</name>
</author>
<author><name sortKey="Pritchard, Jk" uniqKey="Pritchard J">JK Pritchard</name>
</author>
<author><name sortKey="Kim, Sy" uniqKey="Kim S">SY Kim</name>
</author>
<author><name sortKey="Fassati, A" uniqKey="Fassati A">A Fassati</name>
</author>
<author><name sortKey="Weiss, Ra" uniqKey="Weiss R">RA Weiss</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Nik Zainal, S" uniqKey="Nik Zainal S">S Nik-Zainal</name>
</author>
<author><name sortKey="Alexandrov, Lb" uniqKey="Alexandrov L">LB Alexandrov</name>
</author>
<author><name sortKey="Wedge, Dc" uniqKey="Wedge D">DC Wedge</name>
</author>
<author><name sortKey="Van Loo, P" uniqKey="Van Loo P">P Van Loo</name>
</author>
<author><name sortKey="Greenman, Cd" uniqKey="Greenman C">CD Greenman</name>
</author>
<author><name sortKey="Raine, K" uniqKey="Raine K">K Raine</name>
</author>
<author><name sortKey="Jones, D" uniqKey="Jones D">D Jones</name>
</author>
<author><name sortKey="Hinton, J" uniqKey="Hinton J">J Hinton</name>
</author>
<author><name sortKey="Marshall, J" uniqKey="Marshall J">J Marshall</name>
</author>
<author><name sortKey="Stebbings, La" uniqKey="Stebbings L">LA Stebbings</name>
</author>
<author><name sortKey="Menzies, A" uniqKey="Menzies A">A Menzies</name>
</author>
<author><name sortKey="Martin, S" uniqKey="Martin S">S Martin</name>
</author>
<author><name sortKey="Leung, K" uniqKey="Leung K">K Leung</name>
</author>
<author><name sortKey="Chen, L" uniqKey="Chen L">L Chen</name>
</author>
<author><name sortKey="Leroy, C" uniqKey="Leroy C">C Leroy</name>
</author>
<author><name sortKey="Ramakrishna, M" uniqKey="Ramakrishna M">M Ramakrishna</name>
</author>
<author><name sortKey="Rance, R" uniqKey="Rance R">R Rance</name>
</author>
<author><name sortKey="Lau, Kw" uniqKey="Lau K">KW Lau</name>
</author>
<author><name sortKey="Mudie, Lj" uniqKey="Mudie L">LJ Mudie</name>
</author>
<author><name sortKey="Varela, I" uniqKey="Varela I">I Varela</name>
</author>
<author><name sortKey="Mcbride, Dj" uniqKey="Mcbride D">DJ McBride</name>
</author>
<author><name sortKey="Bignell, Gr" uniqKey="Bignell G">GR Bignell</name>
</author>
<author><name sortKey="Cooke, Sl" uniqKey="Cooke S">SL Cooke</name>
</author>
<author><name sortKey="Shlien, A" uniqKey="Shlien A">A Shlien</name>
</author>
<author><name sortKey="Gamble, J" uniqKey="Gamble J">J Gamble</name>
</author>
<author><name sortKey="Whitmore, I" uniqKey="Whitmore I">I Whitmore</name>
</author>
<author><name sortKey="Maddison, M" uniqKey="Maddison M">M Maddison</name>
</author>
<author><name sortKey="Tarpey, Ps" uniqKey="Tarpey P">PS Tarpey</name>
</author>
<author><name sortKey="Davies, Hr" uniqKey="Davies H">HR Davies</name>
</author>
<author><name sortKey="Papaemmanuil, E" uniqKey="Papaemmanuil E">E Papaemmanuil</name>
</author>
<author><name sortKey="Stephens, Pj" uniqKey="Stephens P">PJ Stephens</name>
</author>
<author><name sortKey="Mclaren, S" uniqKey="Mclaren S">S McLaren</name>
</author>
<author><name sortKey="Butler, Ap" uniqKey="Butler A">AP Butler</name>
</author>
<author><name sortKey="Teague, Jw" uniqKey="Teague J">JW Teague</name>
</author>
<author><name sortKey="Jonsson, G" uniqKey="Jonsson G">G Jönsson</name>
</author>
<author><name sortKey="Garber, Je" uniqKey="Garber J">JE Garber</name>
</author>
<author><name sortKey="Silver, D" uniqKey="Silver D">D Silver</name>
</author>
<author><name sortKey="Miron, P" uniqKey="Miron P">P Miron</name>
</author>
<author><name sortKey="Fatima, A" uniqKey="Fatima A">A Fatima</name>
</author>
<author><name sortKey="Boyault, S" uniqKey="Boyault S">S Boyault</name>
</author>
<author><name sortKey="Langer D, A" uniqKey="Langer D A">A Langerød</name>
</author>
<author><name sortKey="Tutt, A" uniqKey="Tutt A">A Tutt</name>
</author>
<author><name sortKey="Martens, Jw" uniqKey="Martens J">JW Martens</name>
</author>
<author><name sortKey="Aparicio, Sa" uniqKey="Aparicio S">SA Aparicio</name>
</author>
<author><name sortKey="Borg, " uniqKey="Borg ">Å Borg</name>
</author>
<author><name sortKey="Salomon, Av" uniqKey="Salomon A">AV Salomon</name>
</author>
<author><name sortKey="Thomas, G" uniqKey="Thomas G">G Thomas</name>
</author>
<author><name sortKey="B Rresen Dale, Al" uniqKey="B Rresen Dale A">AL Børresen-Dale</name>
</author>
<author><name sortKey="Richardson, Al" uniqKey="Richardson A">AL Richardson</name>
</author>
<author><name sortKey="Neuberger, Ms" uniqKey="Neuberger M">MS Neuberger</name>
</author>
<author><name sortKey="Futreal, Pa" uniqKey="Futreal P">PA Futreal</name>
</author>
<author><name sortKey="Campbell, Pj" uniqKey="Campbell P">PJ Campbell</name>
</author>
<author><name sortKey="Stratton, Mr" uniqKey="Stratton M">MR Stratton</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Pang, J F" uniqKey="Pang J">J-F Pang</name>
</author>
<author><name sortKey="Kluetsch, C" uniqKey="Kluetsch C">C Kluetsch</name>
</author>
<author><name sortKey="Zou, X J" uniqKey="Zou X">X-J Zou</name>
</author>
<author><name sortKey="Zhang, A B" uniqKey="Zhang A">A.-b. Zhang</name>
</author>
<author><name sortKey="Luo, L Y" uniqKey="Luo L">L-Y Luo</name>
</author>
<author><name sortKey="Angleby, H" uniqKey="Angleby H">H Angleby</name>
</author>
<author><name sortKey="Ardalan, A" uniqKey="Ardalan A">A Ardalan</name>
</author>
<author><name sortKey="Ekstrom, C" uniqKey="Ekstrom C">C Ekstrom</name>
</author>
<author><name sortKey="Skollermo, A" uniqKey="Skollermo A">A Skollermo</name>
</author>
<author><name sortKey="Lundeberg, J" uniqKey="Lundeberg J">J Lundeberg</name>
</author>
<author><name sortKey="Matsumura, S" uniqKey="Matsumura S">S Matsumura</name>
</author>
<author><name sortKey="Leitner, T" uniqKey="Leitner T">T Leitner</name>
</author>
<author><name sortKey="Zhang, Y P" uniqKey="Zhang Y">Y-P Zhang</name>
</author>
<author><name sortKey="Savolainen, P" uniqKey="Savolainen P">P Savolainen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Posada, D" uniqKey="Posada D">D Posada</name>
</author>
<author><name sortKey="Crandall, Ka" uniqKey="Crandall K">KA Crandall</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="R Development Core Team" uniqKey="R Development Core Team">R Development Core Team</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Rebbeck, Ca" uniqKey="Rebbeck C">CA Rebbeck</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Rebbeck, Ca" uniqKey="Rebbeck C">CA Rebbeck</name>
</author>
<author><name sortKey="Thomas, R" uniqKey="Thomas R">R Thomas</name>
</author>
<author><name sortKey="Breen, M" uniqKey="Breen M">M Breen</name>
</author>
<author><name sortKey="Leroi, Am" uniqKey="Leroi A">AM Leroi</name>
</author>
<author><name sortKey="Burt, A" uniqKey="Burt A">A Burt</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Rebbeck, Ca" uniqKey="Rebbeck C">CA Rebbeck</name>
</author>
<author><name sortKey="Leroi, Am" uniqKey="Leroi A">AM Leroi</name>
</author>
<author><name sortKey="Burt, A" uniqKey="Burt A">A Burt</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Robinson, Jt" uniqKey="Robinson J">JT Robinson</name>
</author>
<author><name sortKey="Thorvaldsd Ttir, H" uniqKey="Thorvaldsd Ttir H">H Thorvaldsdóttir</name>
</author>
<author><name sortKey="Winckler, W" uniqKey="Winckler W">W Winckler</name>
</author>
<author><name sortKey="Guttman, M" uniqKey="Guttman M">M Guttman</name>
</author>
<author><name sortKey="Lander, Es" uniqKey="Lander E">ES Lander</name>
</author>
<author><name sortKey="Getz, G" uniqKey="Getz G">G Getz</name>
</author>
<author><name sortKey="Mesirov, Jp" uniqKey="Mesirov J">JP Mesirov</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Savolainen, P" uniqKey="Savolainen P">P Savolainen</name>
</author>
<author><name sortKey="Zhang, Yp" uniqKey="Zhang Y">YP Zhang</name>
</author>
<author><name sortKey="Luo, J" uniqKey="Luo J">J Luo</name>
</author>
<author><name sortKey="Lundeberg, J" uniqKey="Lundeberg J">J Lundeberg</name>
</author>
<author><name sortKey="Leitner, T" uniqKey="Leitner T">T Leitner</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Shannon, Lm" uniqKey="Shannon L">LM Shannon</name>
</author>
<author><name sortKey="Boyko, Rh" uniqKey="Boyko R">RH Boyko</name>
</author>
<author><name sortKey="Castelhano, M" uniqKey="Castelhano M">M Castelhano</name>
</author>
<author><name sortKey="Corey, E" uniqKey="Corey E">E Corey</name>
</author>
<author><name sortKey="Hayward, Jj" uniqKey="Hayward J">JJ Hayward</name>
</author>
<author><name sortKey="Mclean, C" uniqKey="Mclean C">C McLean</name>
</author>
<author><name sortKey="White, Me" uniqKey="White M">ME White</name>
</author>
<author><name sortKey="Abi Said, M" uniqKey="Abi Said M">M Abi Said</name>
</author>
<author><name sortKey="Anita, Ba" uniqKey="Anita B">BA Anita</name>
</author>
<author><name sortKey="Bondjengo, Ni" uniqKey="Bondjengo N">NI Bondjengo</name>
</author>
<author><name sortKey="Calero, J" uniqKey="Calero J">J Calero</name>
</author>
<author><name sortKey="Galov, A" uniqKey="Galov A">A Galov</name>
</author>
<author><name sortKey="Hedimbi, M" uniqKey="Hedimbi M">M Hedimbi</name>
</author>
<author><name sortKey="Imam, B" uniqKey="Imam B">B Imam</name>
</author>
<author><name sortKey="Khalap, R" uniqKey="Khalap R">R Khalap</name>
</author>
<author><name sortKey="Lally, D" uniqKey="Lally D">D Lally</name>
</author>
<author><name sortKey="Masta, A" uniqKey="Masta A">A Masta</name>
</author>
<author><name sortKey="Oliveira, Kc" uniqKey="Oliveira K">KC Oliveira</name>
</author>
<author><name sortKey="Perez, L" uniqKey="Perez L">L Pérez</name>
</author>
<author><name sortKey="Randall, J" uniqKey="Randall J">J Randall</name>
</author>
<author><name sortKey="Tam, Nm" uniqKey="Tam N">NM Tam</name>
</author>
<author><name sortKey="Trujillo Cornejo, Fj" uniqKey="Trujillo Cornejo F">FJ Trujillo-Cornejo</name>
</author>
<author><name sortKey="Valeriano, C" uniqKey="Valeriano C">C Valeriano</name>
</author>
<author><name sortKey="Sutter, Nb" uniqKey="Sutter N">NB Sutter</name>
</author>
<author><name sortKey="Todhunter, Rj" uniqKey="Todhunter R">RJ Todhunter</name>
</author>
<author><name sortKey="Bustamante, Cd" uniqKey="Bustamante C">CD Bustamante</name>
</author>
<author><name sortKey="Boyko, Ar" uniqKey="Boyko A">AR Boyko</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Sievers, F" uniqKey="Sievers F">F Sievers</name>
</author>
<author><name sortKey="Wilm, A" uniqKey="Wilm A">A Wilm</name>
</author>
<author><name sortKey="Dineen, D" uniqKey="Dineen D">D Dineen</name>
</author>
<author><name sortKey="Gibson, Tj" uniqKey="Gibson T">TJ Gibson</name>
</author>
<author><name sortKey="Karplus, K" uniqKey="Karplus K">K Karplus</name>
</author>
<author><name sortKey="Li, W" uniqKey="Li W">W Li</name>
</author>
<author><name sortKey="Lopez, R" uniqKey="Lopez R">R Lopez</name>
</author>
<author><name sortKey="Mcwilliam, H" uniqKey="Mcwilliam H">H McWilliam</name>
</author>
<author><name sortKey="Remmert, M" uniqKey="Remmert M">M Remmert</name>
</author>
<author><name sortKey="Soding, J" uniqKey="Soding J">J Söding</name>
</author>
<author><name sortKey="Thompson, Jd" uniqKey="Thompson J">JD Thompson</name>
</author>
<author><name sortKey="Higgins, Dg" uniqKey="Higgins D">DG Higgins</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Slater, Gs" uniqKey="Slater G">GS Slater</name>
</author>
<author><name sortKey="Birney, E" uniqKey="Birney E">E Birney</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Smith, Jm" uniqKey="Smith J">JM Smith</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Spees, Jl" uniqKey="Spees J">JL Spees</name>
</author>
<author><name sortKey="Olson, Sd" uniqKey="Olson S">SD Olson</name>
</author>
<author><name sortKey="Whitney, Mj" uniqKey="Whitney M">MJ Whitney</name>
</author>
<author><name sortKey="Prockop, Dj" uniqKey="Prockop D">DJ Prockop</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Stewart, Jb" uniqKey="Stewart J">JB Stewart</name>
</author>
<author><name sortKey="Alaei Mahabadi, B" uniqKey="Alaei Mahabadi B">B Alaei-Mahabadi</name>
</author>
<author><name sortKey="Sabarinathan, R" uniqKey="Sabarinathan R">R Sabarinathan</name>
</author>
<author><name sortKey="Samuelsson, T" uniqKey="Samuelsson T">T Samuelsson</name>
</author>
<author><name sortKey="Gorodkin, J" uniqKey="Gorodkin J">J Gorodkin</name>
</author>
<author><name sortKey="Gustafsson, Cm" uniqKey="Gustafsson C">CM Gustafsson</name>
</author>
<author><name sortKey="Larsson, E" uniqKey="Larsson E">E Larsson</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Strakova, A" uniqKey="Strakova A">A Strakova</name>
</author>
<author><name sortKey="Murchison, Ep" uniqKey="Murchison E">EP Murchison</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Strakova, A" uniqKey="Strakova A">A Strakova</name>
</author>
<author><name sortKey="Murchison, Ep" uniqKey="Murchison E">EP Murchison</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Stratton, Mr" uniqKey="Stratton M">MR Stratton</name>
</author>
<author><name sortKey="Campbell, Pj" uniqKey="Campbell P">PJ Campbell</name>
</author>
<author><name sortKey="Futreal, Pa" uniqKey="Futreal P">PA Futreal</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Tamura, K" uniqKey="Tamura K">K Tamura</name>
</author>
<author><name sortKey="Stecher, G" uniqKey="Stecher G">G Stecher</name>
</author>
<author><name sortKey="Peterson, D" uniqKey="Peterson D">D Peterson</name>
</author>
<author><name sortKey="Filipski, A" uniqKey="Filipski A">A Filipski</name>
</author>
<author><name sortKey="Kumar, S" uniqKey="Kumar S">S Kumar</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Tan, As" uniqKey="Tan A">AS Tan</name>
</author>
<author><name sortKey="Baty, Jw" uniqKey="Baty J">JW Baty</name>
</author>
<author><name sortKey="Dong, Lf" uniqKey="Dong L">LF Dong</name>
</author>
<author><name sortKey="Bezawork Geleta, A" uniqKey="Bezawork Geleta A">A Bezawork-Geleta</name>
</author>
<author><name sortKey="Endaya, B" uniqKey="Endaya B">B Endaya</name>
</author>
<author><name sortKey="Goodwin, J" uniqKey="Goodwin J">J Goodwin</name>
</author>
<author><name sortKey="Bajzikova, M" uniqKey="Bajzikova M">M Bajzikova</name>
</author>
<author><name sortKey="Kovarova, J" uniqKey="Kovarova J">J Kovarova</name>
</author>
<author><name sortKey="Peterka, M" uniqKey="Peterka M">M Peterka</name>
</author>
<author><name sortKey="Yan, B" uniqKey="Yan B">B Yan</name>
</author>
<author><name sortKey="Pesdar, Ea" uniqKey="Pesdar E">EA Pesdar</name>
</author>
<author><name sortKey="Sobol, M" uniqKey="Sobol M">M Sobol</name>
</author>
<author><name sortKey="Filimonenko, A" uniqKey="Filimonenko A">A Filimonenko</name>
</author>
<author><name sortKey="Stuart, S" uniqKey="Stuart S">S Stuart</name>
</author>
<author><name sortKey="Vondrusova, M" uniqKey="Vondrusova M">M Vondrusova</name>
</author>
<author><name sortKey="Kluckova, K" uniqKey="Kluckova K">K Kluckova</name>
</author>
<author><name sortKey="Sachaphibulkij, K" uniqKey="Sachaphibulkij K">K Sachaphibulkij</name>
</author>
<author><name sortKey="Rohlena, J" uniqKey="Rohlena J">J Rohlena</name>
</author>
<author><name sortKey="Hozak, P" uniqKey="Hozak P">P Hozak</name>
</author>
<author><name sortKey="Truksa, J" uniqKey="Truksa J">J Truksa</name>
</author>
<author><name sortKey="Eccles, D" uniqKey="Eccles D">D Eccles</name>
</author>
<author><name sortKey="Haupt, Lm" uniqKey="Haupt L">LM Haupt</name>
</author>
<author><name sortKey="Griffiths, Lr" uniqKey="Griffiths L">LR Griffiths</name>
</author>
<author><name sortKey="Neuzil, J" uniqKey="Neuzil J">J Neuzil</name>
</author>
<author><name sortKey="Berridge, Mv" uniqKey="Berridge M">MV Berridge</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Thorvaldsd Ttir, H" uniqKey="Thorvaldsd Ttir H">H Thorvaldsdóttir</name>
</author>
<author><name sortKey="Robinson, Jt" uniqKey="Robinson J">JT Robinson</name>
</author>
<author><name sortKey="Mesirov, Jp" uniqKey="Mesirov J">JP Mesirov</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Thyagarajan, B" uniqKey="Thyagarajan B">B Thyagarajan</name>
</author>
<author><name sortKey="Padua, Ra" uniqKey="Padua R">RA Padua</name>
</author>
<author><name sortKey="Campbell, C" uniqKey="Campbell C">C Campbell</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ujvari, B" uniqKey="Ujvari B">B Ujvari</name>
</author>
<author><name sortKey="Dowton, M" uniqKey="Dowton M">M Dowton</name>
</author>
<author><name sortKey="Madsen, T" uniqKey="Madsen T">T Madsen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Verscheure, S" uniqKey="Verscheure S">S Verscheure</name>
</author>
<author><name sortKey="Backeljau, T" uniqKey="Backeljau T">T Backeljau</name>
</author>
<author><name sortKey="Desmyter, S" uniqKey="Desmyter S">S Desmyter</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Vila, C" uniqKey="Vila C">C Vilà</name>
</author>
<author><name sortKey="Savolainen, P" uniqKey="Savolainen P">P Savolainen</name>
</author>
<author><name sortKey="Maldonado, Je" uniqKey="Maldonado J">JE Maldonado</name>
</author>
<author><name sortKey="Amorim, Ir" uniqKey="Amorim I">IR Amorim</name>
</author>
<author><name sortKey="Rice, Je" uniqKey="Rice J">JE Rice</name>
</author>
<author><name sortKey="Honeycutt, Rl" uniqKey="Honeycutt R">RL Honeycutt</name>
</author>
<author><name sortKey="Crandall, Ka" uniqKey="Crandall K">KA Crandall</name>
</author>
<author><name sortKey="Lundeberg, J" uniqKey="Lundeberg J">J Lundeberg</name>
</author>
<author><name sortKey="Wayne, Rk" uniqKey="Wayne R">RK Wayne</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Zsurka, G" uniqKey="Zsurka G">G Zsurka</name>
</author>
<author><name sortKey="Kraytsberg, Y" uniqKey="Kraytsberg Y">Y Kraytsberg</name>
</author>
<author><name sortKey="Kudina, T" uniqKey="Kudina T">T Kudina</name>
</author>
<author><name sortKey="Kornblum, C" uniqKey="Kornblum C">C Kornblum</name>
</author>
<author><name sortKey="Elger, Ce" uniqKey="Elger C">CE Elger</name>
</author>
<author><name sortKey="Khrapko, K" uniqKey="Khrapko K">K Khrapko</name>
</author>
<author><name sortKey="Kunz, Ws" uniqKey="Kunz W">WS Kunz</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article"><pmc-dir>properties open_access</pmc-dir>
<front><journal-meta><journal-id journal-id-type="nlm-ta">eLife</journal-id>
<journal-id journal-id-type="iso-abbrev">Elife</journal-id>
<journal-id journal-id-type="hwp">eLife</journal-id>
<journal-id journal-id-type="publisher-id">eLife</journal-id>
<journal-title-group><journal-title>eLife</journal-title>
</journal-title-group>
<issn pub-type="epub">2050-084X</issn>
<publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name>
</publisher>
</journal-meta>
<article-meta><article-id pub-id-type="pmid">27185408</article-id>
<article-id pub-id-type="pmc">4869914</article-id>
<article-id pub-id-type="publisher-id">14552</article-id>
<article-id pub-id-type="doi">10.7554/eLife.14552</article-id>
<article-categories><subj-group subj-group-type="display-channel"><subject>Short Report</subject>
</subj-group>
<subj-group subj-group-type="heading"><subject>Cancer Biology</subject>
</subj-group>
<subj-group subj-group-type="heading"><subject>Genomics and Evolutionary Biology</subject>
</subj-group>
</article-categories>
<title-group><article-title>Mitochondrial genetic diversity, selection and recombination in a canine transmissible cancer</article-title>
</title-group>
<contrib-group><contrib id="author-49785" contrib-type="author"><name><surname>Strakova</surname>
<given-names>Andrea</given-names>
</name>
<xref ref-type="aff" rid="aff1">1</xref>
<xref ref-type="author-notes" rid="equal-contrib">†</xref>
<xref ref-type="fn" rid="con1"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50450" contrib-type="author"><name><surname>Ní Leathlobhair</surname>
<given-names>Máire</given-names>
</name>
<xref ref-type="aff" rid="aff1">1</xref>
<xref ref-type="author-notes" rid="equal-contrib">†</xref>
<xref ref-type="fn" rid="con2"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50451" contrib-type="author"><name><surname>Wang</surname>
<given-names>Guo-Dong</given-names>
</name>
<xref ref-type="aff" rid="aff2">2</xref>
<xref ref-type="fn" rid="con3"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50452" contrib-type="author"><name><surname>Yin</surname>
<given-names>Ting-Ting</given-names>
</name>
<xref ref-type="aff" rid="aff2">2</xref>
<xref ref-type="fn" rid="con4"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50453" contrib-type="author"><name><surname>Airikkala-Otter</surname>
<given-names>Ilona</given-names>
</name>
<xref ref-type="aff" rid="aff3">3</xref>
<xref ref-type="fn" rid="con5"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50454" contrib-type="author"><name><surname>Allen</surname>
<given-names>Janice L</given-names>
</name>
<xref ref-type="aff" rid="aff4">4</xref>
<xref ref-type="fn" rid="con6"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50455" contrib-type="author"><name><surname>Allum</surname>
<given-names>Karen M</given-names>
</name>
<xref ref-type="aff" rid="aff5">5</xref>
<xref ref-type="fn" rid="con7"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50456" contrib-type="author"><name><surname>Bansse-Issa</surname>
<given-names>Leontine</given-names>
</name>
<xref ref-type="aff" rid="aff6">6</xref>
<xref ref-type="fn" rid="con8"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50457" contrib-type="author"><name><surname>Bisson</surname>
<given-names>Jocelyn L</given-names>
</name>
<xref ref-type="aff" rid="aff1">1</xref>
<xref ref-type="fn" rid="con9"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50458" contrib-type="author"><name><surname>Castillo Domracheva</surname>
<given-names>Artemio</given-names>
</name>
<xref ref-type="aff" rid="aff7">7</xref>
<xref ref-type="fn" rid="con10"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50459" contrib-type="author"><name><surname>de Castro</surname>
<given-names>Karina F</given-names>
</name>
<xref ref-type="aff" rid="aff8">8</xref>
<xref ref-type="fn" rid="con11"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50460" contrib-type="author"><name><surname>Corrigan</surname>
<given-names>Anne M</given-names>
</name>
<xref ref-type="aff" rid="aff9">9</xref>
<xref ref-type="fn" rid="con12"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50461" contrib-type="author"><name><surname>Cran</surname>
<given-names>Hugh R</given-names>
</name>
<xref ref-type="aff" rid="aff10">10</xref>
<xref ref-type="fn" rid="con13"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50462" contrib-type="author"><name><surname>Crawford</surname>
<given-names>Jane T</given-names>
</name>
<xref ref-type="aff" rid="aff11">11</xref>
<xref ref-type="fn" rid="con14"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50463" contrib-type="author"><name><surname>Cutter</surname>
<given-names>Stephen M</given-names>
</name>
<xref ref-type="aff" rid="aff4">4</xref>
<xref ref-type="fn" rid="con15"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50464" contrib-type="author"><name><surname>Delgadillo Keenan</surname>
<given-names>Laura</given-names>
</name>
<xref ref-type="aff" rid="aff12">12</xref>
<xref ref-type="fn" rid="con16"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50465" contrib-type="author"><name><surname>Donelan</surname>
<given-names>Edward M</given-names>
</name>
<xref ref-type="aff" rid="aff4">4</xref>
<xref ref-type="fn" rid="con17"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50466" contrib-type="author"><name><surname>Faramade</surname>
<given-names>Ibikunle A</given-names>
</name>
<xref ref-type="aff" rid="aff13">13</xref>
<xref ref-type="fn" rid="con18"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50467" contrib-type="author"><name><surname>Flores Reynoso</surname>
<given-names>Erika</given-names>
</name>
<xref ref-type="aff" rid="aff14">14</xref>
<xref ref-type="fn" rid="con19"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50468" contrib-type="author"><name><surname>Fotopoulou</surname>
<given-names>Eleni</given-names>
</name>
<xref ref-type="aff" rid="aff15">15</xref>
<xref ref-type="fn" rid="con20"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50469" contrib-type="author"><name><surname>Fruean</surname>
<given-names>Skye N</given-names>
</name>
<xref ref-type="aff" rid="aff16">16</xref>
<xref ref-type="fn" rid="con21"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50470" contrib-type="author"><name><surname>Gallardo-Arrieta</surname>
<given-names>Fanny</given-names>
</name>
<xref ref-type="aff" rid="aff17">17</xref>
<xref ref-type="fn" rid="con22"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50471" contrib-type="author"><name><surname>Glebova</surname>
<given-names>Olga</given-names>
</name>
<xref ref-type="aff" rid="aff18">18</xref>
<xref ref-type="fn" rid="con23"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50472" contrib-type="author"><name><surname>Häfelin Manrique</surname>
<given-names>Rodrigo F</given-names>
</name>
<xref ref-type="aff" rid="aff19">19</xref>
<xref ref-type="fn" rid="con24"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50473" contrib-type="author"><name><surname>Henriques</surname>
<given-names>Joaquim JGP</given-names>
</name>
<xref ref-type="aff" rid="aff20">20</xref>
<xref ref-type="fn" rid="con25"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50474" contrib-type="author"><name><surname>Ignatenko</surname>
<given-names>Natalia</given-names>
</name>
<xref ref-type="aff" rid="aff21">21</xref>
<xref ref-type="fn" rid="con26"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50475" contrib-type="author"><name><surname>Koenig</surname>
<given-names>Debbie</given-names>
</name>
<xref ref-type="aff" rid="aff5">5</xref>
<xref ref-type="fn" rid="con27"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50476" contrib-type="author"><name><surname>Lanza-Perea</surname>
<given-names>Marta</given-names>
</name>
<xref ref-type="aff" rid="aff9">9</xref>
<xref ref-type="fn" rid="con28"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50477" contrib-type="author"><name><surname>Lobetti</surname>
<given-names>Remo</given-names>
</name>
<xref ref-type="aff" rid="aff22">22</xref>
<xref ref-type="fn" rid="con29"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50478" contrib-type="author"><name><surname>Lopez Quintana</surname>
<given-names>Adriana M</given-names>
</name>
<xref ref-type="aff" rid="aff23">23</xref>
<xref ref-type="fn" rid="con30"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50479" contrib-type="author"><name><surname>Losfelt</surname>
<given-names>Thibault</given-names>
</name>
<xref ref-type="aff" rid="aff24">24</xref>
<xref ref-type="fn" rid="con31"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50480" contrib-type="author"><name><surname>Marino</surname>
<given-names>Gabriele</given-names>
</name>
<xref ref-type="aff" rid="aff25">25</xref>
<xref ref-type="fn" rid="con32"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-12820" contrib-type="author"><name><surname>Martincorena</surname>
<given-names>Inigo</given-names>
</name>
<xref ref-type="aff" rid="aff26">26</xref>
<xref ref-type="fn" rid="con33"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50481" contrib-type="author"><name><surname>Martínez Castañeda</surname>
<given-names>Simón</given-names>
</name>
<xref ref-type="aff" rid="aff27">27</xref>
<xref ref-type="fn" rid="con34"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50482" contrib-type="author"><name><surname>Martínez-López</surname>
<given-names>Mayra F</given-names>
</name>
<xref ref-type="aff" rid="aff28">28</xref>
<xref ref-type="fn" rid="con35"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50483" contrib-type="author"><name><surname>Meyer</surname>
<given-names>Michael</given-names>
</name>
<xref ref-type="aff" rid="aff29">29</xref>
<xref ref-type="fn" rid="con36"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50484" contrib-type="author"><name><surname>Nakanwagi</surname>
<given-names>Berna</given-names>
</name>
<xref ref-type="aff" rid="aff30">30</xref>
<xref ref-type="fn" rid="con37"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50485" contrib-type="author"><name><surname>De Nardi</surname>
<given-names>Andrigo B</given-names>
</name>
<xref ref-type="aff" rid="aff8">8</xref>
<xref ref-type="fn" rid="con38"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50486" contrib-type="author"><name><surname>Neunzig</surname>
<given-names>Winifred</given-names>
</name>
<xref ref-type="aff" rid="aff5">5</xref>
<xref ref-type="fn" rid="con39"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50487" contrib-type="author"><name><surname>Nixon</surname>
<given-names>Sally J</given-names>
</name>
<xref ref-type="aff" rid="aff31">31</xref>
<xref ref-type="fn" rid="con40"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50488" contrib-type="author"><name><surname>Onsare</surname>
<given-names>Marsden M</given-names>
</name>
<xref ref-type="aff" rid="aff32">32</xref>
<xref ref-type="fn" rid="con41"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50489" contrib-type="author"><name><surname>Ortega-Pacheco</surname>
<given-names>Antonio</given-names>
</name>
<xref ref-type="aff" rid="aff33">33</xref>
<xref ref-type="fn" rid="con42"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50490" contrib-type="author"><name><surname>Peleteiro</surname>
<given-names>Maria C</given-names>
</name>
<xref ref-type="aff" rid="aff34">34</xref>
<xref ref-type="fn" rid="con43"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50491" contrib-type="author"><name><surname>Pye</surname>
<given-names>Ruth J</given-names>
</name>
<xref ref-type="aff" rid="aff31">31</xref>
<xref ref-type="fn" rid="con44"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50492" contrib-type="author"><name><surname>Reece</surname>
<given-names>John F</given-names>
</name>
<xref ref-type="aff" rid="aff35">35</xref>
<xref ref-type="fn" rid="con45"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50493" contrib-type="author"><name><surname>Rojas Gutierrez</surname>
<given-names>Jose</given-names>
</name>
<xref ref-type="aff" rid="aff36">36</xref>
<xref ref-type="fn" rid="con46"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50494" contrib-type="author"><name><surname>Sadia</surname>
<given-names>Haleema</given-names>
</name>
<xref ref-type="aff" rid="aff37">37</xref>
<xref ref-type="fn" rid="con47"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50495" contrib-type="author"><name><surname>Schmeling</surname>
<given-names>Sheila K</given-names>
</name>
<xref ref-type="aff" rid="aff38">38</xref>
<xref ref-type="fn" rid="con48"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50496" contrib-type="author"><name><surname>Shamanova</surname>
<given-names>Olga</given-names>
</name>
<xref ref-type="aff" rid="aff39">39</xref>
<xref ref-type="fn" rid="con49"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50497" contrib-type="author"><name><surname>Ssuna</surname>
<given-names>Richard K</given-names>
</name>
<xref ref-type="aff" rid="aff40">40</xref>
<xref ref-type="fn" rid="con50"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50498" contrib-type="author"><name><surname>Steenland-Smit</surname>
<given-names>Audrey E</given-names>
</name>
<xref ref-type="aff" rid="aff6">6</xref>
<xref ref-type="fn" rid="con51"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50499" contrib-type="author"><name><surname>Svitich</surname>
<given-names>Alla</given-names>
</name>
<xref ref-type="aff" rid="aff41">41</xref>
<xref ref-type="fn" rid="con52"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50500" contrib-type="author"><name><surname>Thoya Ngoka</surname>
<given-names>Ismail</given-names>
</name>
<xref ref-type="aff" rid="aff42">42</xref>
<xref ref-type="fn" rid="con53"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50501" contrib-type="author"><name><surname>Vițălaru</surname>
<given-names>Bogdan A</given-names>
</name>
<xref ref-type="aff" rid="aff43">43</xref>
<xref ref-type="fn" rid="con54"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50502" contrib-type="author"><name><surname>de Vos</surname>
<given-names>Anna P</given-names>
</name>
<xref ref-type="aff" rid="aff44">44</xref>
<xref ref-type="fn" rid="con55"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50503" contrib-type="author"><name><surname>de Vos</surname>
<given-names>Johan P</given-names>
</name>
<xref ref-type="aff" rid="aff45">45</xref>
<xref ref-type="fn" rid="con56"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50504" contrib-type="author"><name><surname>Walkinton</surname>
<given-names>Oliver</given-names>
</name>
<xref ref-type="aff" rid="aff31">31</xref>
<xref ref-type="fn" rid="con57"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50505" contrib-type="author"><name><surname>Wedge</surname>
<given-names>David C</given-names>
</name>
<xref ref-type="aff" rid="aff26">26</xref>
<xref ref-type="fn" rid="con58"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50506" contrib-type="author"><name><surname>Wehrle-Martinez</surname>
<given-names>Alvaro S</given-names>
</name>
<xref ref-type="aff" rid="aff46">46</xref>
<xref ref-type="fn" rid="con59"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50507" contrib-type="author"><name><surname>van der Wel</surname>
<given-names>Mirjam G</given-names>
</name>
<xref ref-type="aff" rid="aff47">47</xref>
<xref ref-type="fn" rid="con60"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-50508" contrib-type="author"><name><surname>Widdowson</surname>
<given-names>Sophie AE</given-names>
</name>
<xref ref-type="aff" rid="aff40">40</xref>
<xref ref-type="fn" rid="con61"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<contrib id="author-49800" contrib-type="author"><name><surname>Murchison</surname>
<given-names>Elizabeth P</given-names>
</name>
<contrib-id contrib-id-type="orcid" authenticated="false">http://orcid.org/0000-0001-7462-8907</contrib-id>
<xref ref-type="aff" rid="aff1">1</xref>
<xref ref-type="corresp" rid="cor1">*</xref>
<xref ref-type="other" rid="par-1"></xref>
<xref ref-type="other" rid="par-2"></xref>
<xref ref-type="other" rid="par-3"></xref>
<xref ref-type="fn" rid="con62"></xref>
<xref ref-type="fn" rid="conf1"></xref>
</contrib>
<aff id="aff1"><label>1</label>
<institution content-type="dept">Department of Veterinary Medicine</institution>
,<institution>University of Cambridge</institution>
,<addr-line>Cambridge</addr-line>
,<country>United Kingdom</country>
</aff>
<aff id="aff2"><label>2</label>
<institution content-type="dept">State Key Laboratory of Genetic Resources and Evolution, Yunnan Laboratory of Molecular Biology of Domestic Animals, Kunming Institute of Zoology</institution>
,<institution>Chinese Academy of Sciences</institution>
,<addr-line>Kunming</addr-line>
,<country>China</country>
</aff>
<aff id="aff3"><label>3</label>
<institution content-type="dept">International Training Center</institution>
,<institution>Worldwide Veterinary Service</institution>
,<addr-line>Aruvankadu</addr-line>
,<country>India</country>
</aff>
<aff id="aff4"><label>4</label>
<institution>Animal Management in Rural and Remote Indigenous Communities</institution>
,<addr-line>Darwin</addr-line>
,<country>Australia</country>
</aff>
<aff id="aff5"><label>5</label>
<institution>World Vets</institution>
,<addr-line>Fargo</addr-line>
,<country>United States</country>
</aff>
<aff id="aff6"><label>6</label>
<institution>Stichting Dierenbescherming Suriname</institution>
,<addr-line>Paramaribo</addr-line>
,<country>Suriname</country>
</aff>
<aff id="aff7"><label>7</label>
<institution content-type="dept">Corozal Veterinary Hospital</institution>
,<institution>University of Panama</institution>
,<addr-line>Panama City</addr-line>
,<country>Panama</country>
</aff>
<aff id="aff8"><label>8</label>
<institution content-type="dept">Department of Clinical and Veterinary Surgery</institution>
,<institution>São Paulo State University</institution>
,<addr-line>São Paulo</addr-line>
,<country>Brazil</country>
</aff>
<aff id="aff9"><label>9</label>
<institution>St. George's University</institution>
,<addr-line>True Blue</addr-line>
,<country>Grenada</country>
</aff>
<aff id="aff10"><label>10</label>
<institution>The Nakuru District Veterinary Scheme Ltd</institution>
,<addr-line>Nakuru</addr-line>
,<country>Kenya</country>
</aff>
<aff id="aff11"><label>11</label>
<institution>Animal Medical Centre</institution>
,<addr-line>Belize City</addr-line>
,<country>Belize</country>
</aff>
<aff id="aff12"><label>12</label>
<institution>Veterinary clinic Sr. Dog's</institution>
,<addr-line>Guadalajara</addr-line>
,<country>Mexico</country>
</aff>
<aff id="aff13"><label>13</label>
<institution>National Veterinary Research Institute</institution>
,<addr-line>Vom</addr-line>
,<country>Nigeria</country>
</aff>
<aff id="aff14"><label>14</label>
<institution>International Fund for Animal Welfare</institution>
,<addr-line>Quintana Roo</addr-line>
,<country>Mexico</country>
</aff>
<aff id="aff15"><label>15</label>
<institution>Intermunicipal Stray Animals Care Centre</institution>
,<addr-line>Perama</addr-line>
,<country>Greece</country>
</aff>
<aff id="aff16"><label>16</label>
<institution>Animal Protection Society of Samoa</institution>
,<addr-line>Apia</addr-line>
,<country>Samoa</country>
</aff>
<aff id="aff17"><label>17</label>
<institution content-type="dept">Faculty of Veterinary Science</institution>
,<institution>University of Zulia</institution>
,<addr-line>Maracaibo</addr-line>
,<country>Venezuela</country>
</aff>
<aff id="aff18"><label>18</label>
<institution>Veterinary clinic BIOCONTROL</institution>
,<addr-line>Moscow</addr-line>
,<country>Russia</country>
</aff>
<aff id="aff19"><label>19</label>
<institution>Veterinary clinic El Roble</institution>
,<addr-line>Santiago de Chile</addr-line>
,<country>Chile</country>
</aff>
<aff id="aff20"><label>20</label>
<institution content-type="dept">OnevetGroup</institution>
,<institution>Centro Veterinário Berna</institution>
,<addr-line>Lisboa</addr-line>
,<country>Portugal</country>
</aff>
<aff id="aff21"><label>21</label>
<institution>Veterinary clinic Zoovetservis</institution>
,<addr-line>Kiev</addr-line>
,<country>Ukraine</country>
</aff>
<aff id="aff22"><label>22</label>
<institution>Bryanston Veterinary Hospital</institution>
,<addr-line>Bryanston</addr-line>
,<country>South Africa</country>
</aff>
<aff id="aff23"><label>23</label>
<institution>Veterinary Clinic Lopez Quintana</institution>
,<addr-line>Maldonado</addr-line>
,<country>Uruguay</country>
</aff>
<aff id="aff24"><label>24</label>
<institution>Clinique Veterinaire de Grand Fond</institution>
,<addr-line>Saint Gilles les Bains</addr-line>
,<country>France</country>
</aff>
<aff id="aff25"><label>25</label>
<institution content-type="dept">Department of Veterinary Sciences</institution>
,<institution>University of Messina</institution>
,<addr-line>Messina</addr-line>
,<country>Italy</country>
</aff>
<aff id="aff26"><label>26</label>
<institution>Wellcome Trust Sanger Institute</institution>
,<addr-line>Hinxton</addr-line>
,<country>United Kingdom</country>
</aff>
<aff id="aff27"><label>27</label>
<institution content-type="dept">Facultad de Medicina Veterinaria y Zootecnia</institution>
,<institution>Universidad Autónoma del Estado de México</institution>
,<addr-line>Toluca</addr-line>
,<country>Mexico</country>
</aff>
<aff id="aff28"><label>28</label>
<institution content-type="dept">School of Veterinary Medicine</institution>
,<institution>Universidad de las Américas</institution>
,<addr-line>Quito</addr-line>
,<country>Ecuador</country>
</aff>
<aff id="aff29"><label>29</label>
<institution>Touray & Meyer Vet Clinic</institution>
,<addr-line>Serrekunda</addr-line>
,<country>Gambia</country>
</aff>
<aff id="aff30"><label>30</label>
<institution>The Kampala Veterinary Surgery</institution>
,<addr-line>Kampala</addr-line>
,<country>Uganda</country>
</aff>
<aff id="aff31"><label>31</label>
<institution>Vets Beyond Borders</institution>
,<addr-line>The Rocks</addr-line>
,<country>Australia</country>
</aff>
<aff id="aff32"><label>32</label>
<institution>Aniworld veterinary clinic</institution>
,<addr-line>Kisumu</addr-line>
,<country>Kenya</country>
</aff>
<aff id="aff33"><label>33</label>
<institution content-type="dept">Faculty of Veterinary Medicine</institution>
,<institution>Autonomous University of Yucatan</institution>
,<addr-line>Merida</addr-line>
,<country>Mexico</country>
</aff>
<aff id="aff34"><label>34</label>
<institution content-type="dept">Interdisciplinary Centre of Research in Animal Health, Faculty of Veterinary Medicine</institution>
,<institution>University of Lisbon</institution>
,<addr-line>Lisboa</addr-line>
,<country>Portugal</country>
</aff>
<aff id="aff35"><label>35</label>
<institution>Help in Suffering</institution>
,<addr-line>Jaipur</addr-line>
,<country>India</country>
</aff>
<aff id="aff36"><label>36</label>
<institution>Veterinary clinic Dr José Rojas</institution>
,<addr-line>Los Andes</addr-line>
,<country>Chile</country>
</aff>
<aff id="aff37"><label>37</label>
<institution>University of Veterinary and Animal Sciences</institution>
,<addr-line>Lahore</addr-line>
,<country>Pakistan</country>
</aff>
<aff id="aff38"><label>38</label>
<institution>Corozal Veterinary Clinic</institution>
,<addr-line>Corozal Town</addr-line>
,<country>Belize</country>
</aff>
<aff id="aff39"><label>39</label>
<institution>Veterinary clinic Vetmaster</institution>
,<addr-line>Ramenskoye</addr-line>
,<country>Russia</country>
</aff>
<aff id="aff40"><label>40</label>
<institution>Lilongwe Society for Protection and Care of Animals</institution>
,<addr-line>Lilongwe</addr-line>
,<country>Malawi</country>
</aff>
<aff id="aff41"><label>41</label>
<institution>State Hospital of Veterinary Medicine</institution>
,<addr-line>Dniprodzerzhynsk</addr-line>
,<country>Ukraine</country>
</aff>
<aff id="aff42"><label>42</label>
<institution>Kenya Society for Protection and Care of Animals</institution>
,<addr-line>Nairobi</addr-line>
,<country>Kenya</country>
</aff>
<aff id="aff43"><label>43</label>
<institution content-type="dept">Clinical Sciences Department</institution>
,<institution>Faculty of Veterinary Medicine</institution>
,<addr-line>Bucharest</addr-line>
,<country>Romania</country>
</aff>
<aff id="aff44"><label>44</label>
<institution>Ladybrand Animal Clinic</institution>
,<addr-line>Ladybrand</addr-line>
,<country>South Africa</country>
</aff>
<aff id="aff45"><label>45</label>
<institution>Veterinary Oncology Referral Centre De Ottenhorst</institution>
,<addr-line>Terneuzen</addr-line>
,<country>Netherlands</country>
</aff>
<aff id="aff46"><label>46</label>
<institution content-type="dept">Faculty of Veterinary Sciences</institution>
,<institution>National University of Asuncion</institution>
,<addr-line>San Lorenzo</addr-line>
,<country>Paraguay</country>
</aff>
<aff id="aff47"><label>47</label>
<institution>Animal Anti Cruelty League</institution>
,<addr-line>Port Elizabeth</addr-line>
,<country>South Africa</country>
</aff>
</contrib-group>
<contrib-group><contrib contrib-type="editor"><name><surname>Ostrander</surname>
<given-names>Elaine</given-names>
</name>
<role>Reviewing editor</role>
<aff id="aff48"><institution>National Human Genome Research Institute, National Institutes of Health</institution>
,<country>United States</country>
</aff>
</contrib>
</contrib-group>
<author-notes><corresp id="cor1"><email>epm27@cam.ac.uk</email>
</corresp>
<fn fn-type="con" id="equal-contrib"><label>†</label>
<p>These authors contributed equally to this work.</p>
</fn>
</author-notes>
<pub-date date-type="pub" publication-format="electronic"><day>17</day>
<month>5</month>
<year>2016</year>
</pub-date>
<pub-date pub-type="collection"><year>2016</year>
</pub-date>
<volume>5</volume>
<elocation-id>e14552</elocation-id>
<history><date date-type="received"><day>19</day>
<month>1</month>
<year>2016</year>
</date>
<date date-type="accepted"><day>08</day>
<month>4</month>
<year>2016</year>
</date>
</history>
<permissions><copyright-statement>© 2016, Strakova et al</copyright-statement>
<copyright-year>2016</copyright-year>
<copyright-holder>Strakova et al</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/"><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>
, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p>
</license>
</permissions>
<self-uri content-type="pdf" xlink:href="elife-14552.pdf"></self-uri>
<abstract><p>Canine transmissible venereal tumour (CTVT) is a clonally transmissible cancer that originated approximately 11,000 years ago and affects dogs worldwide. Despite the clonal origin of the CTVT nuclear genome, CTVT mitochondrial genomes (mtDNAs) have been acquired by periodic capture from transient hosts. We sequenced 449 complete mtDNAs from a global population of CTVTs, and show that mtDNA horizontal transfer has occurred at least five times, delineating five tumour clades whose distributions track two millennia of dog global migration. Negative selection has operated to prevent accumulation of deleterious mutations in captured mtDNA, and recombination has caused occasional mtDNA re-assortment. These findings implicate functional mtDNA as a driver of CTVT global metastatic spread, further highlighting the important role of mtDNA in cancer evolution.</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.001">http://dx.doi.org/10.7554/eLife.14552.001</ext-link>
</p>
</abstract>
<abstract abstract-type="executive-summary"><title>eLife digest</title>
<p>A unique cancer called canine transmissible venereal tumour (CTVT) causes ugly tumours to form on the genitals of dogs. Unlike most other cancers, CTVT is contagious: the cancer cells can be directly transferred from one dog to another when they mate. The disease originated from the cancer cells of one individual dog that lived approximately 11,000 years ago. CTVT now affects dogs all over the world, which makes it the oldest and most widespread cancer known in nature.</p>
<p>Like healthy cells, cancer cells contain compartments known as mitochondria that produce the chemical energy needed to power vital processes. Inside the mitochondria, there is some DNA that encodes the proteins that mitochondria need to perform this role. Changes (or mutations) to this mitochondrial DNA (mtDNA) may stop the mitochondria from working properly. CTVT cells have previously been found to occasionally capture mtDNA from normal dog cells, which suggests that replenishing their mtDNA may help promote CTVT cell growth. Furthermore, these captured mtDNAs act as genetic "flags" that can help trace the spread of the disease.</p>
<p>Here, Strakova, Ní Leathlobhair et al. analysed the mtDNA in CTVT tumours collected from over 400 dogs in 39 countries. The analysis shows that CTVT cells have captured mtDNA from normal dog cells on at least five occasions. Over the last 2,000 years, the disease appears to have spread rapidly around the world, perhaps transported by dogs travelling on ships along historic trade routes. CTVT may have only reached the Americas within the last 500 years, possibly carried there by dogs brought by Europeans. Likewise, CTVT probably only came to Australia after European contact.</p>
<p>The experiments also revealed that the most damaging types of mutations were absent from the mtDNA of CTVT, which suggests that fully functioning mitochondria play an important role in CTVT. Unexpectedly, Strakova, Ní Leathlobhair et al. found evidence that certain sections of mtDNA in some CTVT cells have been exchanged, or shuffled, with the mtDNA captured from normal dog cells. This type of “recombination” is not usually thought to occur in mtDNA, and has not previously been detected in cancer. Future studies will determine if this process is widespread in other types of cancer, including in humans.</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.002">http://dx.doi.org/10.7554/eLife.14552.002</ext-link>
</p>
</abstract>
<kwd-group kwd-group-type="author-keywords"><title>Author Keywords</title>
<kwd>Dog</kwd>
<kwd>transmissible cancer</kwd>
<kwd>canine transmissible venereal tumour</kwd>
<kwd>mitochondria</kwd>
</kwd-group>
<kwd-group kwd-group-type="research-organism"><title>Research Organism</title>
<kwd>Other</kwd>
</kwd-group>
<funding-group><award-group id="par-1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100004440</institution-id>
<institution>Wellcome Trust</institution>
</institution-wrap>
</funding-source>
<award-id>Investigator Award, 102942/Z/13/A</award-id>
<principal-award-recipient><name><surname>Murchison</surname>
<given-names>Elizabeth P</given-names>
</name>
</principal-award-recipient>
</award-group>
<award-group id="par-2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100000275</institution-id>
<institution>Leverhulme Trust</institution>
</institution-wrap>
</funding-source>
<award-id>Philip Leverhulme Prize</award-id>
<principal-award-recipient><name><surname>Murchison</surname>
<given-names>Elizabeth P</given-names>
</name>
</principal-award-recipient>
</award-group>
<award-group id="par-3"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100000288</institution-id>
<institution>Royal Society</institution>
</institution-wrap>
</funding-source>
<award-id>Research Grant, RG130615</award-id>
<principal-award-recipient><name><surname>Murchison</surname>
<given-names>Elizabeth P</given-names>
</name>
</principal-award-recipient>
</award-group>
<funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement>
</funding-group>
<custom-meta-group><custom-meta><meta-name>elife-xml-version</meta-name>
<meta-value>2.5</meta-value>
</custom-meta>
<custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name>
<meta-value>Genetics of a canine transmissible tumour show how the world’s oldest cancer “metastasised” through the global dog population – and captured, maintained and rearranged its mitochondrial DNA along the way.</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body><sec sec-type="intro" id="s1"><title>Introduction</title>
<p>The canine transmissible venereal tumour (CTVT) is a transmissible cancer that is contagious between dogs via the transfer of living cancer cells during coitus. The disease usually manifests as localised tumours involving the genital mucosa in both male and female domestic dogs. CTVT first arose from the somatic cells of an individual dog that lived approximately 11,000 years ago; it subsequently survived beyond the death of this original animal by metastasising to new hosts (<xref rid="bib31" ref-type="bibr">Murgia et al., 2006</xref>
; <xref rid="bib37" ref-type="bibr">Rebbeck et al., 2009</xref>
; <xref rid="bib30" ref-type="bibr">Murchison et al., 2014</xref>
; <xref rid="bib7" ref-type="bibr">Decker et al., 2015</xref>
). CTVT is found in dog populations worldwide, and is the oldest and most prolific cancer lineage known in nature (<xref rid="bib30" ref-type="bibr">Murchison et al., 2014</xref>
; <xref rid="bib47" ref-type="bibr">Strakova and Murchison, 2014</xref>
; <xref rid="bib48" ref-type="bibr">Strakova and Murchison, 2015</xref>
). The clonal evolution of CTVT renders this lineage a unique genetic tag with which to trace historical global dispersals of dogs together with their human companions. Furthermore, the extreme longevity of this lineage, its serial colonisation of genetically distinct allogeneic hosts and its occasional uptake of host mitochondrial DNA (mtDNA) by horizontal transfer (<xref rid="bib38" ref-type="bibr">Rebbeck et al., 2011</xref>
), provide opportunities to probe genetic vulnerabilities in cancer and to identify novel host-tumour interactions. We analysed 449 complete mtDNAs in CTVT and used these to investigate the frequency and timing of mtDNA horizontal transfer in this lineage; furthermore, we assessed the contribution of selection to CTVT mtDNA evolution and searched for evidence of mtDNA recombination.</p>
</sec>
<sec id="s2"><title>Results and discussion</title>
<p>To investigate the global CTVT population structure and estimate the frequency and timing of mtDNA horizontal transfer, we performed low-coverage whole genome sequencing (~0.3X whole genome coverage) on 449 CTVT tumours and 338 matched hosts collected from 39 countries across six continents (Materials and methods) (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>
, <xref ref-type="supplementary-material" rid="SD4-data">Supplementary file 1</xref>
). MtDNA was sequenced at ~70X coverage, indicating that each CTVT cell carries approximately 470 mtDNA copies (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2</xref>
, <xref ref-type="supplementary-material" rid="SD5-data">Supplementary file 2</xref>
, Materials and methods). CTVT was confirmed by identification of a characteristic rearrangement involving a long interspersed nuclear element (LINE) near the <italic>MYC</italic>
locus (<xref rid="bib17" ref-type="bibr">Katzir et al., 1985</xref>
; <xref rid="bib18" ref-type="bibr">1987</xref>
) (<xref ref-type="supplementary-material" rid="SD6-data">Supplementary file 3</xref>
).</p>
<p>We identified 1005 single point substitution variants and 27 short insertions and deletions (indels) in the CTVT mtDNA population (<xref ref-type="supplementary-material" rid="SD7-data">Supplementary files 4</xref>
, <xref ref-type="supplementary-material" rid="SD8-data">5</xref>
, <xref ref-type="supplementary-material" rid="SD9-data">6</xref>
, <xref ref-type="supplementary-material" rid="SD10-data">7</xref>
, <xref ref-type="supplementary-material" rid="SD15-data">12</xref>
, <xref ref-type="supplementary-material" rid="SD16-data">13</xref>
). CTVT mtDNA somatic substitution mutations (see Materials and methods) had the characteristic profile that is observed in human cancers, dominated by C>T and T>C mutations showing a striking strand bias (<xref rid="bib15" ref-type="bibr">Ju et al., 2014</xref>
) (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>
). This mutational process is probably replication-coupled, and mutations associated with this process appear to accumulate at a roughly constant rate in human cancers (<xref rid="bib15" ref-type="bibr">Ju et al., 2014</xref>
). A maximum likelihood phylogenetic tree constructed with mtDNA sequences from CTVT, matched hosts and 252 additional dogs (see <xref ref-type="supplementary-material" rid="SD11-data">Supplementary file 8</xref>
) revealed that CTVT mtDNAs cluster in five distinct groups within dog mtDNA haplogroup A1 (<xref ref-type="fig" rid="fig1">Figure 1A</xref>
, <xref ref-type="fig" rid="fig1s3">Figure 1—figure supplement 3</xref>
, <xref ref-type="supplementary-material" rid="SD1-data">Figure 1—source data 1</xref>
). These data suggest that CTVT mtDNAs have at least five independent origins, demarcating five groups that we have named CTVT clades 1 to 5.<fig id="fig1" position="float" orientation="portrait"><object-id pub-id-type="doi">10.7554/eLife.14552.003</object-id>
<label>Figure 1.</label>
<caption><title>CTVT has acquired mtDNA by horizontal transfer at least five times.</title>
<p>(<bold>A</bold>
) Maximum likelihood phylogenetic tree constructed with complete mtDNA sequences from 449 CTVT tumours and 590 dogs. Coloured and black dots represent CTVT and dog mtDNA respectively. Scale bar indicates base substitutions per site. (<bold>B</bold>
) Number of somatic substitution mutations per CTVT tumour. Coloured bars indicate somatic mutations acquired by each tumour since mtDNA capture. Grey bars indicate substitutions absent from normal dog mtDNA haplotypes but common to all tumours within a clade; thus the early somatic or rare germline status of these variants is unknown. (<bold>C</bold>
) Geographical distribution of clades. Coloured dots represent locations from which one or more CTVT tumours were collected. (<bold>D</bold>
) Simplified representation of maximum likelihood phylogenetic trees for each clade. Trees illustrate nodes with bootstrap support >60, and shaded triangles represent coalescence of individual branches within each group. Two tumours were collected in the United States and the Netherlands respectively from dogs imported from Guatemala and Romania. Discontinuous grey lines represent contributions of substitutions absent from normal dog mtDNA haplotypes but common to all tumours within a clade. Assuming a constant accumulation of mutations within and between clades, approximate number of somatic mutations and estimated timing is shown. Maximum likelihood trees upon which these representations are based are found in <xref ref-type="supplementary-material" rid="SD2-data">Figure 1—source data 2</xref>
.</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.003">http://dx.doi.org/10.7554/eLife.14552.003</ext-link>
</p>
<p><supplementary-material content-type="local-data" id="SD1-data"><object-id pub-id-type="doi">10.7554/eLife.14552.004</object-id>
<label>Figure 1—source data 1.</label>
<caption><title>Maximum likelihood phylogenetic tree of CTVT mtDNA.</title>
<p>Maximum likelihood phylogenetic tree constructed using 449 complete CTVT mitochondrial genomes and 590 complete dog mitochondrial genomes. All sequences are labelled with sample identifier, country, breed and haplotype name. The sample identifier for CTVT hosts is the sample name (<xref ref-type="supplementary-material" rid="SD4-data">Supplementary file 1</xref>
), the sample identifier for the publicly available dogs is the accession number. Scale bar indicates base substitutions per site.</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.004">http://dx.doi.org/10.7554/eLife.14552.004</ext-link>
</p>
</caption>
<media mime-subtype="pdf" mimetype="application" xlink:href="elife-14552-fig1-data1.pdf" orientation="portrait" id="d36e1612" position="anchor"></media>
</supplementary-material>
</p>
<p><supplementary-material content-type="local-data" id="SD2-data"><object-id pub-id-type="doi">10.7554/eLife.14552.005</object-id>
<label>Figure 1—source data 2.</label>
<caption><title>Maximum likelihood phylogenetic trees for CTVT clades 1 to 5.</title>
<p>Maximum likelihood phylogenetic trees for CTVT mtDNA in (<bold>A</bold>
) clade 1 (n = 170) (<bold>B</bold>
) clade 2 (n = 252) (<bold>C</bold>
) clade 3 (n = 22) (<bold>D</bold>
) clade 4 (n = 3) and (<bold>E</bold>
) clade 5 (n = 2), rooted with haplotypes CTVT1 to CTVT5 respectively, which contain clade-defining germline and potential somatic substitutions specific to each clade (<xref ref-type="fig" rid="fig1s4">Figure 1—figure supplement 4</xref>
). Bootstrap values were calculated from 100 bootstrap replicates and are shown where bootstrap values ≥60. Scale bars indicate base substitutions per site. Clade 5 contains only two tumours, which are identical both to each other and to the CTVT5 haplotype; thus the tree for this clade was created separately and does not have a scale bar.</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.005">http://dx.doi.org/10.7554/eLife.14552.005</ext-link>
</p>
</caption>
<media mime-subtype="pdf" mimetype="application" xlink:href="elife-14552-fig1-data2.pdf" orientation="portrait" id="d36e1649" position="anchor"></media>
</supplementary-material>
</p>
</caption>
<graphic xlink:href="elife-14552-fig1"></graphic>
<p content-type="supplemental-figure"><fig id="fig1s1" specific-use="child-fig" orientation="portrait" position="anchor"><object-id pub-id-type="doi">10.7554/eLife.14552.006</object-id>
<label>Figure 1—figure supplement 1.</label>
<caption><title>Geographical locations and mtDNA clades for CTVT tumours and hosts.</title>
<p>Each dot represents the location of (<bold>A</bold>
) CTVT tumours, coloured by CTVT mtDNA clade; or (<bold>B</bold>
) CTVT hosts, coloured by dog mtDNA clade.</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.006">http://dx.doi.org/10.7554/eLife.14552.006</ext-link>
</p>
</caption>
<graphic xlink:href="elife-14552-fig1-figsupp1"></graphic>
</fig>
</p>
<p content-type="supplemental-figure"><fig id="fig1s2" specific-use="child-fig" orientation="portrait" position="anchor"><object-id pub-id-type="doi">10.7554/eLife.14552.007</object-id>
<label>Figure 1—figure supplement 2.</label>
<caption><title>mtDNA copy number in CTVT.</title>
<p>MtDNA copy number was estimated by normalising mtDNA sequence coverage to whole genome sequence coverage (<xref ref-type="supplementary-material" rid="SD5-data">Supplementary file 2A</xref>
). Each point represents an individual tumour (labelled by clade) or host. MtDNA copy number in tumours was not normalised for host contamination. Host and tumour samples with average MT coverage >300X (see <xref ref-type="supplementary-material" rid="SD5-data">Supplementary file 2A</xref>
) were excluded from the analysis and from calculation of average number of mtDNA copies per cell.</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.007">http://dx.doi.org/10.7554/eLife.14552.007</ext-link>
</p>
</caption>
<graphic xlink:href="elife-14552-fig1-figsupp2"></graphic>
</fig>
</p>
<p content-type="supplemental-figure"><fig id="fig1s3" specific-use="child-fig" orientation="portrait" position="anchor"><object-id pub-id-type="doi">10.7554/eLife.14552.008</object-id>
<label>Figure 1—figure supplement 3.</label>
<caption><title>CTVT mtDNA clades 1 to 5 all arose from dog mtDNA clade A.</title>
<p>Maximum likelihood phylogenetic tree constructed with complete mtDNA sequences from 449 CTVT tumours and 590 dogs. Coloured and black dots represent CTVT and dog mtDNA respectively (CTVT mtDNA clade colours are represented as in <xref ref-type="fig" rid="fig1">Figure 1A</xref>
). Dog mtDNA clades A to E are labelled (<xref rid="bib40" ref-type="bibr">Savolainen et al., 2002</xref>
; <xref rid="bib56" ref-type="bibr">Vila et al., 1997</xref>
). Scale bar indicates base substitutions per site.</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.008">http://dx.doi.org/10.7554/eLife.14552.008</ext-link>
</p>
</caption>
<graphic xlink:href="elife-14552-fig1-figsupp3"></graphic>
</fig>
</p>
<p content-type="supplemental-figure"><fig id="fig1s4" specific-use="child-fig" orientation="portrait" position="anchor"><object-id pub-id-type="doi">10.7554/eLife.14552.009</object-id>
<label>Figure 1—figure supplement 4.</label>
<caption><title>Reconstructed donor haplotypes for CTVT mtDNA clades 1 to 5.</title>
<p>Diagrams representing the likely donor haplotype for each of the CTVT mtDNA clades 1 to 5. The coordinates for each substitution variant position are shown, and substitutions are colour-coded either as 'germline' (i.e. they are present in all tumours within a clade and are found in the most closely related dog mtDNA haplotype, which is represented below each of the clade diagrams or they are found in the most closely related dog mtDNA haplotype only); or 'potential somatic' (i.e. they are present in all tumours within a clade but are not found in the most closely related dog mtDNA haplotype).</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.009">http://dx.doi.org/10.7554/eLife.14552.009</ext-link>
</p>
</caption>
<graphic xlink:href="elife-14552-fig1-figsupp4"></graphic>
</fig>
</p>
<p content-type="supplemental-figure"><fig id="fig1s5" specific-use="child-fig" orientation="portrait" position="anchor"><object-id pub-id-type="doi">10.7554/eLife.14552.010</object-id>
<label>Figure 1—figure supplement 5.</label>
<caption><title>Sequence contribution of nuclear-encoded mtDNA (NuMTs).</title>
<p>Sequence read depth across the MT genome for a representative CTVT tumour (146T) and host (100H1) sequenced in this study to ~0.3X whole genome average coverage. This is compared with sequence read depth for simulated reads from CanFam3.1 (excluding the MT chromosome); reads were simulated to ~0.3X whole genome average coverage.</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.010">http://dx.doi.org/10.7554/eLife.14552.010</ext-link>
</p>
</caption>
<graphic xlink:href="elife-14552-fig1-figsupp5"></graphic>
</fig>
</p>
</fig>
</p>
<p>Although CTVT originated about 11,000 years ago, whole genome sequences of two CTVT tumours derived from clades 1 and 2 indicated that these two clades shared a common ancestor approximately 460 years ago (<xref rid="bib30" ref-type="bibr">Murchison et al., 2014</xref>
). We investigated the relative time since each CTVT mtDNA horizontal transfer event by estimating the number of mtDNA somatic mutations acquired by each clade since mtDNA capture (<xref ref-type="fig" rid="fig1">Figure 1B</xref>
). This analysis revealed that clade 1 mtDNA carry more than double the number of mtDNA somatic mutations (22.5 mutations average) compared with clade 2 mtDNA (9.4 mutations average). By inferring that the clade 2 mtDNA horizontal transfer event occurred no more than 460 years ago, this analysis suggests a maximum time since mtDNA uptake of 1097 years for clade 1, 244 years for clade 3, 1690 years for clade 4 and 585 years for clade 5, assuming a constant somatic accumulation of mutations in CTVT mtDNA (Materials and methods). Importantly, two additional mutation rate estimates, derived using human data (<xref rid="bib15" ref-type="bibr">Ju et al., 2014</xref>
), suggested similar timing for CTVT clade origins (Materials and methods, <xref ref-type="supplementary-material" rid="SD12-data">Supplementary file 9</xref>
). Thus, this analysis suggests that the original mtDNA, that was present in the founder dog that first spawned CTVT, is not detectable in tumours that we have analysed, and indicates that CTVT cells have captured mtDNA from transient hosts at least five times within the last two thousand years.</p>
<p>The geographic distribution and phylogenies of the five CTVT clades reveal the dynamic recent history of the CTVT lineage (<xref ref-type="fig" rid="fig1">Figure 1C</xref>
, <xref ref-type="fig" rid="fig1">Figure 1D</xref>
, <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>
and <xref ref-type="supplementary-material" rid="SD2-data">Figure 1—source data 2</xref>
). Clades 1 and 2, which occur most frequently in the CTVT population that we analysed, both have a global distribution. Tumours that diverged early in the clade 1 lineage occur in Russia, Ukraine, China and India, suggesting an Old World origin for this clade (<xref ref-type="fig" rid="fig1">Figure 1D</xref>
). Clade 1 tumours in Central and South America share a single common ancestor that probably existed no more than 511 years ago, suggesting introduction of CTVT to the Americas with colonial contact; similarly, our data suggest a single introduction of CTVT to Australia after European arrival (maximum 116 years ago) (<xref ref-type="fig" rid="fig1">Figure 1D</xref>
, <xref ref-type="supplementary-material" rid="SD12-data">Supplementary file 9</xref>
, see Materials and methods). The distribution pattern and timing of clade 2 suggest that this clade may have been transported between continents via trans-Atlantic and Indian Ocean trade routes (<xref ref-type="fig" rid="fig1">Figure 1C and 1D</xref>
). The more recent clade 3 lineage was found in Central and South America and India, and the less frequent clades 4 and 5 occurred only in India and Nigeria respectively (<xref ref-type="fig" rid="fig1">Figure 1C and 1D</xref>
). The extensive and recent global expansion detected in the CTVT lineage is consistent with signals of widespread admixture observed in worldwide populations of domestic dogs (<xref rid="bib41" ref-type="bibr">Shannon et al., 2015</xref>
), highlighting the extent to which canine companions accompanied human travellers on their global explorations.</p>
<p>Most somatic mutations in cancer are believed to be selectively neutral, and there is little evidence in human cancers for negative selection operating to safeguard essential cellular processes (<xref rid="bib49" ref-type="bibr">Stratton et al., 2009</xref>
). We searched for evidence of mtDNA functionality in CTVT cells by examining CTVT mtDNA for signals of negative selection. If present, negative selection would be expected to operate on mtDNA to prevent homoplasmy of deleterious mutations. Consistent with this prediction, the variant allele fraction (VAF) of nonsense substitutions and frameshift indels was significantly lower than VAF for other substitutions and indels (<xref ref-type="fig" rid="fig2">Figure 2A and B</xref>
, p=0.00019 and p=3.03x10<sup>-05</sup>
respectively, two-sample Kolmogorov-Smirnov test). Furthermore, dN/dS for somatic mtDNA mutations in CTVT showed significant deviation from neutrality both for nonsense (0.187, p=1.02x10<sup>-07</sup>
) and missense (0.748, p=4.18x10<sup>-03</sup>
) mutations (<xref ref-type="fig" rid="fig2">Figure 2C</xref>
). Together with evidence of reduced VAF for truncating mtDNA mutations in human cancers (<xref rid="bib15" ref-type="bibr">Ju et al., 2014</xref>
; <xref rid="bib46" ref-type="bibr">Stewart et al., 2015</xref>
), these findings provide evidence for the activity of negative selection operating to preserve mtDNA function in CTVT and indicate that, at least in some cancers, functional mtDNA contributes to driving cancer.<fig id="fig2" position="float" orientation="portrait"><object-id pub-id-type="doi">10.7554/eLife.14552.011</object-id>
<label>Figure 2.</label>
<caption><title>Negative selection operates to prevent the accumulation of gene-disrupting mutations in CTVT.</title>
<p>Cumulative distribution functions for variant allele fraction (VAF) for gene-disrupting (<bold>A</bold>
) substitutions and (<bold>B</bold>
) indels. <italic>P</italic>
-values were calculated using two-sample Kolmogorov-Smirnov tests. (<bold>C</bold>
) dN/dS for somatic nonsense and missense substitutions. <italic>P</italic>
-values were calculated using a likelihood ratio test with parameters estimated using a Poisson model. Error bars indicate 95 percent confidence intervals.</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.011">http://dx.doi.org/10.7554/eLife.14552.011</ext-link>
</p>
</caption>
<graphic xlink:href="elife-14552-fig2"></graphic>
<p content-type="supplemental-figure"><fig id="fig2s1" specific-use="child-fig" orientation="portrait" position="anchor"><object-id pub-id-type="doi">10.7554/eLife.14552.012</object-id>
<label>Figure 2—figure supplement 1.</label>
<caption><title>CTVT mtDNA somatic mutation spectrum.</title>
<p>CTVT somatic mutations displayed by mutation type (in pyrimidine context) with 5’ and 3’ context and strand. Each of 96 mutation classes is displayed on the horizontal axis, with mutations occurring on the heavy strand displayed in red on the positive axis, and light strand mutations displayed in blue on the negative axis. The normalised substitution rate represents the (number of observed)/(number of expected) mutations, given mtDNA genome triplet content. Distinctive peaks are individually labelled. Only mutations on the 'conservative somatic list' were used (see Materials and methods and <xref ref-type="supplementary-material" rid="SD7-data">Supplementary file 4C</xref>
).</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.012">http://dx.doi.org/10.7554/eLife.14552.012</ext-link>
</p>
</caption>
<graphic xlink:href="elife-14552-fig2-figsupp1"></graphic>
</fig>
</p>
</fig>
</p>
<p>MtDNA is usually assumed to be clonally inherited and recombinationally inert. However, mtDNA recombination has been directly observed in various eukaryotes (<xref rid="bib25" ref-type="bibr">Lunt and Hyman, 1997</xref>
; <xref rid="bib12" ref-type="bibr">Hoarau et al., 2002</xref>
; <xref rid="bib20" ref-type="bibr">Ladoukakis and Zouros, 2001</xref>
; <xref rid="bib9" ref-type="bibr">Gantenbein et al., 2005</xref>
; <xref rid="bib54" ref-type="bibr">Ujvari et al., 2007</xref>
; <xref rid="bib2" ref-type="bibr">Bergthorsson et al., 2003</xref>
) and has been proposed as a mechanism for mtDNA repair (<xref rid="bib53" ref-type="bibr">Thyagarajan et al., 1996</xref>
). Recombination of maternal and paternal mtDNA haplotypes has been observed in rare cases of human biparental mtDNA inheritance (<xref rid="bib19" ref-type="bibr">Kraytsberg et al., 2004</xref>
; <xref rid="bib57" ref-type="bibr">Zsurka et al., 2005</xref>
), and mtDNA recombination activity is present in human cell extracts (<xref rid="bib53" ref-type="bibr">Thyagarajan et al., 1996</xref>
). However, mtDNA recombination has not, to our knowledge, been previously detected in cancer. Given the possibility for coexistence of two distinct mtDNA haplotypes in CTVT cells, we searched for evidence of mtDNA recombination in CTVT using recombination-detection algorithms 3seq and SiScan (<xref rid="bib3" ref-type="bibr">Boni et al., 2007</xref>
; <xref rid="bib10" ref-type="bibr">Gibbs et al., 2000</xref>
). Remarkably, these algorithms detected significant evidence for mtDNA recombination in CTVT clade 1, detecting recombination breakpoints at around MT:5430 and MT:16176. Maximum likelihood phylogenetic trees constructed using segments MT:1–5429 and MT:5430–16176 derived from clade 1 mtDNA produced distinct topologies (<xref ref-type="fig" rid="fig3">Figure 3A</xref>
, <xref ref-type="supplementary-material" rid="SD3-data">Figure 3—source data 1</xref>
). Further inspection of clade 1 mtDNA haplotypes suggested that recombination replaced MT:1–5429 in a clade 1 mtDNA haplotype that diverged from Central American clade 1 CTVTs and that subsequently colonised areas of South and Central America (Chile, Colombia, Ecuador, Panama, Paraguay) (<xref ref-type="fig" rid="fig3">Figure 3B</xref>
).<fig id="fig3" orientation="portrait" position="float"><object-id pub-id-type="doi">10.7554/eLife.14552.013</object-id>
<label>Figure 3.</label>
<caption><title>Ancient and modern mtDNA recombination in CTVT.</title>
<p>(<bold>A</bold>
) Maximum likelihood phylogenetic trees constructed using segments MT:1–5429 and MT:5430–16176 from clade 1 CTVT mtDNAs. Three clade 1 mtDNA haplotype groups are represented by coloured dog silhouettes, and their geographical distributions are colour-coded on the map. Bootstrap values were calculated from 100 iterations. Maximum likelihood trees upon which these representations are based are found in <xref ref-type="supplementary-material" rid="SD3-data">Figure 3—source data 1</xref>
. (<bold>B</bold>
) Simplified haplotype diagrams for clade 1 CTVT mtDNAs derived from groups shown in (<bold>A</bold>
). Germline variants were present in the donor mtDNA that founded clade 1, represented by the A1/A1c/A1e dog haplotype (see <xref ref-type="fig" rid="fig1s4">Figure 1—figure supplement 4</xref>
). Region putatively replaced by recombination is outlined with orange box. (<bold>C</bold>
) Recombination detected in tumour 559T (Nicaragua). The estimated per cent contribution of each recombined haplotype to the mtDNA population within 559T CTVT cells is shown, and grey arrows indicate likely sites of recombination.</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.013">http://dx.doi.org/10.7554/eLife.14552.013</ext-link>
</p>
<p><supplementary-material content-type="local-data" id="SD3-data"><object-id pub-id-type="doi">10.7554/eLife.14552.014</object-id>
<label>Figure 3—source data 1.</label>
<caption><title>Ancient mtDNA recombination in CTVT clade 1.</title>
<p>Maximum likelihood cladograms constructed using clade 1 mtDNA positions (<bold>A</bold>
) 1-5429bp and (<bold>B</bold>
) 5430-16176bp (see Materials and methods). Trees were constructed with 153 clade 1 CTVT mtDNAs rooted with the CTVT1 haplotype, which contains clade 1 clade-defining germline and potential somatic substitutions (Materials and methods, <xref ref-type="fig" rid="fig1s4">Figure 1—figure supplement 4</xref>
). Bootstrap values were calculated from 100 bootstrap replicates and are shown where bootstrap values ≥60.</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.014">http://dx.doi.org/10.7554/eLife.14552.014</ext-link>
</p>
</caption>
<media mime-subtype="zip" mimetype="application" xlink:href="elife-14552-fig3-data1.zip" orientation="portrait" id="d36e1994" position="anchor"></media>
</supplementary-material>
</p>
</caption>
<graphic xlink:href="elife-14552-fig3"></graphic>
</fig>
</p>
<p>These data provide evidence of an mtDNA recombination event in an ancestral CTVT lineage. We searched for evidence of more recent mtDNA recombination by examining outliers on CTVT mtDNA phylogenetic trees (<xref ref-type="supplementary-material" rid="SD2-data">Figure 1—source data 2</xref>
, <xref ref-type="supplementary-material" rid="SD13-data">Supplementary file 10</xref>
). This analysis identified 559T, a CTVT tumour derived from a male dog in Nicaragua (<xref ref-type="fig" rid="fig3">Figure 3C</xref>
). Further investigation of mtDNA in 559T revealed what appeared to be a CTVT clade 1 mtDNA haplotype (CTVT_1B2b1_29) superimposed upon a dog mtDNA haplotype (A1d1a_1), neither of which resembled the mtDNA haplotype found in normal tissues from this host dog, 559H (B1_1 haplotype). Phasing of mtDNA variants in 559T using long sequence reads indicated the presence of at least three distinct mtDNA haplotypes in this tumour, each representing a recombination product apparently derived from mtDNA haplotypes CTVT_1B2b1_29 and A1d1a_1 (<xref ref-type="fig" rid="fig3">Figure 3C</xref>
). These data suggest that a tumour antecedent of 559T captured haplotype A1d1a_1 mtDNA from its host. Recombination was initiated between mtDNA haplotypes CTVT_1B2b1_29 and A1d1a_1, and cells containing these recombination products were passed to host 559H. Alternatively it is possible that 559H received a mixture of both normal and CTVT cells from its CTVT donor animal, and mtDNA capture and recombination occurred within 559H. It must also be mentioned that the A1d1a_1 haplotype resembles the CTVT clade 3 donor haplotype (<xref ref-type="fig" rid="fig1s4">Figure 1—figure supplement 4</xref>
); thus we cannot exclude the possibility that the recombination that we observe in 559T involved horizontal transfer between clade 1 and clade 3 CTVT tumours that occurred within the same animal.</p>
<p>Our analysis provides evidence for occasional mtDNA recombination activity in CTVT cells. The mechanism whereby distinct mtDNA molecules are able to interact within the cell, and the nature of the signals that trigger onset of mtDNA recombination are not clear. Further analysis will determine if DNA damage signalling is involved, and it is interesting to observe that a truncating nonsense mutation in <italic>COX3</italic>
was found in some 559T haplotypes (<xref ref-type="fig" rid="fig3">Figure 3C</xref>
). Although we could not find evidence of mtDNA recombination in CTVT beyond those described, we cannot exclude the possibility that recombination is more widespread in CTVT mtDNA than detected. It is possible, therefore, that our phylogenetic, mutation rate and selection analyses (<xref ref-type="fig" rid="fig1">Figure 1</xref>
, <xref ref-type="fig" rid="fig2">2</xref>
) have been influenced by an undetected recombination signal. However, the presence in all (non-recombining) CTVT mtDNAs of a set of clade-specific markers (<xref ref-type="fig" rid="fig1s4">Figure 1—figure supplement 4</xref>
), the absence (beyond 559T) of distinctive phylogenetic outliers (<xref ref-type="supplementary-material" rid="SD2-data">Figure 1—source data 2</xref>
), the very low frequency of back-mutation (<xref ref-type="supplementary-material" rid="SD13-data">Supplementary file 10</xref>
), the strong somatic signal identified in the CTVT mtDNA mutational spectrum (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>
), and the failure of recombination-detection algorithms to detect further recombination, suggest that, if such a signal is present, it is at a low level.</p>
<p>CTVT is the world’s oldest known cancer whose metastatic spread through its global host population provides unique insights into evolutionary processes operating in cancer. Our analysis of CTVT mtDNA has illuminated five mtDNA horizontal transfer events which trace two millennia of CTVT global spread. Negative selection has operated on CTVT to maintain mtDNA integrity at the level of nonsense and missense mutations, and occasional mtDNA recombination has occurred, possibly to repair damaged mtDNA. Evidence of negative selection demonstrates that maintenance of functional mtDNA is important for the biology of CTVT; and the observation of multiple mtDNA horizontal transfer events further supports the possibility that mtDNA capture from hosts is a positively selected adaptive mechanism (<xref rid="bib38" ref-type="bibr">Rebbeck et al., 2011</xref>
; <xref rid="bib51" ref-type="bibr">Tan et al., 2015</xref>
; <xref rid="bib45" ref-type="bibr">Spees et al., 2006</xref>
). This study highlights the important role of functional mtDNA in cancer and reveals unexpected biological mechanisms that have operated in an ancient mammalian somatic cell lineage.</p>
</sec>
<sec sec-type="materials|methods" id="s3"><title>Materials and methods</title>
<sec id="s3-1"><title>Sample collection and DNA extraction</title>
<p>This study was approved by the Department of Veterinary Medicine, University of Cambridge, Ethics and Welfare Committee (reference number CR174). Tumour and host (gonad, skin, blood or liver) tissue samples were collected into RNAlater solution and stored at 4°C until processing. Genomic DNA was extracted using the Qiagen DNeasy Blood and Tissue extraction kit. Sample information is presented in <xref ref-type="supplementary-material" rid="SD4-data">Supplementary file 1</xref>
.</p>
</sec>
<sec id="s3-2"><title>Confirmation of canine transmissible venereal tumour (CTVT) diagnosis</title>
<p>Quantitative PCR (qPCR) assays were performed to confirm CTVT diagnosis (<xref ref-type="supplementary-material" rid="SD6-data">Supplementary file 3</xref>
) by detection of the CTVT-specific <italic>LINE-MYC</italic>
genomic rearrangement (<xref rid="bib31" ref-type="bibr">Murgia et al., 2006</xref>
; <xref rid="bib37" ref-type="bibr">Rebbeck et al., 2009</xref>
; <xref rid="bib30" ref-type="bibr">Murchison et al., 2014</xref>
; <xref rid="bib17" ref-type="bibr">Katzir et al., 1985</xref>
; <xref rid="bib18" ref-type="bibr">1987</xref>
). Each qPCR was performed in triplicate with SYBR Select Master Mix (Life Technologies, Carlsbad, CA) using an Applied Biosystems 7900HT Fast Real-Time PCR system instrument (Applied Biosystems, Foster City, CA) with conditions and primers specified below.</p>
<p><table-wrap id="tblu1" orientation="portrait" position="anchor"><table frame="hsides" rules="groups"><thead><tr><th colspan="2" rowspan="1">Primer</th>
<th rowspan="1" colspan="1">Sequence</th>
</tr>
</thead>
<tbody><tr><td rowspan="2" colspan="1"><italic>LINE-MYC</italic>
<break></break>
primers (obtained from [<xref rid="bib36" ref-type="bibr">Rebbeck, 2007</xref>
])</td>
<td rowspan="1" colspan="1">Forward</td>
<td rowspan="1" colspan="1">AGG GTT TCC CAT CCT TTA ACA TT</td>
</tr>
<tr><td rowspan="1" colspan="1">Reverse</td>
<td rowspan="1" colspan="1">AGA TAA GAA GCT TTT GCA CAG CAA</td>
</tr>
<tr><td rowspan="2" colspan="1"><italic>ACTB</italic>
primers</td>
<td rowspan="1" colspan="1">Forward</td>
<td rowspan="1" colspan="1">CTC CAT CAT GAA GTG TGA CGT TG</td>
</tr>
<tr><td rowspan="1" colspan="1">Reverse</td>
<td rowspan="1" colspan="1">CGA TGA TCT TGA TCT TCA TTG TGC</td>
</tr>
</tbody>
</table>
</table-wrap>
</p>
<p><table-wrap id="tblu2" orientation="portrait" position="anchor"><table frame="hsides" rules="groups"><thead><tr><th rowspan="1" colspan="1">qPCR master mix reagents</th>
<th rowspan="1" colspan="1">Volume per reaction (μl)</th>
</tr>
</thead>
<tbody><tr><td rowspan="1" colspan="1">SYBR Green Mix</td>
<td rowspan="1" colspan="1">10</td>
</tr>
<tr><td rowspan="1" colspan="1">Primers (5 μM/primer)</td>
<td rowspan="1" colspan="1">2.4</td>
</tr>
<tr><td rowspan="1" colspan="1">DNA (20 ng/μl)</td>
<td rowspan="1" colspan="1">0.5</td>
</tr>
<tr><td rowspan="1" colspan="1">Water</td>
<td rowspan="1" colspan="1">7.1</td>
</tr>
<tr><td rowspan="1" colspan="1">Total volume</td>
<td rowspan="1" colspan="1">20</td>
</tr>
</tbody>
</table>
</table-wrap>
</p>
<p><table-wrap id="tblu3" orientation="portrait" position="anchor"><table frame="hsides" rules="groups"><thead><tr><th rowspan="1" colspan="1">Stage of qPCR amplification</th>
<th rowspan="1" colspan="1">Temperature (°C)</th>
<th rowspan="1" colspan="1">Time (s)</th>
</tr>
</thead>
<tbody><tr><td rowspan="1" colspan="1">Initial denaturation</td>
<td rowspan="1" colspan="1">95</td>
<td rowspan="1" colspan="1">600</td>
</tr>
<tr><td rowspan="2" colspan="1">40 cycles</td>
<td rowspan="1" colspan="1">95</td>
<td rowspan="1" colspan="1">15</td>
</tr>
<tr><td rowspan="1" colspan="1">60</td>
<td rowspan="1" colspan="1">60</td>
</tr>
<tr><td rowspan="1" colspan="1">Final dissociation</td>
<td rowspan="1" colspan="1">95</td>
<td rowspan="1" colspan="1">15</td>
</tr>
</tbody>
</table>
</table-wrap>
</p>
<p>Standard curves were constructed for each primer set using CTVT tumour 29T1 as reference. Relative DNA input was calculated using standard curves as follows: (Ct = m(log10(iA)) + b), with each of the parameters defined as follows: Ct = threshold cycle, m = slope of the standard curve, iA = input amount, b = y-intercept of the standard curve. Relative DNA input for <italic>LINE-MYC</italic>
was then normalised to <italic>ACTB. LINE-MYC</italic>
and <italic>ACTB</italic>
are present in three and two copies respectively in 24T and 79T CTVT tumours (<xref rid="bib30" ref-type="bibr">Murchison et al., 2014</xref>
); however, it is possible that copy number at these loci differs between tumours in the current dataset.</p>
</sec>
<sec id="s3-3"><title>DNA sequencing</title>
<p>Whole genome sequencing libraries with insert size 100 to 400 base pairs (bp) were constructed using standard methods according to manufacturer’s instructions and sequenced with 75bp paired end reads on an Illumina HiSeq2000 instrument (Illumina, San Diego, CA) to an average whole genome depth of 0.3X; average mitochondrial DNA (mtDNA) coverage was ~70X. Reads were aligned with the CanFam3.1 dog reference genome (<xref rid="bib24" ref-type="bibr">Lindblad-Toh et al., 2005</xref>
) (<ext-link ext-link-type="uri" xlink:href="http://www.ensembl.org/Canis_familiaris/Info/Index">http://www.ensembl.org/Canis_familiaris/Info/Index</ext-link>
) using the BWA alignment tool (<xref rid="bib22" ref-type="bibr">Li and Durbin, 2009</xref>
). To calculate the mitochondrial copy number, we used the following equation: (mtCOV/nuclCOV)*P, where mtCOV = average coverage across the mitochondria, nuclCOV = average coverage across the nuclear genome and P = ploidy. The ploidy used in our calculations was 2 for both CTVT tumours and CTVT hosts (<xref rid="bib30" ref-type="bibr">Murchison et al., 2014</xref>
). Host and tumour samples with average MT coverage >300X were excluded from the copy number calculations (see <xref ref-type="supplementary-material" rid="SD5-data">Supplementary file 2A</xref>
).</p>
<p>Samples 1380T and 1381T were sequenced separately, based on the methods described in Pang et al (<xref rid="bib33" ref-type="bibr">Pang et al., 2009</xref>
). Complete mitochondrial genomes were amplified using the primers listed in Pang et al (<xref rid="bib33" ref-type="bibr">Pang et al., 2009</xref>
) with a number of additional primers listed below. The PCR conditions are specified below.</p>
<p><table-wrap id="tblu4" orientation="portrait" position="anchor"><table frame="hsides" rules="groups"><thead><tr><th rowspan="1" colspan="1">PCR master mix reagents</th>
<th rowspan="1" colspan="1">Volume per reaction (μl)</th>
</tr>
</thead>
<tbody><tr><td rowspan="1" colspan="1">1 X PCR LATaq buffer</td>
<td rowspan="1" colspan="1">2.5</td>
</tr>
<tr><td rowspan="1" colspan="1">Primer forward and reverse (10 μM)</td>
<td rowspan="1" colspan="1">1.2 (each)</td>
</tr>
<tr><td rowspan="1" colspan="1">DNA (100-200 ng/μl)</td>
<td rowspan="1" colspan="1">1.2</td>
</tr>
<tr><td rowspan="1" colspan="1">LATaq DNA polymerase</td>
<td rowspan="1" colspan="1">0.25</td>
</tr>
<tr><td rowspan="1" colspan="1">1X dNTP (10 mM)</td>
<td rowspan="1" colspan="1">4</td>
</tr>
<tr><td rowspan="1" colspan="1">Water</td>
<td rowspan="1" colspan="1">14.65</td>
</tr>
<tr><td rowspan="1" colspan="1">Total volume</td>
<td rowspan="1" colspan="1">25</td>
</tr>
</tbody>
</table>
</table-wrap>
</p>
<p><table-wrap id="tblu5" orientation="portrait" position="anchor"><table frame="hsides" rules="groups"><thead><tr><th rowspan="1" colspan="1">Stage of PCR amplification</th>
<th rowspan="1" colspan="1">Temperature (°C)</th>
<th rowspan="1" colspan="1">Time (s)</th>
</tr>
</thead>
<tbody><tr><td rowspan="1" colspan="1">Initial denaturation</td>
<td rowspan="1" colspan="1">94</td>
<td rowspan="1" colspan="1">300</td>
</tr>
<tr><td rowspan="3" colspan="1">12 cycles (touchdown PCR program, reduce 1°C each cycle)</td>
<td rowspan="1" colspan="1">94</td>
<td rowspan="1" colspan="1">60</td>
</tr>
<tr><td rowspan="1" colspan="1">61–50</td>
<td rowspan="1" colspan="1">60</td>
</tr>
<tr><td rowspan="1" colspan="1">74</td>
<td rowspan="1" colspan="1">90</td>
</tr>
<tr><td rowspan="3" colspan="1">25 cycles</td>
<td rowspan="1" colspan="1">94</td>
<td rowspan="1" colspan="1">60</td>
</tr>
<tr><td rowspan="1" colspan="1">52</td>
<td rowspan="1" colspan="1">60</td>
</tr>
<tr><td rowspan="1" colspan="1">74</td>
<td rowspan="1" colspan="1">90</td>
</tr>
<tr><td rowspan="2" colspan="1">Final extension</td>
<td rowspan="2" colspan="1">74</td>
<td rowspan="2" colspan="1">420</td>
</tr>
</tbody>
</table>
</table-wrap>
</p>
<p><table-wrap id="tblu6" orientation="portrait" position="anchor"><table frame="hsides" rules="groups"><thead><tr><th valign="top" rowspan="1" colspan="1">Primer name</th>
<th valign="top" rowspan="1" colspan="1">Sequence (5’–3’)</th>
</tr>
</thead>
<tbody><tr><td rowspan="1" colspan="1">D0132</td>
<td rowspan="1" colspan="1">ACC GTA AGG GAA TGA TGA A</td>
</tr>
<tr><td valign="top" rowspan="1" colspan="1">D0136</td>
<td valign="top" rowspan="1" colspan="1">TGT AAG TGG TCG TAG AGG TTC</td>
</tr>
<tr><td valign="top" rowspan="1" colspan="1">D0141</td>
<td valign="top" rowspan="1" colspan="1">AGG CGG ACT AAA TCA AAC TCA</td>
</tr>
<tr><td valign="top" rowspan="1" colspan="1">D0146</td>
<td valign="top" rowspan="1" colspan="1">GGG GTA TCT AAT CCC AGT TT</td>
</tr>
<tr><td valign="top" rowspan="1" colspan="1">D0149</td>
<td valign="top" rowspan="1" colspan="1">AAG TTT GGT AGC ACG AAG AT</td>
</tr>
</tbody>
</table>
</table-wrap>
</p>
<p>The PCR products were purified using a 1.0% agarose gel and sequenced on a 3730xl DNA analyser (Applied Biosystems) with a Big Dye Terminator v3.1 Sequencing Kit (Applied Biosystems). The sequenced fragments were assembled by Seqman (DNASTAR, Madison, WI) and the complete mitochondrial genomes were aligned with the CanFam3.1 dog mitochondrial reference genome (<xref rid="bib24" ref-type="bibr">Lindblad-Toh et al., 2005</xref>
).</p>
</sec>
<sec id="s3-4"><title>Nuclear copies of mtDNA (NuMT) analysis</title>
<p>Nuclear copies of mtDNA (NuMTs) are mtDNA fragments that have been incorporated into the nuclear genome. Over 150 NuMTs have been identified in the canine genome (<xref rid="bib55" ref-type="bibr">Verscheure et al., 2015</xref>
). Somatically acquired NuMTs have also been described in human cancer (<xref rid="bib16" ref-type="bibr">Ju et al., 2015</xref>
).</p>
<p>Given that our study design did not involve purification of cytoplasmic mtDNA genomes, we assessed the possibility that our mtDNA variant analysis has been influenced by NuMTs.</p>
<sec id="s3-4-1"><title>NuMTs in CanFam3.1</title>
<p>We first assessed the potential contribution of NuMTs present within the CanFam3.1 assembly to our variant calling. We used <italic>wgsim</italic>
(<ext-link ext-link-type="uri" xlink:href="https://github.com/lh3/wgsim">https://github.com/lh3/wgsim</ext-link>
) to simulate sequence reads from CanFam3.1 (excluding the MT chromosome) to a coverage of 0.3X (i.e. the average nuclear genome coverage sequenced as part of this study). We then used BWA (<xref rid="bib22" ref-type="bibr">Li and Durbin, 2009</xref>
) to align the reads to the CanFam3.1 MT reference and used Samtools depth (<xref rid="bib23" ref-type="bibr">Li et al., 2009</xref>
; <xref rid="bib21" ref-type="bibr">Li, 2011</xref>
) to assess the MT genome coverage. Any MT genome coverage detected from this analysis would be expected to arise from NuMTs. The average MT genome coverage from this analysis was 0 (<xref ref-type="fig" rid="fig1s5">Figure 1—figure supplement 5</xref>
), indicating that the NuMTs known to be present within CanFam3.1 are at insufficient copy number and/or are too divergent to map to the MT reference genome using the alignment parameters used in this study.</p>
</sec>
<sec id="s3-4-2"><title>Somatically acquired NuMTs</title>
<p>The analysis described above confirms that NuMTs that form part of the CanFam3.1 assembly have not impacted on the variant analysis performed in this study. However, it is possible that somatically acquired NuMTs that are not captured in the CanFam3.1 assembly could confound our variant analysis.</p>
<p>The following observations argue against the possibility that NuMT-derived variants have had a significant impact on our tumour variant calling:</p>
<list list-type="bullet"><list-item><p>As CTVT is a clonal lineage, somatically acquired NuMT-derived variants would be expected to present as stable low-VAF variants across all tumours within a phylogenetic group. Variants with these features were not observed.</p>
</list-item>
<list-item><p>The mutation spectrum that we observed in CTVT mtDNA has the distinctive profile characteristic of the known somatic mtDNA mutational process (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>
and <xref rid="bib15" ref-type="bibr">Ju et al., 2014</xref>
). As this mutational process is specific to cytoplasmic mtDNA, this observation suggests that the majority of variants within our set are of cytoplasmic origin.</p>
</list-item>
</list>
</sec>
</sec>
<sec id="s3-5"><title>Substitution calling</title>
<sec id="s3-5-1"><title>Extraction and filtering</title>
<p>Substitutions were called using CaVEMan (Cancer Variants through Expectation Maximisation), an in-house variant calling algorithm, as previously described (<xref rid="bib32" ref-type="bibr">Nik-Zainal et al., 2012</xref>
) (<ext-link ext-link-type="uri" xlink:href="http://cancerit.github.io/CaVEMan/">http://cancerit.github.io/CaVEMan/</ext-link>
). As CaVEMan is designed for matched tumour-normal data, and CTVT tumours and normals are unmatched (i.e. they are different individuals), we used simulated reads derived from the reference genome as the 'normal', and called all substitution variants relative to this. A variant allele fraction (VAF value, i.e. number of reads supporting the substitution variant as a fraction of the total number of reads covering the substitution variant position) was reported for each substitution detected. The following list of in-built post-processing filters was used to improve the specificity and sensitivity of substitution calls:</p>
<list list-type="bullet"><list-item><p>At least one third of mutant alleles must have base quality >25.</p>
</list-item>
<list-item><p>Mean mapping quality of reads supporting a substitution variant call must be ≥21.</p>
</list-item>
<list-item><p>Substitution variant calls supported only by the first or last 15bp of reads were discarded.</p>
</list-item>
<list-item><p>Substitution variants were discarded if they occurred 10bp upstream or downstream of an unfiltered indel called in the same sample (as detected by the indel-detecting algorithm cgpPindel see 'Indel calling-Extraction and filtering'). The 10bp range was extended by the REP value for samples where an indel had been called with REP>0; REP represents the number of times the inserted/deleted base(s) occurs in the sequence directly 5’ or 3’ of the putative indel.</p>
</list-item>
<list-item><p>Substitution variant calls were discarded if they occurred within region MT:16129-16430 inclusive; this is a simple repeat region as defined by the UCSC (<ext-link ext-link-type="uri" xlink:href="http://genome.ucsc.edu/">http://genome.ucsc.edu/</ext-link>
) table browser (Dog, CanFam3.1).</p>
</list-item>
<list-item><p>If the reference allele was supported by at least one read on both strands (forward and reverse), then we required that the mutant allele should be supported by at least one read on both strands.</p>
</list-item>
</list>
<p>Substitutions in 1380T and 1381T were called using MEGA (Molecular Evolutionary Genetics Analysis) (<xref rid="bib50" ref-type="bibr">Tamura et al., 2013</xref>
).</p>
</sec>
<sec id="s3-5-2"><title>Post processing</title>
<sec id="s13"><title>Somatic substitutions in tumours with matched hosts</title>
<p>To remove tumour substitutions caused by host contamination, substitutions that were called in both tumour and matched host, but had VAF<0.9 in the tumour, were discarded. Substitutions with VAF>0.9 in both tumour and matched host were considered to be likely germline substitutions shared between host and tumour, and were retained. Low coverage hosts (defined as average coverage <20X, <xref ref-type="supplementary-material" rid="SD5-data">Supplementary file 2A</xref>
) were additionally checked for evidence of substitutions at positions where substitutions were called in the corresponding tumour, and the substitution was discarded in the tumour if at least one read supporting the substitution was found in the low coverage host. All tumour substitutions with VAF<0.5 were discarded if the matched host was of low coverage. Low-level tumour-contaminated hosts were additionally checked for the presence of substitutions identified in other tumours (see <xref ref-type="supplementary-material" rid="SD7-data">Supplementary file 4A</xref>
) and any substitutions arising due to contamination were discarded.</p>
</sec>
<sec id="s14"><title>Somatic substitutions in tumours without matched hosts</title>
<p>VAF value was used to identify substitutions likely arising due to host contamination in tumours for which matched hosts were not available (see <xref ref-type="supplementary-material" rid="SD4-data">Supplementary file 1</xref>
for tumours without matched hosts). We used VAF plots, which display VAF value versus genomic position, to identify the level of host contamination in each tumour. We then discarded any substitution below a VAF cutoff, specified uniquely for each tumour based on its estimated level of host contamination (for most tumours, the VAF cutoff was 0.5 or 0.6). If VAF plots did not show clear distinctions between tumour substitutions and host contamination (i.e. host contamination was greater than~40%; this category included 9 tumours), we identified likely tumour substitutions as those which were present in phylogenetically-related tumours. Remaining substitutions were removed if they were also found in normal dogs (see 'CTVT host and published dog genome germline substitutions list', <xref ref-type="supplementary-material" rid="SD7-data">Supplementary file 4F</xref>
); those substitutions that were not found either in phylogenetically-related tumours or in normal dogs were kept as putative somatic substitutions (total of 11 substitutions).</p>
</sec>
<sec id="s15"><title>Germline substitutions in hosts</title>
<p>Substitutions in hosts were filtered using filters described in 'Substitution calling-Extraction and filtering'. Low coverage hosts (defined as average coverage <20X, <xref ref-type="supplementary-material" rid="SD5-data">Supplementary file 2A</xref>
) were further checked for evidence of substitutions at positions where a substitution was called in the corresponding tumour as described in 'Somatic substitutions in tumours with matched hosts'. </p>
<p>Caution should be taken when considering substitution lists for low coverage hosts and hosts with regions of low coverage (see <xref ref-type="supplementary-material" rid="SD5-data">Supplementary file 2A</xref>
for average coverage per sample and <xref ref-type="supplementary-material" rid="SD5-data">Supplementary file 2B</xref>
for list of samples with low coverage mtDNA regions), as these may contain false negatives due to low coverage.</p>
</sec>
</sec>
<sec id="s3-5-3"><title>Additional quality checks and validation</title>
<p>Additional quality filtering was performed in low coverage regions, regions with low-mapping quality, and regions containing variable-length polyC homopolymer tracts (<xref rid="bib8" ref-type="bibr">Fregel et al., 2015</xref>
). Substitutions that were subsequently completely excluded from the analysis as a part of this check are listed in the table below.</p>
<p><table-wrap id="tblu7" orientation="portrait" position="anchor"><table frame="hsides" rules="groups"><thead><tr><th valign="top" rowspan="1" colspan="1">Position</th>
<th valign="top" rowspan="1" colspan="1">Base change</th>
<th valign="top" rowspan="1" colspan="1">Justification for excluding substitution</th>
</tr>
</thead>
<tbody><tr><td valign="top" rowspan="1" colspan="1">15493</td>
<td valign="top" rowspan="1" colspan="1">G>A</td>
<td valign="top" rowspan="1" colspan="1">Inconsistently called due to low coverage and decreased mapping quality in this region</td>
</tr>
<tr><td valign="top" rowspan="1" colspan="1">15505</td>
<td valign="top" rowspan="1" colspan="1">T>C</td>
<td valign="top" rowspan="1" colspan="1">Inconsistently called due to low coverage and decreased mapping quality in this region</td>
</tr>
<tr><td valign="top" rowspan="1" colspan="1">15632</td>
<td valign="top" rowspan="1" colspan="1">C>T</td>
<td valign="top" rowspan="1" colspan="1">Frequently miscalled due to decreased mapping quality in this region</td>
</tr>
<tr><td valign="top" rowspan="1" colspan="1">15639</td>
<td valign="top" rowspan="1" colspan="1">T>A</td>
<td valign="top" rowspan="1" colspan="1">Frequently miscalled due to decreased mapping quality in this region</td>
</tr>
<tr><td valign="top" rowspan="1" colspan="1">15639</td>
<td valign="top" rowspan="1" colspan="1">T>G</td>
<td valign="top" rowspan="1" colspan="1">Frequently miscalled due to decreased mapping quality in this region</td>
</tr>
<tr><td valign="top" rowspan="1" colspan="1">15931</td>
<td valign="top" rowspan="1" colspan="1">A>G</td>
<td valign="top" rowspan="1" colspan="1">Frequently miscalled due to its presence in the same position as a frequently miscalled indel (middle of a homopolymer tract)</td>
</tr>
<tr><td valign="top" rowspan="1" colspan="1">16672</td>
<td valign="top" rowspan="1" colspan="1">C>T</td>
<td valign="top" rowspan="1" colspan="1">Frequently miscalled due to its proximity to a frequently miscalled indel (associated with a very long homopolymer tract)</td>
</tr>
<tr><td valign="top" rowspan="1" colspan="1">16705</td>
<td valign="top" rowspan="1" colspan="1">C>T</td>
<td valign="top" rowspan="1" colspan="1">Frequently miscalled due to low coverage in this region</td>
</tr>
</tbody>
</table>
</table-wrap>
</p>
<p>Substitutions that were discarded due to proximity to an indel (see 'Substitution calling-Extraction and filtering' above) were visually inspected in Integrative Genomics Viewer (IGV) (<xref rid="bib39" ref-type="bibr">Robinson et al., 2011</xref>
; <xref rid="bib52" ref-type="bibr">Thorvaldsdottir et al., 2013</xref>
). A subset of these substitutions had substantial support and were rescued (listed below).</p>
<p><table-wrap id="tblu8" orientation="portrait" position="anchor"><table frame="hsides" rules="groups"><thead><tr><th rowspan="1" colspan="1">Position</th>
<th rowspan="1" colspan="1">Base change</th>
</tr>
</thead>
<tbody><tr><td rowspan="1" colspan="1">381</td>
<td rowspan="1" colspan="1">T>A</td>
</tr>
<tr><td rowspan="1" colspan="1">1481</td>
<td rowspan="1" colspan="1">T>C</td>
</tr>
<tr><td rowspan="1" colspan="1">1683</td>
<td rowspan="1" colspan="1">T>C</td>
</tr>
<tr><td rowspan="1" colspan="1">2682</td>
<td rowspan="1" colspan="1">G>A</td>
</tr>
<tr><td rowspan="1" colspan="1">2683</td>
<td rowspan="1" colspan="1">G>A</td>
</tr>
<tr><td rowspan="1" colspan="1">3028</td>
<td rowspan="1" colspan="1">A>C</td>
</tr>
<tr><td rowspan="1" colspan="1">6629</td>
<td rowspan="1" colspan="1">T>C</td>
</tr>
<tr><td rowspan="1" colspan="1">6882</td>
<td rowspan="1" colspan="1">A>G</td>
</tr>
<tr><td rowspan="1" colspan="1">7014</td>
<td rowspan="1" colspan="1">T>G</td>
</tr>
<tr><td rowspan="1" colspan="1">8281</td>
<td rowspan="1" colspan="1">T>C</td>
</tr>
<tr><td rowspan="1" colspan="1">8368</td>
<td rowspan="1" colspan="1">C>T</td>
</tr>
<tr><td rowspan="1" colspan="1">8703</td>
<td rowspan="1" colspan="1">G>A</td>
</tr>
<tr><td rowspan="1" colspan="1">9825</td>
<td rowspan="1" colspan="1">G>A</td>
</tr>
<tr><td rowspan="1" colspan="1">9896</td>
<td rowspan="1" colspan="1">T>C</td>
</tr>
<tr><td rowspan="1" colspan="1">13708</td>
<td rowspan="1" colspan="1">C>T</td>
</tr>
<tr><td rowspan="1" colspan="1">14977</td>
<td rowspan="1" colspan="1">T>C</td>
</tr>
<tr><td rowspan="1" colspan="1">15524</td>
<td rowspan="1" colspan="1">C>T</td>
</tr>
<tr><td rowspan="1" colspan="1">15526</td>
<td rowspan="1" colspan="1">C>T</td>
</tr>
<tr><td rowspan="1" colspan="1">16660</td>
<td rowspan="1" colspan="1">T>C</td>
</tr>
<tr><td rowspan="1" colspan="1">16663</td>
<td rowspan="1" colspan="1">C>T</td>
</tr>
<tr><td rowspan="1" colspan="1">16671</td>
<td rowspan="1" colspan="1">T>C</td>
</tr>
</tbody>
</table>
</table-wrap>
</p>
</sec>
<sec id="s3-5-4"><title>Host contamination</title>
<p>Host contamination levels in each tumour were estimated from VAF plots (see 'Somatic substitutions in tumours without matched hosts' above). Substitutions that were present in tumours but not in matched host were identified, and their average VAF used to estimate the proportion of tumour mtDNA (see <xref ref-type="supplementary-material" rid="SD5-data">Supplementary file 2C</xref>
for estimated tumour cell fraction in each tumour). Substitution VAFs were normalised to take account of host contamination in <xref ref-type="fig" rid="fig2">Figure 2A</xref>
and <xref ref-type="supplementary-material" rid="SD7-data">Supplementary files 4B,C</xref>
. Tumour variants with normalised VAF<1 most likely represent heteroplasmic variants; however, we cannot exclude that these represent cellular subclones harbouring distinct homoplasmic mtDNA populations.</p>
</sec>
<sec id="s3-5-5"><title>Recurrent mutations and back mutations</title>
<p>Back mutations and recurrent mutations occurring in tumours were identified by inspecting positions of tumours carrying each substitution on phylogenetic trees (<xref ref-type="supplementary-material" rid="SD2-data">Figure 1—source data 2</xref>
).</p>
</sec>
<sec id="s3-5-6"><title>Predicted functional consequences of substitutions</title>
<p>Variant effect predictor (VEP) (<xref rid="bib29" ref-type="bibr">McLaren et al., 2010</xref>
) was used to predict the functional consequences of single point substitutions, as annotated in <xref ref-type="supplementary-material" rid="SD9-data">Supplementary file 6</xref>
.</p>
</sec>
<sec id="s3-5-7"><title>Extracting substitution variants from publicly available dog sequences</title>
<p>In order to enrich our panel of germline substitutions created from 338 CTVT hosts, we included an additional set of 252 publicly available complete dog mtDNA genomes (see <xref ref-type="supplementary-material" rid="SD11-data">Supplementary file 8</xref>
). To extract substitution variants from available fasta files, sequences were aligned with the CanFam3.1 dog mitochondrial reference genome using Clustal Omega (<xref rid="bib42" ref-type="bibr">Sievers et al., 2011</xref>
). Alignment errors in the multiple sequence alignment, usually due to miscalls caused by closely mapped indels, were inspected manually and corrected to minimise gaps. Substitutions were extracted using snp-sites (<ext-link ext-link-type="uri" xlink:href="https://github.com/sanger-pathogens/snp_sites">https://github.com/sanger-pathogens/snp_sites</ext-link>
). For those samples missing data in regions MT: 15510–15532 and MT: 16040–16550 we substituted the most likely substitution at polymorphic sites based on phylogenetic position. Our filtering rules were applied to the substitution set where applicable (see 'Substitution calling-Extraction and filtering' and 'Additional quality checks and validation') and substitutions called before MT position 48 or after MT position 16671 were excluded due to low coverage in these regions in our sequencing data. Substitutions represented by International Union of Pure and Applied Chemistry (IUPAC) codes R, Y, S, W, K or M where one of the two possible calls was the same as the reference were changed to the base which was different to the reference. In cases where the IUPAC code represented >2 bases (B, D, H, V, or N), the reference base was substituted.</p>
</sec>
</sec>
<sec id="s3-6"><title>Indel calling</title>
<sec id="s3-6-1"><title>Extraction and filtering</title>
<p>Small insertions and deletions (indels) were extracted from the sequencing data using cgpPindel (<ext-link ext-link-type="uri" xlink:href="https://github.com/cancerit/cgpPindel">https://github.com/cancerit/cgpPindel</ext-link>
). The following list of in-built filters was used to improve the specificity and sensitivity of indel calls:</p>
<list list-type="bullet"><list-item><p>Indels were required to have ≥3 supporting reads on either the forward or reverse strands or ≥2 supporting reads on both the forward and reverse strands</p>
</list-item>
<list-item><p>Indel calls with at least 4 supporting pindel-mapped reads were required to have at least 1 supporting BWA-mapped read or, failing that, if REP= 0 (see 'Substitution calling-Extraction and filtering'), then at least one supporting pindel-mapped read on both strands.</p>
</list-item>
<list-item><p>Indels called within the simple repeat region MT:16129–16430 inclusive were excluded.</p>
</list-item>
</list>
<p>Samples with very high coverage of the mitochondrial genome (24T-Dog, 24H-Dog, 1T-Dog, 2T-Dog, 3T-Dog, 4T-Dog, 4H-Dog, 498H-Dog, 432T-Dog, 455T1-Dog, 231T-Dog, 79H-Dog, 79T-Dog), see <xref ref-type="supplementary-material" rid="SD5-data">Supplementary file 2A</xref>
, were excluded from this analysis due to frequent false positives, together with samples 1380T-Dog and 1381T-Dog.</p>
</sec>
<sec id="s3-6-2"><title>Post processing</title>
<sec id="s24"><title>Somatic indels</title>
<p>Indels called in tumours that were also called in at least one host were discarded as possibly arising due to host contamination. Indels that were uniquely called in tumours without matched hosts were discarded, as we could not rule out the possibility that they were caused by host contamination. All remaining indels were visually validated using IGV (<xref rid="bib39" ref-type="bibr">Robinson et al., 2011</xref>
; <xref rid="bib52" ref-type="bibr">Thorvaldsdottir et al., 2013</xref>
). The indels listed in the table below were discarded from the analysis as miscalls. In total 27 somatic indels were included in the analysis (see <xref ref-type="supplementary-material" rid="SD8-data">Supplementary file 5A</xref>
).</p>
<p><table-wrap id="tblu9" orientation="portrait" position="anchor"><table frame="hsides" rules="groups"><thead><tr><th valign="top" rowspan="1" colspan="1">Position</th>
<th valign="top" rowspan="1" colspan="1">Indel</th>
<th valign="top" rowspan="1" colspan="1">Sample</th>
<th valign="top" rowspan="1" colspan="1">Justification for discarding indel</th>
</tr>
</thead>
<tbody><tr><td valign="top" rowspan="1" colspan="1">9891</td>
<td valign="top" rowspan="1" colspan="1">TGATTTATCTCATAATTATCA> <break></break>
TATCTCATAATTATCATG</td>
<td valign="top" rowspan="1" colspan="1">324T2-Dog</td>
<td valign="top" rowspan="1" colspan="1">Indel miscalled due to close proximity of two other indels in the same sample</td>
</tr>
<tr><td valign="top" rowspan="1" colspan="1">9910</td>
<td valign="top" rowspan="1" colspan="1">C>CAT</td>
<td valign="top" rowspan="1" colspan="1">401T-Dog</td>
<td valign="top" rowspan="1" colspan="1">Indel miscalled due to presence of a substitution at the same position</td>
</tr>
</tbody>
</table>
</table-wrap>
</p>
</sec>
<sec id="s25"><title>Germline indels</title>
<p>The indels found on the host variant lists (<xref ref-type="supplementary-material" rid="SD8-data">Supplementary files 5B</xref>
and <xref ref-type="supplementary-material" rid="SD10-data">7B</xref>
, <xref ref-type="supplementary-material" rid="SD16-data">Supplementary file 13</xref>
) include only those which were considered homoplasmic (VAF≥0.9) and which passed a visual validation performed using IGV (<xref rid="bib39" ref-type="bibr">Robinson et al., 2011</xref>
; <xref rid="bib52" ref-type="bibr">Thorvaldsdottir et al., 2013</xref>
).</p>
</sec>
</sec>
<sec id="s3-6-3"><title>Recurrent indels</title>
<p>Recurrent indels occurring in tumours were identified by inspecting phylogenetic positions of tumours carrying each indel (<xref ref-type="supplementary-material" rid="SD2-data">Figure 1—source data 2</xref>
).</p>
</sec>
<sec id="s3-6-4"><title>Variant Allele Fraction calculation for indels</title>
<p>Although primary indel calling was carried out using cgpPindel, indel allele fraction for wild type and mutant indels was calculated using vcfCommons (unpublished in-house software developed at the Wellcome Trust Sanger Institute; for additional information please contact cgp@sanger.ac.uk). The algorithm takes all mapped and unmapped reads in the region of an indel and performs an alignment of the reference and the predicted mutated path using Exonerate (<xref rid="bib43" ref-type="bibr">Slater and Birney, 2005</xref>
). The predicted mutated path is the reference with the change predicted by cgpPindel applied to it. Based on this alignment, reads are classified into 3 categories:</p>
<list list-type="order"><list-item><p>aligns to reference path</p>
</list-item>
<list-item><p>aligns to mutated path</p>
</list-item>
<list-item><p>ambiguous; a read sequence aligns to the reference and mutated path with identical scores which makes it impossible to determine the true path</p>
</list-item>
</list>
<p>Indel VAF values were normalised to take account of host contamination in <xref ref-type="fig" rid="fig2">Figure 2B</xref>
.</p>
</sec>
<sec id="s3-6-5"><title>Predicted functional consequences of indels</title>
<p>Variant effect predictor (VEP) (<xref rid="bib29" ref-type="bibr">McLaren et al., 2010</xref>
) was used to predict the functional effects of indels, as listed in <xref ref-type="supplementary-material" rid="SD10-data">Supplementary file 7</xref>
.</p>
</sec>
</sec>
<sec id="s3-7"><title>Phylogenetic analyses</title>
<sec id="s3-7-1"><title>Phylogenetic trees</title>
<p>Phylogenetic trees were constructed using a maximum likelihood (ML) method implemented in PhyML 3.0 (<xref rid="bib11" ref-type="bibr">Guindon et al., 2010</xref>
) using the General Time Reversible (GTR) + G + I nucleotide substitution model with transition/transversion (ts/tv) ratio, gamma distribution shape parameter and proportion of invariant sites estimated in PhyML for each dataset. Phylogenetic trees constructed using RAxML 8.2.6 with a rapid climbing algorithm and identical model specification were consistent with the phylogenetic trees obtained using PhyML. Prior to tree construction jModelTest2 (<xref rid="bib6" ref-type="bibr">Darriba et al., 2012</xref>
) (<ext-link ext-link-type="uri" xlink:href="https://code.google.com/p/jmodeltest2">https://code.google.com/p/jmodeltest2</ext-link>
) was used to determine the best fitting substitution model for the alignment, inferred using the Akaike Information Criteria (AIC). The tree topology was estimated using a combination of Nearest Neighbor Interchange (NNI) and Subtree Pruning and Regrafting (SPR) (<xref rid="bib13" ref-type="bibr">Hordijk and Gascuel, 2005</xref>
) algorithms. Trees were visualised using Dendrocope (<xref rid="bib14" ref-type="bibr">Huson and Scornavacca, 2012</xref>
). Bootstrap support values were obtained from 100 bootstrap replicates. Nodes with ≥60% support are labelled in <xref ref-type="supplementary-material" rid="SD2-data">Figure 1—source data 2</xref>
and <xref ref-type="supplementary-material" rid="SD3-data">Figure 3—source data 1</xref>
. The long branch-lengths in CTVT clade 4 were further investigated by visually validating sequence alignments involving these samples.</p>
</sec>
<sec id="s3-7-2"><title>Confirmation of individual horizontal transfer events</title>
<sec id="s32"><title>Classification of tumour substitutions</title>
<p>CTVT tumour substitutions were classified as follows:</p>
<p>1) Tumour germline clade-defining substitutions (see <xref ref-type="supplementary-material" rid="SD7-data">Supplementary file 4D</xref>
for the full list)</p>
<list list-type="bullet"><list-item><p>Inferred to be present on the donor mtDNA haplotype which founded each of the five horizontal transfer events</p>
</list-item>
<list-item><p>Present within the pool of substitutions in the current dog population (see <xref ref-type="supplementary-material" rid="SD7-data">Supplementary file 4F</xref>
)</p>
</list-item>
<list-item><p>Shared by all tumours within each clade derived from the original CTVT cell which received the horizontally transferred donated mtDNA (see <xref ref-type="fig" rid="fig1s4">Figure 1—figure supplement 4</xref>
)</p>
</list-item>
</list>
<p>2) Tumour somatic substitutions (see <xref ref-type="supplementary-material" rid="SD7-data">Supplementary file 4B</xref>
for the full list)</p>
<list list-type="bullet"><list-item><p>Inferred to have arisen after the clade-defining horizontal transfer event</p>
</list-item>
<list-item><p>Variable and phylogenetically informative within the set of tumours in one clade</p>
</list-item>
<list-item><p>Any substitutions which were associated with inferred recombination event (present uniquely) in 559T were discarded (see 'Mitochondrial recombination analysis')</p>
</list-item>
</list>
<p>3) Tumour somatic substitutions - conservative list (see <xref ref-type="supplementary-material" rid="SD7-data">Supplementary file 4C</xref>
for the full list)</p>
<list list-type="bullet"><list-item><p>Inferred to have arisen after the clade-defining horizontal transfer event</p>
</list-item>
<list-item><p>Variable and phylogenetically informative within the set of tumours in one clade</p>
</list-item>
<list-item><p>Any substitutions which were classed as somatic but had the potential to be germline were excluded from this list. Exclusions were based on:<list list-type="bullet"><list-item><p>Inferred recombination events</p>
</list-item>
<list-item><p>Occurrence in clade 3; clade 3 tumours carry very few somatic mutations, and so the possibility that clade 3 tumours arose from several independent mtDNA horizontal transfer events cannot be excluded</p>
</list-item>
<list-item><p>Occurrence on ancestral trunks; these include trunks defining CTVT_1A, CTVT_1B1, CTVT_2A haplogroups; due to their ancestral divergence, it cannot be excluded that these haplotypes are derived from independent mtDNA horizontal transfer events</p>
</list-item>
<list-item><p>Occurrence as a putative somatic mutation in tumours without hosts (see 'Somastic substitutions in tumours without matched hosts')</p>
</list-item>
</list>
</p>
</list-item>
<list-item><p>This list was used for the analysis in <xref ref-type="fig" rid="fig2">Figure 2A,C</xref>
and <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>
.</p>
</list-item>
</list>
<p>4) Tumour potential somatic substitutions (see <xref ref-type="supplementary-material" rid="SD7-data">Supplementary file 4E</xref>
for the full list)</p>
<list list-type="bullet"><list-item><p>Substitutions present within all tumours within one clade but not represented in the set of 590 normal dogs analysed as part of this study (<xref ref-type="supplementary-material" rid="SD7-data">Supplementary file 4F</xref>
)</p>
</list-item>
<list-item><p>It cannot be determined if these substitutions are germline substitutions which were present on the mtDNA genome that founded each clade, or if they are early somatic substitutions that occurred after the clade-defining horizontal transfer event, but prior to the divergence of tumours analysed in our study.</p>
</list-item>
</list>
</sec>
<sec id="s33"><title>Definition of a CTVT clade</title>
<p>A CTVT clade is defined as a group of tumours arising from an individual horizontal transfer event. Each clade is defined with respect to the tumour substitution classification (see 'Classification of tumour substitutions') as follows:</p>
<list list-type="order"><list-item><p>CTVT tumours from the same clade cluster together on phylogenetic tree represented in <xref ref-type="fig" rid="fig1">Figure 1A</xref>
.</p>
</list-item>
<list-item><p>CTVT tumours from the same clade arose from a single donor mtDNA haplotype and therefore share the same set of germline substitutions which was inferred to be originally present on the donor mtDNA haplotype (germline clade-defining substitutions, see <xref ref-type="fig" rid="fig1s4">Figure 1—figure supplement 4</xref>
, 'Classification of tumour substitutions').</p>
</list-item>
<list-item><p>The reconstructed donor mtDNA haplotype for each clade has a phylogenetically closely related/identical haplotype in the current dog population (see <xref ref-type="fig" rid="fig1s4">Figure 1—figure supplement 4</xref>
).</p>
</list-item>
</list>
</sec>
</sec>
<sec id="s3-7-3"><title>Estimated timing of clade divergence</title>
<p>Average number of somatic mutations (i.e. mutations arising after the horizontal transfer event) within each clade was calculated for each of the five clades (see <xref ref-type="supplementary-material" rid="SD12-data">Supplementary file 9</xref>
). For potential somatic mutations (shown in grey in <xref ref-type="fig" rid="fig1">Figure 1B and D</xref>
), we were unable to determine whether they occurred before or after the horizontal transfer event, as they are present in all samples from the same clade, but not in the pool of germline substitutions (see <xref ref-type="supplementary-material" rid="SD7-data">Supplementary file 4F</xref>
). As the number of somatic mutations influences the time of divergence, we included estimates both with and without potential somatic mutations in our analysis (see <xref ref-type="supplementary-material" rid="SD12-data">Supplementary file 9</xref>
). Presence of mitochondrial recombination in haplogroup CTVT_1B2b2 (clade 1) was taken into account when calculating the average number of mutations per clade (see 'Mitochondrial recombination analysis'). The timing of clade divergence was estimated independently based on the following three methods, as explained below: timing based on nuclear DNA (<xref rid="bib30" ref-type="bibr">Murchison et al., 2014</xref>
; <xref rid="bib1" ref-type="bibr">Alexandrov et al., 2013</xref>
), timing based on number of cell divisions per homoplasmic mitochondrial mutation (<xref rid="bib15" ref-type="bibr">Ju et al., 2014</xref>
; <xref rid="bib4" ref-type="bibr">Cohen and Steel, 1972</xref>
), and timing based on number of mitochondrial mutations per year (<xref rid="bib15" ref-type="bibr">Ju et al., 2014</xref>
). All estimates of CTVT dates assume a constant rate of accumulation of somatic mtDNA mutations both within and between clades, including constant activity of selection (<xref ref-type="fig" rid="fig2">Figure 2</xref>
).</p>
<sec id="s35"><title>Timing based on nuclear DNA</title>
<p>Based on the most recent common ancestor of samples 24T (CTVT clade 1) and 79T (CTVT clade 2) which is estimated to have existed approximately 460 years ago (<xref rid="bib30" ref-type="bibr">Murchison et al., 2014</xref>
), we can assume that the maximum age of clade 2 (i.e. the more recent clade) is 460 years. Calibrated according to this dating (<xref rid="bib30" ref-type="bibr">Murchison et al., 2014</xref>
; <xref rid="bib1" ref-type="bibr">Alexandrov et al., 2013</xref>
), and assuming a constant rate of accumulation of mutations with time, the maximum number of CTVT somatic mtDNA mutations per year is 0.0205 (calculated using average number of mutations in clade 2 = 9.437). The calculated maximum time since origin of clades 1, 3, 4 and 5, is shown in <xref ref-type="fig" rid="fig1">Figure 1D</xref>
and <xref ref-type="supplementary-material" rid="SD12-data">Supplementary file 9</xref>
.</p>
</sec>
<sec id="s36"><title>Timing based on number of cell divisions</title>
<p>A study of mtDNA mutations in human cancers estimated that one homoplasmic somatic mtDNA mutation arises every ~1000 cell generations in human cancers (<xref rid="bib15" ref-type="bibr">Ju et al., 2014</xref>
). An experimental study estimated CTVT cell generation times to be 4 days for first stage tumours and >20 days for second stage tumours (<xref rid="bib4" ref-type="bibr">Cohen and Steel, 1972</xref>
). Using 4 days and 20 days as a minimum and maximum generation time, and assuming a constant mtDNA somatic mutation rate in CTVT, we estimated a minimum and maximum mutation rate of ~0.0183 and ~0.0913 mutations/year respectively. See <xref ref-type="supplementary-material" rid="SD12-data">Supplementary file 9</xref>
for corresponding calculations of minimum and maximum time since clade origins.</p>
</sec>
<sec id="s37"><title>Timing based on number of mutations per year</title>
<p>A previous study correlated somatic mtDNA mutation accumulation in human cancers with patient age (<xref rid="bib15" ref-type="bibr">Ju et al., 2014</xref>
). This suggested an approximate rate of ~0.025 mutations per year. Assuming a similar rate in CTVT somatic mtDNA mutations and a constant CTVT somatic mtDNA mutation rate, we estimated time since mtDNA horizontal transfer events (<xref ref-type="supplementary-material" rid="SD12-data">Supplementary file 9</xref>
).</p>
</sec>
</sec>
</sec>
<sec id="s3-8"><title>Haplotype analysis</title>
<sec id="s3-8-1"><title>Haplotype nomenclature</title>
<sec id="s40"><title>Host haplotypes</title>
<p>The host haplotype naming system was adapted from the cladistic canine mitochondrial DNA phylogeny nomenclature proposed by Fregel et al (<xref rid="bib8" ref-type="bibr">Fregel et al., 2015</xref>
). See <xref ref-type="supplementary-material" rid="SD4-data">Supplementary files 1</xref>
and <xref ref-type="supplementary-material" rid="SD14-data">11</xref>
for all host haplotype names. Corresponding CTVT normal dog host samples were assigned into one of the major clades (A, B, C, D, E and F). For subsequent levels, haplogroups were defined by specific diagnostic variants, as defined by Fregel et al (<xref rid="bib8" ref-type="bibr">Fregel et al., 2015</xref>
). A unique number, following an underscore after the haplogroup name, distinguished distinct haplotypes within each haplogroup. Haplogroup-defining variants 15632 C>T, 15639 T>A and 15639 T>G were excluded from our analysis ('Additional quality checks and validation') and therefore we were unable to distinguish between haplogroups A1c and A1e. Haplotypes which did not fit into any haplogroup were classified as 'unassigned'.</p>
</sec>
<sec id="s41"><title>Tumour haplotypes</title>
<p>We devised a CTVT mtDNA haplotype naming system adapted from the cladistic canine mtDNA phylogeny nomenclature proposed by Fregel et al (<xref rid="bib8" ref-type="bibr">Fregel et al., 2015</xref>
). See <xref ref-type="supplementary-material" rid="SD4-data">Supplementary file 1</xref>
and <xref ref-type="supplementary-material" rid="SD14-data">11</xref>
for all CTVT tumour haplotype names. Each CTVT haplotype has a prefix 'CTVT_', indicating a tumour haplotype. Distinct CTVT clades are numbered (CTVT_1, CTVT_2, CTVT_3, CTVT_4 and CTVT_5). For subsequent levels, hierarchical notation was used, where subsequent haplogroups were named by alternating letters and numbers and the maximum number of levels included in the hierarchical notation was five – i.e. 3 numbers and 2 letters (e.g. 1A1a1). The first letter is a Roman capital; subsequently-used letters are lower case Roman letters. Any haplogroups beyond the maximum number of levels were considered as a single subgroup, in which individual haplotypes were distinguished using a non-hierarchical numbering system - an underscore followed by a number (e.g. 1A1a1_1, 1A1a1_2, etc.). Underscores were only used to distinguish individual haplotypes after the haplotype has been assigned to all 5 hierarchical levels (e.g. 1A_1 does not exist, as this haplotype would be classified as 1A1 instead).</p>
</sec>
</sec>
<sec id="s3-8-2"><title>Reconstructed donor haplotypes</title>
<p>A 'donor haplotype' was reconstructed for each of the clades, representing the inferred donor mtDNA haplotype in each horizontal transfer event, and was used to root the trees for each clade in <xref ref-type="supplementary-material" rid="SD2-data">Figure 1—source data 2</xref>
. Donor haplotypes were reconstructed from the clade-defining germline substitutions and the clade-defining potential somatic substitutions (see 'Classifications of tumour substitutions' above) and are shown in <xref ref-type="fig" rid="fig1s4">Figure 1—figure supplement 4</xref>
. The phylogenetically closest haplotype present in the current dog population is shown in the same figure.</p>
</sec>
</sec>
<sec id="s3-9"><title>Mitochondrial recombination analysis</title>
<sec id="s3-9-1"><title>Automated recombination analysis</title>
<p>The RDP4 package (<xref rid="bib28" ref-type="bibr">Martin et al., 2015</xref>
) was used to detect recombination events within the complete sample set (i.e. 449 CTVT tumours, 338 CTVT hosts and 252 additional dogs) using a Bonferroni corrected <italic>p</italic>
-value cutoff of 0.05. Default parameters were used for the following programs implemented within the RDP package: RDP (<xref rid="bib26" ref-type="bibr">Martin and Rybicki, 2000</xref>
), MaxChi (<xref rid="bib44" ref-type="bibr">Smith, 1992</xref>
), Chimaera (<xref rid="bib34" ref-type="bibr">Posada and Crandall, 2001</xref>
), 3Seq (<xref rid="bib3" ref-type="bibr">Boni et al., 2007</xref>
) and SiScan (<xref rid="bib10" ref-type="bibr">Gibbs et al., 2000</xref>
).</p>
</sec>
<sec id="s3-9-2"><title>Long read sequencing</title>
<p>A genomic library was created directly using 5µg of genomic DNA from sample 559T, not utilizing shearing or amplification techniques, as previously described (<xref rid="bib5" ref-type="bibr">Coupland et al., 2012</xref>
). The library was sequenced using two PacBio SMRT cells using the Pacific Biosciences RS sequencer (Pacific Biosciences, Menlo Park, CA). Each SMRT cell yielded ~1Gb of sequence data with mean read length 11,421bp and N50 read length 19,382bp. Average sequence coverage across the mitochondrial genome was 111.3X.</p>
</sec>
<sec id="s3-9-3"><title>PacBio data analysis</title>
<p>PacBio sequence reads aligning to mtDNA were viewed in SMRT view (Pacific Biosciences) as well as in Integrative Genomics Viewer (IGV) (<xref rid="bib39" ref-type="bibr">Robinson et al., 2011</xref>
; <xref rid="bib52" ref-type="bibr">Thorvaldsdottir et al., 2013</xref>
) and used to phase the mitochondrial substitutions previously called in 559T (Nicaragua). The three most common recombinant haplotypes were completely phased, as shown in <xref ref-type="fig" rid="fig3">Figure 3C</xref>
. Additional haplotypes, which we were unable to phase completely and which were present at very low level (less than 5%), were also identified. Reads derived from 559H, the host of 559T (haplotype B1_1), were also identified. The reads used to phase the substitutions in the three most common haplotypes are shown in the table below:</p>
<p><table-wrap id="tblu10" orientation="portrait" position="anchor"><table frame="hsides" rules="groups"><thead><tr><th colspan="3" rowspan="1">PacBio sequencing reads used for phasing of individual haplotypes</th>
</tr>
</thead>
<tbody><tr><td rowspan="1" colspan="1">559T haplotype 1</td>
<td rowspan="1" colspan="1">559T haplotype 2</td>
<td rowspan="1" colspan="1">559T haplotype 3</td>
</tr>
<tr><td valign="top" rowspan="1" colspan="1">m150625_205815_00127_ <break></break>
c10080924255000000 <break></break>
1823177310081544_ <break></break>
s1_p0/80046</td>
<td valign="top" rowspan="1" colspan="1">m150623_234631_00127_ <break></break>
c10078774255000000 <break></break>
1823173008251557_ <break></break>
s1_p0/328</td>
<td valign="top" rowspan="1" colspan="1">m150625_205815_00127_ <break></break>
c10080924255000000 <break></break>
1823177310081544_ <break></break>
s1_p0/64645</td>
</tr>
<tr><td valign="top" rowspan="1" colspan="1">m150625_205815_00127_ <break></break>
c10080924255000000 <break></break>
1823177310081544_ <break></break>
s1_p0/50141</td>
<td valign="top" rowspan="1" colspan="1">m150623_234631_00127_ <break></break>
c10078774255000000 <break></break>
1823173008251557_ <break></break>
s1_p0/89158</td>
<td valign="top" rowspan="1" colspan="1">m150625_205815_00127_ <break></break>
c10080924255000000 <break></break>
1823177310081544_ <break></break>
s1_p0/29160</td>
</tr>
<tr><td valign="top" rowspan="1" colspan="1">m150623_234631_00127_ <break></break>
c10078774255000000 <break></break>
1823173008251557_ <break></break>
s1_p0/32367</td>
<td valign="top" rowspan="1" colspan="1">m150625_205815_00127_ <break></break>
c10080924255000000 <break></break>
1823177310081544_ <break></break>
s1_p0/45213</td>
<td valign="top" rowspan="1" colspan="1">Many reads in the region between 9790-16627</td>
</tr>
<tr><td valign="top" rowspan="1" colspan="1">m150623_234631_00127_ <break></break>
c10078774255000000 <break></break>
1823173008251557_ <break></break>
s1_p0/145458</td>
<td valign="top" rowspan="1" colspan="1"></td>
<td valign="top" rowspan="1" colspan="1"></td>
</tr>
</tbody>
</table>
</table-wrap>
</p>
</sec>
</sec>
<sec id="s3-10"><title>Mutation spectrum</title>
<p>The two strands of the mtDNA are known as the heavy and light strands, and the light strand is the reference strand in CanFam3.1. Each mutation on the conservative somatic list (n=835, 'Classification of tumour substitutions', <xref ref-type="supplementary-material" rid="SD7-data">Supplementary file 4C</xref>
) was classified as one of six possible substitutions in the pyrimidine context (C>A, C>G, C>T, T>A, T>C, T>G) and assigned to a strand relative to the reference (i.e. pyrimidine mutations (i.e. C>, T>) with respect to the reference were defined as light strand mutations; purine mutations (i.e. A>, G>) with respect to the reference were defined as heavy strand mutations). The immediate 5’ and 3’ sequence contexts for each CTVT mutation was extracted from the dog mitochondrial reference genome for mutations on the heavy and light strands, yielding a maximum of 96 mutation types (6 possible substitutions x 4 possible 5’ bases x 4 possible 3’ bases).</p>
<p>The number of observations of each substitution type was normalised to the triplet frequency extracted from the canine mitochondrial genome. The following example illustrates how to calculate the observed/expected ratio for T[C>T]G occurring on the heavy strand. We observed a total of 835 substitutions occurring across the MT genome; given that the TCG triplet is observed 117 times in the dog mitochondrial reference genome heavy strand, the frequency of TCG triplets occurring in the dog mtDNA heavy strand is 117/16727 = 0.007, where 16,727 bp is the length of the dog mitochondrial genome. Using the frequency of TCG triplets in the reference genome, we can calculate the expected number of T[C>T]G substitution types on the heavy strand as (total number of mutations) x (TCG frequency on the heavy strand) / 3 (as there are 3 possible C>N substitutions) i.e. expected number of T[C>T]G substitutions on the heavy strand = 835 x 0.007/ 3 ≈ 1.95. As we observed 22 T[C>T]G mutations on the heavy strand, the observed/expected ratio for this mutation type was 22/1.95 = 11.28.</p>
<p>Triplets within region MT:16129–16430 inclusive ('Substitution calling-Extraction and filtering'), as well as a set of specific excluded sites ('Additional quality checks and validation') were excluded from our analysis. This was accounted for during the calculation of expected substitutions described above.</p>
</sec>
<sec id="s3-11"><title>Selection analyses</title>
<sec id="s3-11-1"><title>VAF</title>
<sec id="s50"><title>Substitutions</title>
<p>Normalised VAF values for somatic substitutions were calculated as described in 'Host contamination'. Cumulative distribution functions for VAF scores (normalised to take into account host contamination, see 'Host contamination' above) were plotted for nonsense substitutions (n = 10) and missense and synonymous substitutions (n = 610), using the conservative somatic list (see 'Classification of tumour substitutions' above and <xref ref-type="supplementary-material" rid="SD7-data">Supplementary file 4C</xref>
). Statistical significance was tested using the two-sample Kolmogorov-Smirnov test implemented in <italic>R</italic>
(<xref rid="bib35" ref-type="bibr">R Development Core Team, 2013</xref>
).</p>
</sec>
<sec id="s51"><title>Indels</title>
<p>Normalised VAF for somatic indels was calculated as described in 'Predicted functional consequences on indels'. Cumulative distribution functions of normalised variant allele fractions were plotted for frameshift (n = 18) and non-frameshift (n = 9) indels. Statistical significance was tested using the two-sample Kolmogorov-Smirnov test implemented in <italic>R</italic>
(<xref rid="bib35" ref-type="bibr">R Development Core Team, 2013</xref>
).</p>
</sec>
</sec>
<sec id="s3-11-2"><title>dN/dS</title>
<p>dN/dS was estimated using a method adapted from <xref rid="bib28" ref-type="bibr">Martincorena et al. (2015)</xref>
. Briefly, a context-dependent model with 192 substitution rates (12 possible substitution types C>A, C>G, C>T, T>A, T>C, T>G, A>C, A>G, A>T, G>A, G>C, G>T x 4 possible 5’ bases x 4 possible 3’ bases) was used, thus accounting for any confounding context-dependent effects. The substitution rate was modelled as a Poisson process where the product of the underlying mutation rate and the impact of selection give the rate. A likelihood ratio test was used to test the deviation from neutrality (w<sub>MIS</sub>
=1 or w<sub>NON</sub>
=1), giving a <italic>p</italic>
-value for the evidence of selection. To avoid any confounding effects due to the highly strand-biased CTVT mtDNA mutation spectrum (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>
), we excluded <italic>ND6</italic>
, the only mitochondrially-encoded gene transcribed from the light strand, from this analysis.</p>
</sec>
</sec>
</sec>
</body>
<back><sec sec-type="funding-information"><title>Funding Information</title>
<p>This paper was supported by the following grants:</p>
<list list-type="bullet"><list-item><p><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100004440</institution-id>
<institution>Wellcome Trust</institution>
</institution-wrap>
</funding-source>
<award-id>Investigator Award, 102942/Z/13/A</award-id>
to Elizabeth P Murchison.</p>
</list-item>
<list-item><p><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100000275</institution-id>
<institution>Leverhulme Trust</institution>
</institution-wrap>
</funding-source>
<award-id>Philip Leverhulme Prize</award-id>
to Elizabeth P Murchison.</p>
</list-item>
<list-item><p><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100000288</institution-id>
<institution>Royal Society</institution>
</institution-wrap>
</funding-source>
<award-id>Research Grant, RG130615</award-id>
to Elizabeth P Murchison.</p>
</list-item>
</list>
</sec>
<ack id="ack"><title>Acknowledgements</title>
<p>We thank Simon Frost, Young Seok Ju and Ludmil Alexandrov for helpful discussions and advice. This work was supported by grants from the Wellcome Trust (102942/Z/13/A) and the Royal Society (RG130615), and a Philip Leverhulme Prize from the Leverhulme Trust. We are grateful to Michael Stratton for his support. We would like to acknowledge the Core Sequencing Facility, IT groups and members of the Cancer Genome Group of the Wellcome Trust Sanger Institute. We are very grateful to Cathy King and all World Vets staff and volunteers who contributed to sample collection. We would like to thank the following individuals for useful information and for their help with obtaining samples for this project: Adrián Báez-Ortega, Ekaterina Batrakova, Rafaela Bortolotti Viéra, Matthew Breen, Austin Burt, Fernando Constantino Casas, John Cooper, Amici Cannis Cotacachi, Lytvynenko Dmytro, Ariberto Fassati, Ricardo Gaitan, David Hanzlíček, Mike Hobart, Rafael Ricardo Huppes, Matilde Jimenez-Coello, Debra Kamstock, Patrick Kelly, Tatiana Korytina, Ada Krupa, Anna Kuznetsova, Olakunle AbdulRasaq Lawal, Thabo Lerotholi, Marco Lima-Maigua, Jimmy Loayza-Feijoo, Mayra López-Bucheli, Margarita Mancero-Albuja, Cynthia Marchiori Bueno, Talita Mariana Morata Raposo, Luis Martínez-López, Alfredo Martínez-Meza, Edward Migneco, Scott Moroff, Claudio Murgia, Alvira Murison Swartz, Fran Nargi, Edwin Ortiz-Rodríguez, Lisa Pellegrini, Gerry Polton, Freddy Proaño-Pérez, Clare Rebbeck, Šárka Rusá, Ceseltina Semedo, Ivan Stoikov, Lester Tapia, Mirela Tinucci Costa, David Walker, Robin Weiss, Kevin Xie, Yaping Zhang, veterinary workers of Pet Centre (UVAS, Lahore, Pakistan), staff at the WVS International Training Centre in Ooty (India), staff of Veterinary clinic “El Roble” and students from St. George's University (True Blue, Grenada, West Indies) who assisted with sample collection. We are grateful to the following organisations for helpful information: Associacao Bons Amigos de Cabo Verde, the Humane Society of Cozumel, ViDAS and Coco´s Animal Welfare, Veterinary Society of Surgical Oncology (VSSO), Veterinary Cancer Society, World Vets, Animal Balance, The Spanky Project, Humane Society Veterinary Medical Association-Rural Area Veterinary Services (HSVMA-RAVS), World Small Animal Veterinary Association (WSAVA), VWB/VSF Canada, Israel Veterinary Medical Association, Italian Veterinary Oncology Society, American College of Veterinary Internal Medicine (ACVIM), Rural Vets South Africa, Animal Care Association (The Gambia), МИР ВЕТЕРИНАРИИ (World Veterinary Medicine), and staff of VetPharma. We thank Ian Mickleburgh for his assistance with laboratory procedures. The map in <xref ref-type="fig" rid="fig1">Figures 1C</xref>
, <xref ref-type="fig" rid="fig3">3A</xref>
and <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>
was used under the Royalty Free License from Free Vector Maps. Data associated with this study are available in GenBank with accession numbers: KU290400 - KU291095. Sequencing data associated with this study are available in the ENA with accession number ERP014691.</p>
</ack>
<sec id="s4" sec-type="additional-information"><title>Additional information</title>
<fn-group content-type="competing-interest"><title><bold>Competing interests</bold>
</title>
<fn fn-type="conflict" id="conf1"><p>The authors declare that no competing interests exist.</p>
</fn>
</fn-group>
<fn-group content-type="author-contribution"><title><bold>Author contributions</bold>
</title>
<fn fn-type="con" id="con1"><p>ASt, Critical reading of the manuscript, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con2"><p>MNL, Critical reading of the manuscript, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article.</p>
</fn>
<fn fn-type="con" id="con3"><p>G-DW, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con4"><p>T-TY, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con5"><p>IA-O, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con6"><p>JLA, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con7"><p>KMA, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con8"><p>LB-I, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con9"><p>JLB, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con10"><p>ACD, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con11"><p>KFdC, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con12"><p>AMC, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con13"><p>HRC, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con14"><p>JTC, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con15"><p>SMCu, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con16"><p>LDK, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con17"><p>EMD, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con18"><p>IAF, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con19"><p>EFR, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con20"><p>EF, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con21"><p>SNF, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con22"><p>FG-A, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con23"><p>OG, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con24"><p>RFHM, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con25"><p>JJGPH, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con26"><p>NI, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con27"><p>DK, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con28"><p>ML-P, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con29"><p>RL, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con30"><p>AMLQ, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con31"><p>TL, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con32"><p>GM, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con33"><p>IM, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con34"><p>SMCa, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con35"><p>MFM-L, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con36"><p>MM, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con37"><p>BN, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con38"><p>ABDN, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con39"><p>WN, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con40"><p>SJN, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con41"><p>MMO, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con42"><p>AO-P, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con43"><p>MCP, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con44"><p>RJP, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con45"><p>JFR, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con46"><p>JRG, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con47"><p>HS, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con48"><p>SKS, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con49"><p>OS, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con50"><p>RKS, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con51"><p>AES-S, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con52"><p>ASv, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con53"><p>ITN, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con54"><p>BAV, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con55"><p>APdV, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con56"><p>JPdV, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con57"><p>OW, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con58"><p>DCW, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con59"><p>ASW-M, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con60"><p>MGvdW, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con61"><p>SAEW, Critical reading of the manuscript, Contributed unpublished essential data or reagents.</p>
</fn>
<fn fn-type="con" id="con62"><p>EPM, Critical reading of the manuscript, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article, Contributed unpublished essential data or reagents.</p>
</fn>
</fn-group>
</sec>
<sec id="s5" sec-type="supplementary-material"><title>Additional files</title>
<supplementary-material content-type="local-data" id="SD4-data"><object-id pub-id-type="doi">10.7554/eLife.14552.015</object-id>
<label>Supplementary file 1.</label>
<caption><title>Sample information.</title>
<p>Summary of information available for 449 CTVT tumours and 338 hosts sequenced in this study. Includes data on location, year of collection, CTVT mtDNA clade, tumour and host mtDNA haplotypes, breed, age and sex.</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.015">http://dx.doi.org/10.7554/eLife.14552.015</ext-link>
</p>
</caption>
<media mime-subtype="xlsx" mimetype="application" xlink:href="elife-14552-supp1.xlsx" orientation="portrait" id="d36e3648" position="anchor"></media>
</supplementary-material>
<supplementary-material content-type="local-data" id="SD5-data"><object-id pub-id-type="doi">10.7554/eLife.14552.016</object-id>
<label>Supplementary file 2.</label>
<caption><title>Sequencing coverage and tumour cell fraction.</title>
<p>(<bold>A</bold>
) Average per-base coverage for whole genome (CanFam3.1) and for mtDNA genome (CanFam3.1; NC_002008). (<bold>B</bold>
) List of 11 CTVT hosts with low coverage mtDNA regions. (<bold>C</bold>
) Estimated tumour cell fraction for 449 CTVT tumours; tumour cell fraction was estimated by calculating the average VAF for variant substitutions present in tumour but not in matched host for each tumour.</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.016">http://dx.doi.org/10.7554/eLife.14552.016</ext-link>
</p>
</caption>
<media mime-subtype="xlsx" mimetype="application" xlink:href="elife-14552-supp2.xlsx" orientation="portrait" id="d36e3674" position="anchor"></media>
</supplementary-material>
<supplementary-material content-type="local-data" id="SD6-data"><object-id pub-id-type="doi">10.7554/eLife.14552.017</object-id>
<label>Supplementary file 3.</label>
<caption><title>Confirmation of CTVT diagnosis.</title>
<p>Quantitative PCR (qPCR) was performed for <italic>LINE-MYC,</italic>
a CTVT-specific rearrangement (Katzir et al., 1985; Katzir et al., 1987). Each reaction was performed in triplicate and a standard curve was used to detect relative DNA input at each locus. 'Normalised input' represents the relative <italic>LINE-MYC</italic>
input detected in each sample normalised to <italic>ACTB</italic>
('Confirmation of canine transmissible venereal tumour (CTVT) diagnosis', Materials and methods). In general, we consider normalised input >0.05 as indicative of presence of <italic>LINE-MYC.</italic>
Sufficient DNA was not available for samples 1380T and 1381T; diagnosis in these cases was performed with histopathology. *2T was grown as a xenograft.</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.017">http://dx.doi.org/10.7554/eLife.14552.017</ext-link>
</p>
</caption>
<media mime-subtype="xlsx" mimetype="application" xlink:href="elife-14552-supp3.xlsx" orientation="portrait" id="d36e3703" position="anchor"></media>
</supplementary-material>
<supplementary-material content-type="local-data" id="SD7-data"><object-id pub-id-type="doi">10.7554/eLife.14552.018</object-id>
<label>Supplementary file 4.</label>
<caption><title>Single point substitution variant lists.</title>
<p>(<bold>A</bold>
) Total number of substitution variants (n = 1005) identified in 449 CTVT tumours. (<bold>B</bold>
) CTVT tumour somatic substitutions list (n = 928), including the average VAF value normalised for host contamination (see Materials and methods 'Classification of tumour substitutions'). Back mutations are not included on the list. (<bold>C</bold>
) CTVT tumour conservative somatic substitutions list (n = 835), including the average VAF value normalised for host contamination (see Materials and methods 'Classification of tumour substitutions'). Back mutations are not included on the list. (<bold>D</bold>
) Germline clade defining substitutions lists. Substitutions present in the pool of host substitutions and also shared between all samples within a clade (see Materials and methods 'Classification of tumour substitutions'). (<bold>E</bold>
) Potential somatic substitutions lists. Substitutions not present in the pool of host substitutions, but shared between all samples within a clade (see Materials and methods 'Classification on tumour substitutions'). (<bold>F</bold>
) Total number of substitution variants (n = 1152) identified in 338 CTVT host samples and 252 publicly available dog mitochondrial genomes (see <xref ref-type="supplementary-material" rid="SD11-data">Supplementary file 8</xref>
).</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.018">http://dx.doi.org/10.7554/eLife.14552.018</ext-link>
</p>
</caption>
<media mime-subtype="xlsx" mimetype="application" xlink:href="elife-14552-supp4.xlsx" orientation="portrait" id="d36e3742" position="anchor"></media>
</supplementary-material>
<supplementary-material content-type="local-data" id="SD8-data"><object-id pub-id-type="doi">10.7554/eLife.14552.019</object-id>
<label>Supplementary file 5.</label>
<caption><title>Summary of small insertions and deletions (indels).</title>
<p>(<bold>A</bold>
) Total number of insertions and deletions identified in tumours (n = 27), including the average VAF value normalised for host contamination (see Materials and methods) (<bold>B</bold>
) Total number of homoplasmic insertions and deletions in CTVT hosts (n = 7), including the average VAF value (see Materials and methods).</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.019">http://dx.doi.org/10.7554/eLife.14552.019</ext-link>
</p>
</caption>
<media mime-subtype="xlsx" mimetype="application" xlink:href="elife-14552-supp5.xlsx" orientation="portrait" id="d36e3765" position="anchor"></media>
</supplementary-material>
<supplementary-material content-type="local-data" id="SD9-data"><object-id pub-id-type="doi">10.7554/eLife.14552.020</object-id>
<label>Supplementary file 6.</label>
<caption><title>Annotation of single point substitutions.</title>
<p>Annotation of individual point substitution mutations in (<bold>A</bold>
) 449 CTVT tumours (see list <xref ref-type="supplementary-material" rid="SD7-data">Supplementary file 4A</xref>
, excluding back mutations) and (<bold>B</bold>
) 338 CTVT hosts (see list <xref ref-type="supplementary-material" rid="SD7-data">Supplementary file 4F</xref>
). Annotation was performed using Variant Effect Predictor (McLaren et al., 2010). In cases where a single substitution affects two different genes, the two annotations are shown on different lines.</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.020">http://dx.doi.org/10.7554/eLife.14552.020</ext-link>
</p>
</caption>
<media mime-subtype="xlsx" mimetype="application" xlink:href="elife-14552-supp6.xlsx" orientation="portrait" id="d36e3794" position="anchor"></media>
</supplementary-material>
<supplementary-material content-type="local-data" id="SD10-data"><object-id pub-id-type="doi">10.7554/eLife.14552.021</object-id>
<label>Supplementary file 7.</label>
<caption><title>Annotation of insertions and deletions (indels).</title>
<p>Annotation of individual indels (<bold>A</bold>
) unique to CTVT tumours and (<bold>B</bold>
) homoplasmic in CTVT hosts. Annotation was performed using Variant Effect Predictor (McLaren et al., 2010).</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.021">http://dx.doi.org/10.7554/eLife.14552.021</ext-link>
</p>
</caption>
<media mime-subtype="xlsx" mimetype="application" xlink:href="elife-14552-supp7.xlsx" orientation="portrait" id="d36e3817" position="anchor"></media>
</supplementary-material>
<supplementary-material content-type="local-data" id="SD11-data"><object-id pub-id-type="doi">10.7554/eLife.14552.022</object-id>
<label>Supplementary file 8.</label>
<caption><title>Publicly available mitochondrial dog genomes used in the study.</title>
<p>Summary of Genbank accession numbers and metadata for 252 publicly available dog mitochondrial genomes included in this study (see Materials and methods 'Extracting substitution variants from publicly available dog sequences' and <xref ref-type="supplementary-material" rid="SD7-data">Supplementary file 4F</xref>
).</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.022">http://dx.doi.org/10.7554/eLife.14552.022</ext-link>
</p>
</caption>
<media mime-subtype="xlsx" mimetype="application" xlink:href="elife-14552-supp8.xlsx" orientation="portrait" id="d36e3837" position="anchor"></media>
</supplementary-material>
<supplementary-material content-type="local-data" id="SD12-data"><object-id pub-id-type="doi">10.7554/eLife.14552.023</object-id>
<label>Supplementary file 9.</label>
<caption><title>Timing analysis.</title>
<p>Methods used to estimate the time since the origin of CTVT clades 1 to 5. Potential somatic substitutions (see Materials and methods 'Classification of tumour substitutions' and <xref ref-type="supplementary-material" rid="SD7-data">Supplementary file 4E</xref>
) are those which are shared between all tumours within a clade, but that are not found in the normal dog population; thus we cannot confirm their germline or early somatic status. The upper panel lists time estimates (years before present for the origin of each clade) assuming potential somatic substitutions are somatic and arose after mtDNA horizontal transfer; the lower panel lists time estimates (years before present for the origin of each clade) assuming potential somatic substitutions are germline and were originally present on the mtDNA haplotype that founded the clade.</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.023">http://dx.doi.org/10.7554/eLife.14552.023</ext-link>
</p>
</caption>
<media mime-subtype="xlsx" mimetype="application" xlink:href="elife-14552-supp9.xlsx" orientation="portrait" id="d36e3857" position="anchor"></media>
</supplementary-material>
<supplementary-material content-type="local-data" id="SD13-data"><object-id pub-id-type="doi">10.7554/eLife.14552.024</object-id>
<label>Supplementary file 10.</label>
<caption><title>Summary of back mutations.</title>
<p>List of back mutations attributable and non-attributable to a putative recombination event.</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.024">http://dx.doi.org/10.7554/eLife.14552.024</ext-link>
</p>
</caption>
<media mime-subtype="xlsx" mimetype="application" xlink:href="elife-14552-supp10.xlsx" orientation="portrait" id="d36e3874" position="anchor"></media>
</supplementary-material>
<supplementary-material content-type="local-data" id="SD14-data"><object-id pub-id-type="doi">10.7554/eLife.14552.025</object-id>
<label>Supplementary file 11.</label>
<caption><title>CTVT tumour and host mtDNA haplotype lists.</title>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.025">http://dx.doi.org/10.7554/eLife.14552.025</ext-link>
</p>
</caption>
<media mime-subtype="xlsx" mimetype="application" xlink:href="elife-14552-supp11.xlsx" orientation="portrait" id="d36e3890" position="anchor"></media>
</supplementary-material>
<supplementary-material content-type="local-data" id="SD15-data"><object-id pub-id-type="doi">10.7554/eLife.14552.026</object-id>
<label>Supplementary file 12.</label>
<caption><title>Substitutions with corresponding VAF (before normalisation) for each of 449 CTVT tumours and 338 CTVT hosts.</title>
<p><xref ref-type="supplementary-material" rid="SD5-data">Supplementary file 12</xref>
is included as accompanying zip file.</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.026">http://dx.doi.org/10.7554/eLife.14552.026</ext-link>
</p>
</caption>
<media mime-subtype="zip" mimetype="application" xlink:href="elife-14552-supp12.zip" orientation="portrait" id="d36e3909" position="anchor"></media>
</supplementary-material>
<supplementary-material content-type="local-data" id="SD16-data"><object-id pub-id-type="doi">10.7554/eLife.14552.027</object-id>
<label>Supplementary file 13.</label>
<caption><title>Indels with corresponding VAF (before normalisation) for each of 438 CTVT tumours and 334 CTVT hosts.</title>
<p>Samples with very high coverage of the mitochondrial genome were excluded from the indel analysis (see Materials and methods 'Indel calling-Extraction and filtering'). <xref ref-type="supplementary-material" rid="SD6-data">Supplementary file 13</xref>
is included as accompanying zip file.</p>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.027">http://dx.doi.org/10.7554/eLife.14552.027</ext-link>
</p>
</caption>
<media mime-subtype="zip" mimetype="application" xlink:href="elife-14552-supp13.zip" orientation="portrait" id="d36e3929" position="anchor"></media>
</supplementary-material>
<sec id="s6" sec-type="datasets"><title>Major datasets</title>
<p>The following datasets were generated:</p>
<p><related-object content-type="generated-dataset" id="data-ro1" source-id="http://www.ncbi.nlm.nih.gov/genbank/KU290400" source-id-type="uri"><collab>Strakova et al</collab>
<x xml:space="preserve">,</x>
<year>2016</year>
<x xml:space="preserve">,</x>
<source>Mitochondrial genetic diversity, selection and recombination in a canine transmissible cancer</source>
<x xml:space="preserve">,</x>
<ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov/genbank/KU290400">http://www.ncbi.nlm.nih.gov/genbank/KU290400</ext-link>
<x xml:space="preserve">,</x>
<comment>Publicly available at Genbank (accession no: KU290400 - KU291095)</comment>
</related-object>
</p>
<p><related-object content-type="generated-dataset" id="data-ro2" source-id="http://www.ebi.ac.uk/ena/ERP014691" source-id-type="uri"><collab>Strakova et al</collab>
<x xml:space="preserve">,</x>
<year>2016</year>
<x xml:space="preserve">,</x>
<source>Canine transmissible venereal tumour (CTVT) mitochondria</source>
<x xml:space="preserve">,</x>
<ext-link ext-link-type="uri" xlink:href="http://www.ebi.ac.uk/ena/ERP014691">http://www.ebi.ac.uk/ena/ERP014691</ext-link>
<x xml:space="preserve">,</x>
<comment>Publicly available at European Nucleotide Archive (accession no: ERP014691)</comment>
</related-object>
</p>
</sec>
</sec>
<ref-list><title>References</title>
<ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Alexandrov</surname>
<given-names>LB</given-names>
</name>
<name><surname>Nik-Zainal</surname>
<given-names>S</given-names>
</name>
<name><surname>Wedge</surname>
<given-names>DC</given-names>
</name>
<name><surname>Aparicio</surname>
<given-names>SA</given-names>
</name>
<name><surname>Behjati</surname>
<given-names>S</given-names>
</name>
<name><surname>Biankin</surname>
<given-names>AV</given-names>
</name>
<name><surname>Bignell</surname>
<given-names>GR</given-names>
</name>
<name><surname>Bolli</surname>
<given-names>N</given-names>
</name>
<name><surname>Borg</surname>
<given-names>A</given-names>
</name>
<name><surname>Børresen-Dale</surname>
<given-names>AL</given-names>
</name>
<name><surname>Boyault</surname>
<given-names>S</given-names>
</name>
<name><surname>Burkhardt</surname>
<given-names>B</given-names>
</name>
<name><surname>Butler</surname>
<given-names>AP</given-names>
</name>
<name><surname>Caldas</surname>
<given-names>C</given-names>
</name>
<name><surname>Davies</surname>
<given-names>HR</given-names>
</name>
<name><surname>Desmedt</surname>
<given-names>C</given-names>
</name>
<name><surname>Eils</surname>
<given-names>R</given-names>
</name>
<name><surname>Eyfjörd</surname>
<given-names>JE</given-names>
</name>
<name><surname>Foekens</surname>
<given-names>JA</given-names>
</name>
<name><surname>Greaves</surname>
<given-names>M</given-names>
</name>
<name><surname>Hosoda</surname>
<given-names>F</given-names>
</name>
<name><surname>Hutter</surname>
<given-names>B</given-names>
</name>
<name><surname>Ilicic</surname>
<given-names>T</given-names>
</name>
<name><surname>Imbeaud</surname>
<given-names>S</given-names>
</name>
<name><surname>Imielinski</surname>
<given-names>M</given-names>
</name>
<name><surname>Imielinsk</surname>
<given-names>M</given-names>
</name>
<name><surname>Jäger</surname>
<given-names>N</given-names>
</name>
<name><surname>Jones</surname>
<given-names>DT</given-names>
</name>
<name><surname>Jones</surname>
<given-names>D</given-names>
</name>
<name><surname>Knappskog</surname>
<given-names>S</given-names>
</name>
<name><surname>Kool</surname>
<given-names>M</given-names>
</name>
<name><surname>Lakhani</surname>
<given-names>SR</given-names>
</name>
<name><surname>López-Otín</surname>
<given-names>C</given-names>
</name>
<name><surname>Martin</surname>
<given-names>S</given-names>
</name>
<name><surname>Munshi</surname>
<given-names>NC</given-names>
</name>
<name><surname>Nakamura</surname>
<given-names>H</given-names>
</name>
<name><surname>Northcott</surname>
<given-names>PA</given-names>
</name>
<name><surname>Pajic</surname>
<given-names>M</given-names>
</name>
<name><surname>Papaemmanuil</surname>
<given-names>E</given-names>
</name>
<name><surname>Paradiso</surname>
<given-names>A</given-names>
</name>
<name><surname>Pearson</surname>
<given-names>JV</given-names>
</name>
<name><surname>Puente</surname>
<given-names>XS</given-names>
</name>
<name><surname>Raine</surname>
<given-names>K</given-names>
</name>
<name><surname>Ramakrishna</surname>
<given-names>M</given-names>
</name>
<name><surname>Richardson</surname>
<given-names>AL</given-names>
</name>
<name><surname>Richter</surname>
<given-names>J</given-names>
</name>
<name><surname>Rosenstiel</surname>
<given-names>P</given-names>
</name>
<name><surname>Schlesner</surname>
<given-names>M</given-names>
</name>
<name><surname>Schumacher</surname>
<given-names>TN</given-names>
</name>
<name><surname>Span</surname>
<given-names>PN</given-names>
</name>
<name><surname>Teague</surname>
<given-names>JW</given-names>
</name>
<name><surname>Totoki</surname>
<given-names>Y</given-names>
</name>
<name><surname>Tutt</surname>
<given-names>AN</given-names>
</name>
<name><surname>Valdés-Mas</surname>
<given-names>R</given-names>
</name>
<name><surname>van Buuren</surname>
<given-names>MM</given-names>
</name>
<name><surname>van 't Veer</surname>
<given-names>L</given-names>
</name>
<name><surname>Vincent-Salomon</surname>
<given-names>A</given-names>
</name>
<name><surname>Waddell</surname>
<given-names>N</given-names>
</name>
<name><surname>Yates</surname>
<given-names>LR</given-names>
</name>
<name><surname>Zucman-Rossi</surname>
<given-names>J</given-names>
</name>
<name><surname>Futreal</surname>
<given-names>PA</given-names>
</name>
<name><surname>McDermott</surname>
<given-names>U</given-names>
</name>
<name><surname>Lichter</surname>
<given-names>P</given-names>
</name>
<name><surname>Meyerson</surname>
<given-names>M</given-names>
</name>
<name><surname>Grimmond</surname>
<given-names>SM</given-names>
</name>
<name><surname>Siebert</surname>
<given-names>R</given-names>
</name>
<name><surname>Campo</surname>
<given-names>E</given-names>
</name>
<name><surname>Shibata</surname>
<given-names>T</given-names>
</name>
<name><surname>Pfister</surname>
<given-names>SM</given-names>
</name>
<name><surname>Campbell</surname>
<given-names>PJ</given-names>
</name>
<name><surname>Stratton</surname>
<given-names>MR</given-names>
</name>
<collab>Australian Pancreatic Cancer Genome Initiative,</collab>
<collab>ICGC Breast Cancer Consortium</collab>
<collab>ICGC MMML-Seq Consortium</collab>
<collab>ICGC PedBrain</collab>
</person-group>
<year>2013</year>
<article-title>Signatures of mutational processes in human cancer</article-title>
<source>Nature</source>
<volume>500</volume>
<fpage>415</fpage>
<lpage>421</lpage>
<pub-id pub-id-type="doi">10.1038/nature12477</pub-id>
<pub-id pub-id-type="pmid">23945592</pub-id>
</element-citation>
</ref>
<ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bergthorsson</surname>
<given-names>U</given-names>
</name>
<name><surname>Adams</surname>
<given-names>KL</given-names>
</name>
<name><surname>Thomason</surname>
<given-names>B</given-names>
</name>
<name><surname>Palmer</surname>
<given-names>JD</given-names>
</name>
</person-group>
<year>2003</year>
<article-title>Widespread horizontal transfer of mitochondrial genes in flowering plants</article-title>
<source>Nature</source>
<volume>424</volume>
<fpage>197</fpage>
<lpage>201</lpage>
<pub-id pub-id-type="doi">10.1038/nature01743</pub-id>
<pub-id pub-id-type="pmid">12853958</pub-id>
</element-citation>
</ref>
<ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Boni</surname>
<given-names>MF</given-names>
</name>
<name><surname>Posada</surname>
<given-names>D</given-names>
</name>
<name><surname>Feldman</surname>
<given-names>MW</given-names>
</name>
</person-group>
<year>2007</year>
<article-title>An exact nonparametric method for inferring mosaic structure in sequence triplets</article-title>
<source>Genetics</source>
<volume>176</volume>
<fpage>1035</fpage>
<lpage>1047</lpage>
<pub-id pub-id-type="doi">10.1534/genetics.106.068874</pub-id>
<pub-id pub-id-type="pmid">17409078</pub-id>
</element-citation>
</ref>
<ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cohen</surname>
<given-names>D</given-names>
</name>
<name><surname>Steel</surname>
<given-names>GG</given-names>
</name>
</person-group>
<year>1972</year>
<article-title>Thymidine labelling studies in a transmissible venereal tumour of the dog</article-title>
<source>British Journal of Cancer</source>
<volume>26</volume>
<fpage>413</fpage>
<lpage>419</lpage>
<pub-id pub-id-type="doi">10.1038/bjc.1972.54</pub-id>
<pub-id pub-id-type="pmid">5085680</pub-id>
</element-citation>
</ref>
<ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Coupland</surname>
<given-names>P</given-names>
</name>
<name><surname>Chandra</surname>
<given-names>T</given-names>
</name>
<name><surname>Quail</surname>
<given-names>M</given-names>
</name>
<name><surname>Reik</surname>
<given-names>W</given-names>
</name>
<name><surname>Swerdlow</surname>
<given-names>H</given-names>
</name>
</person-group>
<year>2012</year>
<article-title>Direct sequencing of small genomes on the pacific biosciences RS without library preparation</article-title>
<source>BioTechniques</source>
<volume>53</volume>
<fpage>365</fpage>
<lpage>372</lpage>
<pub-id pub-id-type="doi">10.2144/000113962</pub-id>
<pub-id pub-id-type="pmid">23227987</pub-id>
</element-citation>
</ref>
<ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Darriba</surname>
<given-names>D</given-names>
</name>
<name><surname>Taboada</surname>
<given-names>GL</given-names>
</name>
<name><surname>Doallo</surname>
<given-names>R</given-names>
</name>
<name><surname>Posada</surname>
<given-names>D</given-names>
</name>
</person-group>
<year>2012</year>
<article-title>jModelTest 2: More models, new heuristics and parallel computing</article-title>
<source>Nature Methods</source>
<volume>9</volume>
<fpage>772</fpage>
<pub-id pub-id-type="doi">10.1038/nmeth.2109</pub-id>
<pub-id pub-id-type="pmid">22847109</pub-id>
</element-citation>
</ref>
<ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Decker</surname>
<given-names>B</given-names>
</name>
<name><surname>Davis</surname>
<given-names>BW</given-names>
</name>
<name><surname>Rimbault</surname>
<given-names>M</given-names>
</name>
<name><surname>Long</surname>
<given-names>AH</given-names>
</name>
<name><surname>Karlins</surname>
<given-names>E</given-names>
</name>
<name><surname>Jagannathan</surname>
<given-names>V</given-names>
</name>
<name><surname>Reiman</surname>
<given-names>R</given-names>
</name>
<name><surname>Parker</surname>
<given-names>HG</given-names>
</name>
<name><surname>Drögemüller</surname>
<given-names>C</given-names>
</name>
<name><surname>Corneveaux</surname>
<given-names>JJ</given-names>
</name>
<name><surname>Chapman</surname>
<given-names>ES</given-names>
</name>
<name><surname>Trent</surname>
<given-names>JM</given-names>
</name>
<name><surname>Leeb</surname>
<given-names>T</given-names>
</name>
<name><surname>Huentelman</surname>
<given-names>MJ</given-names>
</name>
<name><surname>Wayne</surname>
<given-names>RK</given-names>
</name>
<name><surname>Karyadi</surname>
<given-names>DM</given-names>
</name>
<name><surname>Ostrander</surname>
<given-names>EA</given-names>
</name>
</person-group>
<year>2015</year>
<article-title>Comparison against 186 canid whole-genome sequences reveals survival strategies of an ancient clonally transmissible canine tumor</article-title>
<source>Genome Research</source>
<volume>25</volume>
<fpage>1646</fpage>
<lpage>1655</lpage>
<pub-id pub-id-type="doi">10.1101/gr.190314.115</pub-id>
<pub-id pub-id-type="pmid">26232412</pub-id>
</element-citation>
</ref>
<ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fregel</surname>
<given-names>R</given-names>
</name>
<name><surname>Suárez</surname>
<given-names>NM</given-names>
</name>
<name><surname>Betancor</surname>
<given-names>E</given-names>
</name>
<name><surname>González</surname>
<given-names>AM</given-names>
</name>
<name><surname>Cabrera</surname>
<given-names>VM</given-names>
</name>
<name><surname>Pestano</surname>
<given-names>J</given-names>
</name>
</person-group>
<year>2015</year>
<article-title>Mitochondrial DNA haplogroup phylogeny of the dog: Proposal for a cladistic nomenclature</article-title>
<source>Mitochondrion</source>
<volume>22</volume>
<fpage>75</fpage>
<lpage>84</lpage>
<pub-id pub-id-type="doi">10.1016/j.mito.2015.04.001</pub-id>
<pub-id pub-id-type="pmid">25869968</pub-id>
</element-citation>
</ref>
<ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gantenbein</surname>
<given-names>B</given-names>
</name>
<name><surname>Fet</surname>
<given-names>V</given-names>
</name>
<name><surname>Gantenbein-Ritter</surname>
<given-names>IA</given-names>
</name>
<name><surname>Balloux</surname>
<given-names>F</given-names>
</name>
</person-group>
<year>2005</year>
<article-title>Evidence for recombination in scorpion mitochondrial DNA (Scorpiones: Buthidae)</article-title>
<source>Proceedings. Biological Sciences / the Royal Society</source>
<volume>272</volume>
<fpage>697</fpage>
<lpage>704</lpage>
<pub-id pub-id-type="doi">10.1098/rspb.2004.3017</pub-id>
<pub-id pub-id-type="pmid">15870032</pub-id>
</element-citation>
</ref>
<ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gibbs</surname>
<given-names>MJ</given-names>
</name>
<name><surname>Armstrong</surname>
<given-names>JS</given-names>
</name>
<name><surname>Gibbs</surname>
<given-names>AJ</given-names>
</name>
</person-group>
<year>2000</year>
<article-title>Sister-scanning: A monte carlo procedure for assessing signals in recombinant sequences</article-title>
<source>Bioinformatics</source>
<volume>16</volume>
<fpage>573</fpage>
<lpage>582</lpage>
<pub-id pub-id-type="doi">10.1093/bioinformatics/16.7.573</pub-id>
<pub-id pub-id-type="pmid">11038328</pub-id>
</element-citation>
</ref>
<ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Guindon</surname>
<given-names>S</given-names>
</name>
<name><surname>Dufayard</surname>
<given-names>JF</given-names>
</name>
<name><surname>Lefort</surname>
<given-names>V</given-names>
</name>
<name><surname>Anisimova</surname>
<given-names>M</given-names>
</name>
<name><surname>Hordijk</surname>
<given-names>W</given-names>
</name>
<name><surname>Gascuel</surname>
<given-names>O</given-names>
</name>
</person-group>
<year>2010</year>
<article-title>New algorithms and methods to estimate maximum-likelihood phylogenies: Assessing the performance of phyml 3.0</article-title>
<source>Systematic Biology</source>
<volume>59</volume>
<fpage>307</fpage>
<lpage>321</lpage>
<pub-id pub-id-type="doi">10.1093/sysbio/syq010</pub-id>
<pub-id pub-id-type="pmid">20525638</pub-id>
</element-citation>
</ref>
<ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hoarau</surname>
<given-names>G</given-names>
</name>
<name><surname>Holla</surname>
<given-names>S</given-names>
</name>
<name><surname>Lescasse</surname>
<given-names>R</given-names>
</name>
<name><surname>Stam</surname>
<given-names>WT</given-names>
</name>
<name><surname>Olsen</surname>
<given-names>JL</given-names>
</name>
</person-group>
<year>2002</year>
<article-title>Heteroplasmy and evidence for recombination in the mitochondrial control region of the flatfish platichthys flesus</article-title>
<source>Molecular Biology and Evolution</source>
<volume>19</volume>
<fpage>2261</fpage>
<lpage>2264</lpage>
<pub-id pub-id-type="doi">10.1093/oxfordjournals.molbev.a004049</pub-id>
<pub-id pub-id-type="pmid">12446816</pub-id>
</element-citation>
</ref>
<ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hordijk</surname>
<given-names>W</given-names>
</name>
<name><surname>Gascuel</surname>
<given-names>O</given-names>
</name>
</person-group>
<year>2005</year>
<article-title>Improving the efficiency of SPR moves in phylogenetic tree search methods based on maximum likelihood</article-title>
<source>Bioinformatics</source>
<volume>21</volume>
<fpage>4338</fpage>
<lpage>4347</lpage>
<pub-id pub-id-type="doi">10.1093/bioinformatics/bti713</pub-id>
<pub-id pub-id-type="pmid">16234323</pub-id>
</element-citation>
</ref>
<ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Huson</surname>
<given-names>DH</given-names>
</name>
<name><surname>Scornavacca</surname>
<given-names>C</given-names>
</name>
</person-group>
<year>2012</year>
<article-title>Dendroscope 3: An interactive tool for rooted phylogenetic trees and networks</article-title>
<source>Systematic Biology</source>
<volume>61</volume>
<pub-id pub-id-type="doi">10.1093/sysbio/sys062</pub-id>
</element-citation>
</ref>
<ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ju</surname>
<given-names>YS</given-names>
</name>
<name><surname>Alexandrov</surname>
<given-names>LB</given-names>
</name>
<name><surname>Gerstung</surname>
<given-names>M</given-names>
</name>
<name><surname>Martincorena</surname>
<given-names>I</given-names>
</name>
<name><surname>Nik-Zainal</surname>
<given-names>S</given-names>
</name>
<name><surname>Ramakrishna</surname>
<given-names>M</given-names>
</name>
<name><surname>Davies</surname>
<given-names>HR</given-names>
</name>
<name><surname>Papaemmanuil</surname>
<given-names>E</given-names>
</name>
<name><surname>Gundem</surname>
<given-names>G</given-names>
</name>
<name><surname>Shlien</surname>
<given-names>A</given-names>
</name>
<name><surname>Bolli</surname>
<given-names>N</given-names>
</name>
<name><surname>Behjati</surname>
<given-names>S</given-names>
</name>
<name><surname>Tarpey</surname>
<given-names>PS</given-names>
</name>
<name><surname>Nangalia</surname>
<given-names>J</given-names>
</name>
<name><surname>Massie</surname>
<given-names>CE</given-names>
</name>
<name><surname>Butler</surname>
<given-names>AP</given-names>
</name>
<name><surname>Teague</surname>
<given-names>JW</given-names>
</name>
<name><surname>Vassiliou</surname>
<given-names>GS</given-names>
</name>
<name><surname>Green</surname>
<given-names>AR</given-names>
</name>
<name><surname>Du</surname>
<given-names>M-Q</given-names>
</name>
<name><surname>Unnikrishnan</surname>
<given-names>A</given-names>
</name>
<name><surname>Pimanda</surname>
<given-names>JE</given-names>
</name>
<name><surname>Teh</surname>
<given-names>BT</given-names>
</name>
<name><surname>Munshi</surname>
<given-names>N</given-names>
</name>
<name><surname>Greaves</surname>
<given-names>M</given-names>
</name>
<name><surname>Vyas</surname>
<given-names>P</given-names>
</name>
<name><surname>El-Naggar</surname>
<given-names>AK</given-names>
</name>
<name><surname>Santarius</surname>
<given-names>T</given-names>
</name>
<name><surname>Collins</surname>
<given-names>VP</given-names>
</name>
<name><surname>Grundy</surname>
<given-names>R</given-names>
</name>
<name><surname>Taylor</surname>
<given-names>JA</given-names>
</name>
<name><surname>Hayes</surname>
<given-names>DN</given-names>
</name>
<name><surname>Malkin</surname>
<given-names>D</given-names>
</name>
<name><surname>Foster</surname>
<given-names>CS</given-names>
</name>
<name><surname>Warren</surname>
<given-names>AY</given-names>
</name>
<name><surname>Whitaker</surname>
<given-names>HC</given-names>
</name>
<name><surname>Brewer</surname>
<given-names>D</given-names>
</name>
<name><surname>Eeles</surname>
<given-names>R</given-names>
</name>
<name><surname>Cooper</surname>
<given-names>C</given-names>
</name>
<name><surname>Neal</surname>
<given-names>D</given-names>
</name>
<name><surname>Visakorpi</surname>
<given-names>T</given-names>
</name>
<name><surname>Isaacs</surname>
<given-names>WB</given-names>
</name>
<name><surname>Bova</surname>
<given-names>GS</given-names>
</name>
<name><surname>Flanagan</surname>
<given-names>AM</given-names>
</name>
<name><surname>Futreal</surname>
<given-names>PA</given-names>
</name>
<name><surname>Lynch</surname>
<given-names>AG</given-names>
</name>
<name><surname>Chinnery</surname>
<given-names>PF</given-names>
</name>
<name><surname>McDermott</surname>
<given-names>U</given-names>
</name>
<name><surname>Stratton</surname>
<given-names>MR</given-names>
</name>
<name><surname>Campbell</surname>
<given-names>PJ</given-names>
</name>
</person-group>
<year>2014</year>
<article-title>Origins and functional consequences of somatic mitochondrial DNA mutations in human cancer</article-title>
<source>eLife</source>
<volume>3</volume>
<pub-id pub-id-type="doi">10.7554/eLife.02935</pub-id>
</element-citation>
</ref>
<ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ju</surname>
<given-names>YS</given-names>
</name>
<name><surname>Tubio</surname>
<given-names>JM</given-names>
</name>
<name><surname>Mifsud</surname>
<given-names>W</given-names>
</name>
<name><surname>Fu</surname>
<given-names>B</given-names>
</name>
<name><surname>Davies</surname>
<given-names>HR</given-names>
</name>
<name><surname>Ramakrishna</surname>
<given-names>M</given-names>
</name>
<name><surname>Li</surname>
<given-names>Y</given-names>
</name>
<name><surname>Yates</surname>
<given-names>L</given-names>
</name>
<name><surname>Gundem</surname>
<given-names>G</given-names>
</name>
<name><surname>Tarpey</surname>
<given-names>PS</given-names>
</name>
<name><surname>Behjati</surname>
<given-names>S</given-names>
</name>
<name><surname>Papaemmanuil</surname>
<given-names>E</given-names>
</name>
<name><surname>Martin</surname>
<given-names>S</given-names>
</name>
<name><surname>Fullam</surname>
<given-names>A</given-names>
</name>
<name><surname>Gerstung</surname>
<given-names>M</given-names>
</name>
<name><surname>Nangalia</surname>
<given-names>J</given-names>
</name>
<name><surname>Green</surname>
<given-names>AR</given-names>
</name>
<name><surname>Caldas</surname>
<given-names>C</given-names>
</name>
<name><surname>Borg</surname>
<given-names>Å</given-names>
</name>
<name><surname>Tutt</surname>
<given-names>A</given-names>
</name>
<name><surname>Lee</surname>
<given-names>MT</given-names>
</name>
<name><surname>van't Veer</surname>
<given-names>LJ</given-names>
</name>
<name><surname>Tan</surname>
<given-names>BK</given-names>
</name>
<name><surname>Aparicio</surname>
<given-names>S</given-names>
</name>
<name><surname>Span</surname>
<given-names>PN</given-names>
</name>
<name><surname>Martens</surname>
<given-names>JW</given-names>
</name>
<name><surname>Knappskog</surname>
<given-names>S</given-names>
</name>
<name><surname>Vincent-Salomon</surname>
<given-names>A</given-names>
</name>
<name><surname>Børresen-Dale</surname>
<given-names>AL</given-names>
</name>
<name><surname>Eyfjörd</surname>
<given-names>JE</given-names>
</name>
<name><surname>Flanagan</surname>
<given-names>AM</given-names>
</name>
<name><surname>Foster</surname>
<given-names>C</given-names>
</name>
<name><surname>Neal</surname>
<given-names>DE</given-names>
</name>
<name><surname>Cooper</surname>
<given-names>C</given-names>
</name>
<name><surname>Eeles</surname>
<given-names>R</given-names>
</name>
<name><surname>Lakhani</surname>
<given-names>SR</given-names>
</name>
<name><surname>Desmedt</surname>
<given-names>C</given-names>
</name>
<name><surname>Thomas</surname>
<given-names>G</given-names>
</name>
<name><surname>Richardson</surname>
<given-names>AL</given-names>
</name>
<name><surname>Purdie</surname>
<given-names>CA</given-names>
</name>
<name><surname>Thompson</surname>
<given-names>AM</given-names>
</name>
<name><surname>McDermott</surname>
<given-names>U</given-names>
</name>
<name><surname>Yang</surname>
<given-names>F</given-names>
</name>
<name><surname>Nik-Zainal</surname>
<given-names>S</given-names>
</name>
<name><surname>Campbell</surname>
<given-names>PJ</given-names>
</name>
<name><surname>Stratton</surname>
<given-names>MR</given-names>
</name>
<collab>ICGC Prostate Cancer Working Group,</collab>
<collab>ICGC Bone Cancer Working Group</collab>
<collab>ICGC Breast Cancer Working Group</collab>
</person-group>
<year>2015</year>
<article-title>Frequent somatic transfer of mitochondrial DNA into the nuclear genome of human cancer cells</article-title>
<source>Genome Research</source>
<volume>25</volume>
<fpage>814</fpage>
<lpage>824</lpage>
<pub-id pub-id-type="doi">10.1101/gr.190470.115</pub-id>
<pub-id pub-id-type="pmid">25963125</pub-id>
</element-citation>
</ref>
<ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Katzir</surname>
<given-names>N</given-names>
</name>
<name><surname>Rechavi</surname>
<given-names>G</given-names>
</name>
<name><surname>Cohen</surname>
<given-names>JB</given-names>
</name>
<name><surname>Unger</surname>
<given-names>T</given-names>
</name>
<name><surname>Simoni</surname>
<given-names>F</given-names>
</name>
<name><surname>Segal</surname>
<given-names>S</given-names>
</name>
<name><surname>Cohen</surname>
<given-names>D</given-names>
</name>
<name><surname>Givol</surname>
<given-names>D</given-names>
</name>
</person-group>
<year>1985</year>
<article-title>"Retroposon" insertion into the cellular oncogene c-myc in canine transmissible venereal tumor</article-title>
<source>Proceedings of the National Academy of Sciences of the United States of America</source>
<volume>82</volume>
<fpage>1054</fpage>
<lpage>1058</lpage>
<pub-id pub-id-type="doi">10.1073/pnas.82.4.1054</pub-id>
<pub-id pub-id-type="pmid">2983328</pub-id>
</element-citation>
</ref>
<ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Katzir</surname>
<given-names>N</given-names>
</name>
<name><surname>Arman</surname>
<given-names>E</given-names>
</name>
<name><surname>Cohen</surname>
<given-names>D</given-names>
</name>
<name><surname>Givol</surname>
<given-names>D</given-names>
</name>
<name><surname>Rechavi</surname>
<given-names>G</given-names>
</name>
</person-group>
<year>1987</year>
<article-title>Common origin of transmissible venereal tumors (TVT) in dogs</article-title>
<source>Oncogene</source>
<volume>1</volume>
<fpage>445</fpage>
<lpage>448</lpage>
<pub-id pub-id-type="pmid">3330787</pub-id>
</element-citation>
</ref>
<ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kraytsberg</surname>
<given-names>Y</given-names>
</name>
<name><surname>Schwartz</surname>
<given-names>M</given-names>
</name>
<name><surname>Brown</surname>
<given-names>TA</given-names>
</name>
<name><surname>Ebralidse</surname>
<given-names>K</given-names>
</name>
<name><surname>Kunz</surname>
<given-names>WS</given-names>
</name>
<name><surname>Clayton</surname>
<given-names>DA</given-names>
</name>
<name><surname>Vissing</surname>
<given-names>J</given-names>
</name>
<name><surname>Khrapko</surname>
<given-names>K</given-names>
</name>
</person-group>
<year>2004</year>
<article-title>Recombination of human mitochondrial DNA</article-title>
<source>Science</source>
<volume>304</volume>
<fpage>981</fpage>
<pub-id pub-id-type="doi">10.1126/science.1096342</pub-id>
<pub-id pub-id-type="pmid">15143273</pub-id>
</element-citation>
</ref>
<ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ladoukakis</surname>
<given-names>ED</given-names>
</name>
<name><surname>Zouros</surname>
<given-names>E</given-names>
</name>
</person-group>
<year>2001</year>
<article-title>Direct evidence for homologous recombination in mussel (mytilus galloprovincialis) mitochondrial DNA</article-title>
<source>Molecular Biology and Evolution</source>
<volume>18</volume>
<fpage>1168</fpage>
<lpage>1175</lpage>
<pub-id pub-id-type="doi">10.1093/oxfordjournals.molbev.a003904</pub-id>
<pub-id pub-id-type="pmid">11420358</pub-id>
</element-citation>
</ref>
<ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname>
<given-names>H</given-names>
</name>
</person-group>
<year>2011</year>
<article-title>A statistical framework for SNP calling, mutation discovery, association mapping and population genetical parameter estimation from sequencing data</article-title>
<source>Bioinformatics</source>
<volume>27</volume>
<fpage>2987</fpage>
<lpage>2993</lpage>
<pub-id pub-id-type="doi">10.1093/bioinformatics/btr509</pub-id>
<pub-id pub-id-type="pmid">21903627</pub-id>
</element-citation>
</ref>
<ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname>
<given-names>H</given-names>
</name>
<name><surname>Durbin</surname>
<given-names>R</given-names>
</name>
</person-group>
<year>2009</year>
<article-title>Fast and accurate short read alignment with burrows-wheeler transform</article-title>
<source>Bioinformatics</source>
<volume>25</volume>
<fpage>1754</fpage>
<lpage>1760</lpage>
<pub-id pub-id-type="doi">10.1093/bioinformatics/btp324</pub-id>
<pub-id pub-id-type="pmid">19451168</pub-id>
</element-citation>
</ref>
<ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname>
<given-names>H</given-names>
</name>
<name><surname>Handsaker</surname>
<given-names>B</given-names>
</name>
<name><surname>Wysoker</surname>
<given-names>A</given-names>
</name>
<name><surname>Fennell</surname>
<given-names>T</given-names>
</name>
<name><surname>Ruan</surname>
<given-names>J</given-names>
</name>
<name><surname>Homer</surname>
<given-names>N</given-names>
</name>
<name><surname>Marth</surname>
<given-names>G</given-names>
</name>
<name><surname>Abecasis</surname>
<given-names>G</given-names>
</name>
<name><surname>Durbin</surname>
<given-names>R</given-names>
</name>
<collab>1000 Genome Project Data Processing Subgroup</collab>
</person-group>
<year>2009</year>
<article-title>The sequence alignment/map format and samtools</article-title>
<source>Bioinformatics</source>
<volume>25</volume>
<fpage>2078</fpage>
<lpage>2079</lpage>
<pub-id pub-id-type="doi">10.1093/bioinformatics/btp352</pub-id>
<pub-id pub-id-type="pmid">19505943</pub-id>
</element-citation>
</ref>
<ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lindblad-Toh</surname>
<given-names>K</given-names>
</name>
<name><surname>Wade</surname>
<given-names>CM</given-names>
</name>
<name><surname>Mikkelsen</surname>
<given-names>TS</given-names>
</name>
<name><surname>Karlsson</surname>
<given-names>EK</given-names>
</name>
<name><surname>Jaffe</surname>
<given-names>DB</given-names>
</name>
<name><surname>Kamal</surname>
<given-names>M</given-names>
</name>
<name><surname>Clamp</surname>
<given-names>M</given-names>
</name>
<name><surname>Chang</surname>
<given-names>JL</given-names>
</name>
<name><surname>Kulbokas</surname>
<given-names>EJ</given-names>
</name>
<name><surname>Zody</surname>
<given-names>MC</given-names>
</name>
<name><surname>Mauceli</surname>
<given-names>E</given-names>
</name>
<name><surname>Xie</surname>
<given-names>X</given-names>
</name>
<name><surname>Breen</surname>
<given-names>M</given-names>
</name>
<name><surname>Wayne</surname>
<given-names>RK</given-names>
</name>
<name><surname>Ostrander</surname>
<given-names>EA</given-names>
</name>
<name><surname>Ponting</surname>
<given-names>CP</given-names>
</name>
<name><surname>Galibert</surname>
<given-names>F</given-names>
</name>
<name><surname>Smith</surname>
<given-names>DR</given-names>
</name>
<name><surname>DeJong</surname>
<given-names>PJ</given-names>
</name>
<name><surname>Kirkness</surname>
<given-names>E</given-names>
</name>
<name><surname>Alvarez</surname>
<given-names>P</given-names>
</name>
<name><surname>Biagi</surname>
<given-names>T</given-names>
</name>
<name><surname>Brockman</surname>
<given-names>W</given-names>
</name>
<name><surname>Butler</surname>
<given-names>J</given-names>
</name>
<name><surname>Chin</surname>
<given-names>CW</given-names>
</name>
<name><surname>Cook</surname>
<given-names>A</given-names>
</name>
<name><surname>Cuff</surname>
<given-names>J</given-names>
</name>
<name><surname>Daly</surname>
<given-names>MJ</given-names>
</name>
<name><surname>DeCaprio</surname>
<given-names>D</given-names>
</name>
<name><surname>Gnerre</surname>
<given-names>S</given-names>
</name>
<name><surname>Grabherr</surname>
<given-names>M</given-names>
</name>
<name><surname>Kellis</surname>
<given-names>M</given-names>
</name>
<name><surname>Kleber</surname>
<given-names>M</given-names>
</name>
<name><surname>Bardeleben</surname>
<given-names>C</given-names>
</name>
<name><surname>Goodstadt</surname>
<given-names>L</given-names>
</name>
<name><surname>Heger</surname>
<given-names>A</given-names>
</name>
<name><surname>Hitte</surname>
<given-names>C</given-names>
</name>
<name><surname>Kim</surname>
<given-names>L</given-names>
</name>
<name><surname>Koepfli</surname>
<given-names>KP</given-names>
</name>
<name><surname>Parker</surname>
<given-names>HG</given-names>
</name>
<name><surname>Pollinger</surname>
<given-names>JP</given-names>
</name>
<name><surname>Searle</surname>
<given-names>SM</given-names>
</name>
<name><surname>Sutter</surname>
<given-names>NB</given-names>
</name>
<name><surname>Thomas</surname>
<given-names>R</given-names>
</name>
<name><surname>Webber</surname>
<given-names>C</given-names>
</name>
<name><surname>Baldwin</surname>
<given-names>J</given-names>
</name>
<name><surname>Abebe</surname>
<given-names>A</given-names>
</name>
<name><surname>Abouelleil</surname>
<given-names>A</given-names>
</name>
<name><surname>Aftuck</surname>
<given-names>L</given-names>
</name>
<name><surname>Ait-Zahra</surname>
<given-names>M</given-names>
</name>
<name><surname>Aldredge</surname>
<given-names>T</given-names>
</name>
<name><surname>Allen</surname>
<given-names>N</given-names>
</name>
<name><surname>An</surname>
<given-names>P</given-names>
</name>
<name><surname>Anderson</surname>
<given-names>S</given-names>
</name>
<name><surname>Antoine</surname>
<given-names>C</given-names>
</name>
<name><surname>Arachchi</surname>
<given-names>H</given-names>
</name>
<name><surname>Aslam</surname>
<given-names>A</given-names>
</name>
<name><surname>Ayotte</surname>
<given-names>L</given-names>
</name>
<name><surname>Bachantsang</surname>
<given-names>P</given-names>
</name>
<name><surname>Barry</surname>
<given-names>A</given-names>
</name>
<name><surname>Bayul</surname>
<given-names>T</given-names>
</name>
<name><surname>Benamara</surname>
<given-names>M</given-names>
</name>
<name><surname>Berlin</surname>
<given-names>A</given-names>
</name>
<name><surname>Bessette</surname>
<given-names>D</given-names>
</name>
<name><surname>Blitshteyn</surname>
<given-names>B</given-names>
</name>
<name><surname>Bloom</surname>
<given-names>T</given-names>
</name>
<name><surname>Blye</surname>
<given-names>J</given-names>
</name>
<name><surname>Boguslavskiy</surname>
<given-names>L</given-names>
</name>
<name><surname>Bonnet</surname>
<given-names>C</given-names>
</name>
<name><surname>Boukhgalter</surname>
<given-names>B</given-names>
</name>
<name><surname>Brown</surname>
<given-names>A</given-names>
</name>
<name><surname>Cahill</surname>
<given-names>P</given-names>
</name>
<name><surname>Calixte</surname>
<given-names>N</given-names>
</name>
<name><surname>Camarata</surname>
<given-names>J</given-names>
</name>
<name><surname>Cheshatsang</surname>
<given-names>Y</given-names>
</name>
<name><surname>Chu</surname>
<given-names>J</given-names>
</name>
<name><surname>Citroen</surname>
<given-names>M</given-names>
</name>
<name><surname>Collymore</surname>
<given-names>A</given-names>
</name>
<name><surname>Cooke</surname>
<given-names>P</given-names>
</name>
<name><surname>Dawoe</surname>
<given-names>T</given-names>
</name>
<name><surname>Daza</surname>
<given-names>R</given-names>
</name>
<name><surname>Decktor</surname>
<given-names>K</given-names>
</name>
<name><surname>DeGray</surname>
<given-names>S</given-names>
</name>
<name><surname>Dhargay</surname>
<given-names>N</given-names>
</name>
<name><surname>Dooley</surname>
<given-names>K</given-names>
</name>
<name><surname>Dooley</surname>
<given-names>K</given-names>
</name>
<name><surname>Dorje</surname>
<given-names>P</given-names>
</name>
<name><surname>Dorjee</surname>
<given-names>K</given-names>
</name>
<name><surname>Dorris</surname>
<given-names>L</given-names>
</name>
<name><surname>Duffey</surname>
<given-names>N</given-names>
</name>
<name><surname>Dupes</surname>
<given-names>A</given-names>
</name>
<name><surname>Egbiremolen</surname>
<given-names>O</given-names>
</name>
<name><surname>Elong</surname>
<given-names>R</given-names>
</name>
<name><surname>Falk</surname>
<given-names>J</given-names>
</name>
<name><surname>Farina</surname>
<given-names>A</given-names>
</name>
<name><surname>Faro</surname>
<given-names>S</given-names>
</name>
<name><surname>Ferguson</surname>
<given-names>D</given-names>
</name>
<name><surname>Ferreira</surname>
<given-names>P</given-names>
</name>
<name><surname>Fisher</surname>
<given-names>S</given-names>
</name>
<name><surname>FitzGerald</surname>
<given-names>M</given-names>
</name>
<name><surname>Foley</surname>
<given-names>K</given-names>
</name>
<name><surname>Foley</surname>
<given-names>C</given-names>
</name>
<name><surname>Franke</surname>
<given-names>A</given-names>
</name>
<name><surname>Friedrich</surname>
<given-names>D</given-names>
</name>
<name><surname>Gage</surname>
<given-names>D</given-names>
</name>
<name><surname>Garber</surname>
<given-names>M</given-names>
</name>
<name><surname>Gearin</surname>
<given-names>G</given-names>
</name>
<name><surname>Giannoukos</surname>
<given-names>G</given-names>
</name>
<name><surname>Goode</surname>
<given-names>T</given-names>
</name>
<name><surname>Goyette</surname>
<given-names>A</given-names>
</name>
<name><surname>Graham</surname>
<given-names>J</given-names>
</name>
<name><surname>Grandbois</surname>
<given-names>E</given-names>
</name>
<name><surname>Gyaltsen</surname>
<given-names>K</given-names>
</name>
<name><surname>Hafez</surname>
<given-names>N</given-names>
</name>
<name><surname>Hagopian</surname>
<given-names>D</given-names>
</name>
<name><surname>Hagos</surname>
<given-names>B</given-names>
</name>
<name><surname>Hall</surname>
<given-names>J</given-names>
</name>
<name><surname>Healy</surname>
<given-names>C</given-names>
</name>
<name><surname>Hegarty</surname>
<given-names>R</given-names>
</name>
<name><surname>Honan</surname>
<given-names>T</given-names>
</name>
<name><surname>Horn</surname>
<given-names>A</given-names>
</name>
<name><surname>Houde</surname>
<given-names>N</given-names>
</name>
<name><surname>Hughes</surname>
<given-names>L</given-names>
</name>
<name><surname>Hunnicutt</surname>
<given-names>L</given-names>
</name>
<name><surname>Husby</surname>
<given-names>M</given-names>
</name>
<name><surname>Jester</surname>
<given-names>B</given-names>
</name>
<name><surname>Jones</surname>
<given-names>C</given-names>
</name>
<name><surname>Kamat</surname>
<given-names>A</given-names>
</name>
<name><surname>Kanga</surname>
<given-names>B</given-names>
</name>
<name><surname>Kells</surname>
<given-names>C</given-names>
</name>
<name><surname>Khazanovich</surname>
<given-names>D</given-names>
</name>
<name><surname>Kieu</surname>
<given-names>AC</given-names>
</name>
<name><surname>Kisner</surname>
<given-names>P</given-names>
</name>
<name><surname>Kumar</surname>
<given-names>M</given-names>
</name>
<name><surname>Lance</surname>
<given-names>K</given-names>
</name>
<name><surname>Landers</surname>
<given-names>T</given-names>
</name>
<name><surname>Lara</surname>
<given-names>M</given-names>
</name>
<name><surname>Lee</surname>
<given-names>W</given-names>
</name>
<name><surname>Leger</surname>
<given-names>JP</given-names>
</name>
<name><surname>Lennon</surname>
<given-names>N</given-names>
</name>
<name><surname>Leuper</surname>
<given-names>L</given-names>
</name>
<name><surname>LeVine</surname>
<given-names>S</given-names>
</name>
<name><surname>Liu</surname>
<given-names>J</given-names>
</name>
<name><surname>Liu</surname>
<given-names>X</given-names>
</name>
<name><surname>Lokyitsang</surname>
<given-names>Y</given-names>
</name>
<name><surname>Lokyitsang</surname>
<given-names>T</given-names>
</name>
<name><surname>Lui</surname>
<given-names>A</given-names>
</name>
<name><surname>Macdonald</surname>
<given-names>J</given-names>
</name>
<name><surname>Major</surname>
<given-names>J</given-names>
</name>
<name><surname>Marabella</surname>
<given-names>R</given-names>
</name>
<name><surname>Maru</surname>
<given-names>K</given-names>
</name>
<name><surname>Matthews</surname>
<given-names>C</given-names>
</name>
<name><surname>McDonough</surname>
<given-names>S</given-names>
</name>
<name><surname>Mehta</surname>
<given-names>T</given-names>
</name>
<name><surname>Meldrim</surname>
<given-names>J</given-names>
</name>
<name><surname>Melnikov</surname>
<given-names>A</given-names>
</name>
<name><surname>Meneus</surname>
<given-names>L</given-names>
</name>
<name><surname>Mihalev</surname>
<given-names>A</given-names>
</name>
<name><surname>Mihova</surname>
<given-names>T</given-names>
</name>
<name><surname>Miller</surname>
<given-names>K</given-names>
</name>
<name><surname>Mittelman</surname>
<given-names>R</given-names>
</name>
<name><surname>Mlenga</surname>
<given-names>V</given-names>
</name>
<name><surname>Mulrain</surname>
<given-names>L</given-names>
</name>
<name><surname>Munson</surname>
<given-names>G</given-names>
</name>
<name><surname>Navidi</surname>
<given-names>A</given-names>
</name>
<name><surname>Naylor</surname>
<given-names>J</given-names>
</name>
<name><surname>Nguyen</surname>
<given-names>T</given-names>
</name>
<name><surname>Nguyen</surname>
<given-names>N</given-names>
</name>
<name><surname>Nguyen</surname>
<given-names>C</given-names>
</name>
<name><surname>Nguyen</surname>
<given-names>T</given-names>
</name>
<name><surname>Nicol</surname>
<given-names>R</given-names>
</name>
<name><surname>Norbu</surname>
<given-names>N</given-names>
</name>
<name><surname>Norbu</surname>
<given-names>C</given-names>
</name>
<name><surname>Novod</surname>
<given-names>N</given-names>
</name>
<name><surname>Nyima</surname>
<given-names>T</given-names>
</name>
<name><surname>Olandt</surname>
<given-names>P</given-names>
</name>
<name><surname>O'Neill</surname>
<given-names>B</given-names>
</name>
<name><surname>O'Neill</surname>
<given-names>K</given-names>
</name>
<name><surname>Osman</surname>
<given-names>S</given-names>
</name>
<name><surname>Oyono</surname>
<given-names>L</given-names>
</name>
<name><surname>Patti</surname>
<given-names>C</given-names>
</name>
<name><surname>Perrin</surname>
<given-names>D</given-names>
</name>
<name><surname>Phunkhang</surname>
<given-names>P</given-names>
</name>
<name><surname>Pierre</surname>
<given-names>F</given-names>
</name>
<name><surname>Priest</surname>
<given-names>M</given-names>
</name>
<name><surname>Rachupka</surname>
<given-names>A</given-names>
</name>
<name><surname>Raghuraman</surname>
<given-names>S</given-names>
</name>
<name><surname>Rameau</surname>
<given-names>R</given-names>
</name>
<name><surname>Ray</surname>
<given-names>V</given-names>
</name>
<name><surname>Raymond</surname>
<given-names>C</given-names>
</name>
<name><surname>Rege</surname>
<given-names>F</given-names>
</name>
<name><surname>Rise</surname>
<given-names>C</given-names>
</name>
<name><surname>Rogers</surname>
<given-names>J</given-names>
</name>
<name><surname>Rogov</surname>
<given-names>P</given-names>
</name>
<name><surname>Sahalie</surname>
<given-names>J</given-names>
</name>
<name><surname>Settipalli</surname>
<given-names>S</given-names>
</name>
<name><surname>Sharpe</surname>
<given-names>T</given-names>
</name>
<name><surname>Shea</surname>
<given-names>T</given-names>
</name>
<name><surname>Sheehan</surname>
<given-names>M</given-names>
</name>
<name><surname>Sherpa</surname>
<given-names>N</given-names>
</name>
<name><surname>Shi</surname>
<given-names>J</given-names>
</name>
<name><surname>Shih</surname>
<given-names>D</given-names>
</name>
<name><surname>Sloan</surname>
<given-names>J</given-names>
</name>
<name><surname>Smith</surname>
<given-names>C</given-names>
</name>
<name><surname>Sparrow</surname>
<given-names>T</given-names>
</name>
<name><surname>Stalker</surname>
<given-names>J</given-names>
</name>
<name><surname>Stange-Thomann</surname>
<given-names>N</given-names>
</name>
<name><surname>Stavropoulos</surname>
<given-names>S</given-names>
</name>
<name><surname>Stone</surname>
<given-names>C</given-names>
</name>
<name><surname>Stone</surname>
<given-names>S</given-names>
</name>
<name><surname>Sykes</surname>
<given-names>S</given-names>
</name>
<name><surname>Tchuinga</surname>
<given-names>P</given-names>
</name>
<name><surname>Tenzing</surname>
<given-names>P</given-names>
</name>
<name><surname>Tesfaye</surname>
<given-names>S</given-names>
</name>
<name><surname>Thoulutsang</surname>
<given-names>D</given-names>
</name>
<name><surname>Thoulutsang</surname>
<given-names>Y</given-names>
</name>
<name><surname>Topham</surname>
<given-names>K</given-names>
</name>
<name><surname>Topping</surname>
<given-names>I</given-names>
</name>
<name><surname>Tsamla</surname>
<given-names>T</given-names>
</name>
<name><surname>Vassiliev</surname>
<given-names>H</given-names>
</name>
<name><surname>Venkataraman</surname>
<given-names>V</given-names>
</name>
<name><surname>Vo</surname>
<given-names>A</given-names>
</name>
<name><surname>Wangchuk</surname>
<given-names>T</given-names>
</name>
<name><surname>Wangdi</surname>
<given-names>T</given-names>
</name>
<name><surname>Weiand</surname>
<given-names>M</given-names>
</name>
<name><surname>Wilkinson</surname>
<given-names>J</given-names>
</name>
<name><surname>Wilson</surname>
<given-names>A</given-names>
</name>
<name><surname>Yadav</surname>
<given-names>S</given-names>
</name>
<name><surname>Yang</surname>
<given-names>S</given-names>
</name>
<name><surname>Yang</surname>
<given-names>X</given-names>
</name>
<name><surname>Young</surname>
<given-names>G</given-names>
</name>
<name><surname>Yu</surname>
<given-names>Q</given-names>
</name>
<name><surname>Zainoun</surname>
<given-names>J</given-names>
</name>
<name><surname>Zembek</surname>
<given-names>L</given-names>
</name>
<name><surname>Zimmer</surname>
<given-names>A</given-names>
</name>
<name><surname>Lander</surname>
<given-names>ES</given-names>
</name>
</person-group>
<year>2005</year>
<article-title>Genome sequence, comparative analysis and haplotype structure of the domestic dog</article-title>
<source>Nature</source>
<volume>438</volume>
<fpage>803</fpage>
<lpage>819</lpage>
<pub-id pub-id-type="doi">10.1038/nature04338</pub-id>
<pub-id pub-id-type="pmid">16341006</pub-id>
</element-citation>
</ref>
<ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lunt</surname>
<given-names>DH</given-names>
</name>
<name><surname>Hyman</surname>
<given-names>BC</given-names>
</name>
</person-group>
<year>1997</year>
<article-title>Animal mitochondrial DNA recombination</article-title>
<source>Nature</source>
<volume>387</volume>
<fpage>247</fpage>
<pub-id pub-id-type="doi">10.1038/387247a0</pub-id>
<pub-id pub-id-type="pmid">9153388</pub-id>
</element-citation>
</ref>
<ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Martin</surname>
<given-names>D</given-names>
</name>
<name><surname>Rybicki</surname>
<given-names>E</given-names>
</name>
</person-group>
<year>2000</year>
<article-title>Rdp: Detection of recombination amongst aligned sequences</article-title>
<source>Bioinformatics</source>
<volume>16</volume>
<fpage>562</fpage>
<lpage>563</lpage>
<pub-id pub-id-type="doi">10.1093/bioinformatics/16.6.562</pub-id>
<pub-id pub-id-type="pmid">10980155</pub-id>
</element-citation>
</ref>
<ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Martin</surname>
<given-names>DP</given-names>
</name>
<name><surname>Murrell</surname>
<given-names>B</given-names>
</name>
<name><surname>Golden</surname>
<given-names>M</given-names>
</name>
<name><surname>Khoosal</surname>
<given-names>A</given-names>
</name>
<name><surname>Muhire</surname>
<given-names>B</given-names>
</name>
</person-group>
<year>2015</year>
<article-title>Rdp4: Detection and analysis of recombination patterns in virus genomes</article-title>
<source>Virus Evolution</source>
<volume>1</volume>
<fpage>vev003</fpage>
<pub-id pub-id-type="doi">10.1093/ve/vev003</pub-id>
</element-citation>
</ref>
<ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Martincorena</surname>
<given-names>I</given-names>
</name>
<name><surname>Roshan</surname>
<given-names>A</given-names>
</name>
<name><surname>Gerstung</surname>
<given-names>M</given-names>
</name>
<name><surname>Ellis</surname>
<given-names>P</given-names>
</name>
<name><surname>Van Loo</surname>
<given-names>P</given-names>
</name>
<name><surname>McLaren</surname>
<given-names>S</given-names>
</name>
<name><surname>Wedge</surname>
<given-names>DC</given-names>
</name>
<name><surname>Fullam</surname>
<given-names>A</given-names>
</name>
<name><surname>Alexandrov</surname>
<given-names>LB</given-names>
</name>
<name><surname>Tubio</surname>
<given-names>JM</given-names>
</name>
<name><surname>Stebbings</surname>
<given-names>L</given-names>
</name>
<name><surname>Menzies</surname>
<given-names>A</given-names>
</name>
<name><surname>Widaa</surname>
<given-names>S</given-names>
</name>
<name><surname>Stratton</surname>
<given-names>MR</given-names>
</name>
<name><surname>Jones</surname>
<given-names>PH</given-names>
</name>
<name><surname>Campbell</surname>
<given-names>PJ</given-names>
</name>
</person-group>
<year>2015</year>
<article-title>Tumor evolution. high burden and pervasive positive selection of somatic mutations in normal human skin</article-title>
<source>Science</source>
<volume>348</volume>
<fpage>880</fpage>
<lpage>886</lpage>
<pub-id pub-id-type="doi">10.1126/science.aaa6806</pub-id>
<pub-id pub-id-type="pmid">25999502</pub-id>
</element-citation>
</ref>
<ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>McLaren</surname>
<given-names>W</given-names>
</name>
<name><surname>Pritchard</surname>
<given-names>B</given-names>
</name>
<name><surname>Rios</surname>
<given-names>D</given-names>
</name>
<name><surname>Chen</surname>
<given-names>Y</given-names>
</name>
<name><surname>Flicek</surname>
<given-names>P</given-names>
</name>
<name><surname>Cunningham</surname>
<given-names>F</given-names>
</name>
</person-group>
<year>2010</year>
<article-title>Deriving the consequences of genomic variants with the ensembl API and SNP effect predictor</article-title>
<source>Bioinformatics</source>
<volume>26</volume>
<fpage>2069</fpage>
<lpage>2070</lpage>
<pub-id pub-id-type="doi">10.1093/bioinformatics/btq330</pub-id>
<pub-id pub-id-type="pmid">20562413</pub-id>
</element-citation>
</ref>
<ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Murchison</surname>
<given-names>EP</given-names>
</name>
<name><surname>Wedge</surname>
<given-names>DC</given-names>
</name>
<name><surname>Alexandrov</surname>
<given-names>LB</given-names>
</name>
<name><surname>Fu</surname>
<given-names>B</given-names>
</name>
<name><surname>Martincorena</surname>
<given-names>I</given-names>
</name>
<name><surname>Ning</surname>
<given-names>Z</given-names>
</name>
<name><surname>Tubio</surname>
<given-names>JM</given-names>
</name>
<name><surname>Werner</surname>
<given-names>EI</given-names>
</name>
<name><surname>Allen</surname>
<given-names>J</given-names>
</name>
<name><surname>De Nardi</surname>
<given-names>AB</given-names>
</name>
<name><surname>Donelan</surname>
<given-names>EM</given-names>
</name>
<name><surname>Marino</surname>
<given-names>G</given-names>
</name>
<name><surname>Fassati</surname>
<given-names>A</given-names>
</name>
<name><surname>Campbell</surname>
<given-names>PJ</given-names>
</name>
<name><surname>Yang</surname>
<given-names>F</given-names>
</name>
<name><surname>Burt</surname>
<given-names>A</given-names>
</name>
<name><surname>Weiss</surname>
<given-names>RA</given-names>
</name>
<name><surname>Stratton</surname>
<given-names>MR</given-names>
</name>
</person-group>
<year>2014</year>
<article-title>Transmissible [corrected] dog cancer genome reveals the origin and history of an ancient cell lineage</article-title>
<source>Science</source>
<volume>343</volume>
<fpage>437</fpage>
<lpage>440</lpage>
<pub-id pub-id-type="doi">10.1126/science.1247167</pub-id>
<pub-id pub-id-type="pmid">24458646</pub-id>
</element-citation>
</ref>
<ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Murgia</surname>
<given-names>C</given-names>
</name>
<name><surname>Pritchard</surname>
<given-names>JK</given-names>
</name>
<name><surname>Kim</surname>
<given-names>SY</given-names>
</name>
<name><surname>Fassati</surname>
<given-names>A</given-names>
</name>
<name><surname>Weiss</surname>
<given-names>RA</given-names>
</name>
</person-group>
<year>2006</year>
<article-title>Clonal origin and evolution of a transmissible cancer</article-title>
<source>Cell</source>
<volume>126</volume>
<fpage>477</fpage>
<lpage>487</lpage>
<pub-id pub-id-type="doi">10.1016/j.cell.2006.05.051</pub-id>
<pub-id pub-id-type="pmid">16901782</pub-id>
</element-citation>
</ref>
<ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nik-Zainal</surname>
<given-names>S</given-names>
</name>
<name><surname>Alexandrov</surname>
<given-names>LB</given-names>
</name>
<name><surname>Wedge</surname>
<given-names>DC</given-names>
</name>
<name><surname>Van Loo</surname>
<given-names>P</given-names>
</name>
<name><surname>Greenman</surname>
<given-names>CD</given-names>
</name>
<name><surname>Raine</surname>
<given-names>K</given-names>
</name>
<name><surname>Jones</surname>
<given-names>D</given-names>
</name>
<name><surname>Hinton</surname>
<given-names>J</given-names>
</name>
<name><surname>Marshall</surname>
<given-names>J</given-names>
</name>
<name><surname>Stebbings</surname>
<given-names>LA</given-names>
</name>
<name><surname>Menzies</surname>
<given-names>A</given-names>
</name>
<name><surname>Martin</surname>
<given-names>S</given-names>
</name>
<name><surname>Leung</surname>
<given-names>K</given-names>
</name>
<name><surname>Chen</surname>
<given-names>L</given-names>
</name>
<name><surname>Leroy</surname>
<given-names>C</given-names>
</name>
<name><surname>Ramakrishna</surname>
<given-names>M</given-names>
</name>
<name><surname>Rance</surname>
<given-names>R</given-names>
</name>
<name><surname>Lau</surname>
<given-names>KW</given-names>
</name>
<name><surname>Mudie</surname>
<given-names>LJ</given-names>
</name>
<name><surname>Varela</surname>
<given-names>I</given-names>
</name>
<name><surname>McBride</surname>
<given-names>DJ</given-names>
</name>
<name><surname>Bignell</surname>
<given-names>GR</given-names>
</name>
<name><surname>Cooke</surname>
<given-names>SL</given-names>
</name>
<name><surname>Shlien</surname>
<given-names>A</given-names>
</name>
<name><surname>Gamble</surname>
<given-names>J</given-names>
</name>
<name><surname>Whitmore</surname>
<given-names>I</given-names>
</name>
<name><surname>Maddison</surname>
<given-names>M</given-names>
</name>
<name><surname>Tarpey</surname>
<given-names>PS</given-names>
</name>
<name><surname>Davies</surname>
<given-names>HR</given-names>
</name>
<name><surname>Papaemmanuil</surname>
<given-names>E</given-names>
</name>
<name><surname>Stephens</surname>
<given-names>PJ</given-names>
</name>
<name><surname>McLaren</surname>
<given-names>S</given-names>
</name>
<name><surname>Butler</surname>
<given-names>AP</given-names>
</name>
<name><surname>Teague</surname>
<given-names>JW</given-names>
</name>
<name><surname>Jönsson</surname>
<given-names>G</given-names>
</name>
<name><surname>Garber</surname>
<given-names>JE</given-names>
</name>
<name><surname>Silver</surname>
<given-names>D</given-names>
</name>
<name><surname>Miron</surname>
<given-names>P</given-names>
</name>
<name><surname>Fatima</surname>
<given-names>A</given-names>
</name>
<name><surname>Boyault</surname>
<given-names>S</given-names>
</name>
<name><surname>Langerød</surname>
<given-names>A</given-names>
</name>
<name><surname>Tutt</surname>
<given-names>A</given-names>
</name>
<name><surname>Martens</surname>
<given-names>JW</given-names>
</name>
<name><surname>Aparicio</surname>
<given-names>SA</given-names>
</name>
<name><surname>Borg</surname>
<given-names>Å</given-names>
</name>
<name><surname>Salomon</surname>
<given-names>AV</given-names>
</name>
<name><surname>Thomas</surname>
<given-names>G</given-names>
</name>
<name><surname>Børresen-Dale</surname>
<given-names>AL</given-names>
</name>
<name><surname>Richardson</surname>
<given-names>AL</given-names>
</name>
<name><surname>Neuberger</surname>
<given-names>MS</given-names>
</name>
<name><surname>Futreal</surname>
<given-names>PA</given-names>
</name>
<name><surname>Campbell</surname>
<given-names>PJ</given-names>
</name>
<name><surname>Stratton</surname>
<given-names>MR</given-names>
</name>
<collab>Breast Cancer Working Group of the International Cancer Genome Consortium</collab>
</person-group>
<year>2012</year>
<article-title>Mutational processes molding the genomes of 21 breast cancers</article-title>
<source>Cell</source>
<volume>149</volume>
<fpage>979</fpage>
<lpage>993</lpage>
<pub-id pub-id-type="doi">10.1016/j.cell.2012.04.024</pub-id>
<pub-id pub-id-type="pmid">22608084</pub-id>
</element-citation>
</ref>
<ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pang</surname>
<given-names>J-F</given-names>
</name>
<name><surname>Kluetsch</surname>
<given-names>C</given-names>
</name>
<name><surname>Zou</surname>
<given-names>X-J</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>A.-b.</given-names>
</name>
<name><surname>Luo</surname>
<given-names>L-Y</given-names>
</name>
<name><surname>Angleby</surname>
<given-names>H</given-names>
</name>
<name><surname>Ardalan</surname>
<given-names>A</given-names>
</name>
<name><surname>Ekstrom</surname>
<given-names>C</given-names>
</name>
<name><surname>Skollermo</surname>
<given-names>A</given-names>
</name>
<name><surname>Lundeberg</surname>
<given-names>J</given-names>
</name>
<name><surname>Matsumura</surname>
<given-names>S</given-names>
</name>
<name><surname>Leitner</surname>
<given-names>T</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>Y-P</given-names>
</name>
<name><surname>Savolainen</surname>
<given-names>P</given-names>
</name>
</person-group>
<year>2009</year>
<article-title>mtDNA data indicate a single origin for dogs south of yangtze river, less than 16,300 years ago, from numerous wolves</article-title>
<source>Molecular Biology and Evolution</source>
<volume>26</volume>
<fpage>2849</fpage>
<lpage>2864</lpage>
<pub-id pub-id-type="doi">10.1093/molbev/msp195</pub-id>
<pub-id pub-id-type="pmid">19723671</pub-id>
</element-citation>
</ref>
<ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Posada</surname>
<given-names>D</given-names>
</name>
<name><surname>Crandall</surname>
<given-names>KA</given-names>
</name>
</person-group>
<year>2001</year>
<article-title>Evaluation of methods for detecting recombination from DNA sequences: Computer simulations</article-title>
<source>Proceedings of the National Academy of Sciences of the United States of America</source>
<volume>98</volume>
<fpage>13757</fpage>
<lpage>13762</lpage>
<pub-id pub-id-type="doi">10.1073/pnas.241370698</pub-id>
<pub-id pub-id-type="pmid">11717435</pub-id>
</element-citation>
</ref>
<ref id="bib35"><element-citation publication-type="web"><person-group person-group-type="author"><name><surname>R Development Core Team</surname>
</name>
</person-group>
<year>2013</year>
<chapter-title>A language and environment for statistical computing</chapter-title>
<source>R Foundation for Statistical Computing, Vienna, Austria</source>
<uri xlink:href="http://www.R-project.org/"><ext-link ext-link-type="uri" xlink:href="http://www.r-project.org/">http://www.R-project.org/</ext-link>
</uri>
</element-citation>
</ref>
<ref id="bib36"><element-citation publication-type="book"><person-group person-group-type="author"><name><surname>Rebbeck</surname>
<given-names>CA</given-names>
</name>
</person-group>
<year>2007</year>
<article-title>Canine Transmissible Cancer: Evolution of a Selfish Cell Lineage</article-title>
<publisher-name>Doctoral thesis, Imperial College London</publisher-name>
</element-citation>
</ref>
<ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rebbeck</surname>
<given-names>CA</given-names>
</name>
<name><surname>Thomas</surname>
<given-names>R</given-names>
</name>
<name><surname>Breen</surname>
<given-names>M</given-names>
</name>
<name><surname>Leroi</surname>
<given-names>AM</given-names>
</name>
<name><surname>Burt</surname>
<given-names>A</given-names>
</name>
</person-group>
<year>2009</year>
<article-title>Origins and evolution of a transmissible cancer</article-title>
<source>Evolution; International Journal of Organic Evolution</source>
<volume>63</volume>
<fpage>2340</fpage>
<lpage>2349</lpage>
<pub-id pub-id-type="doi">10.1111/j.1558-5646.2009.00724.x</pub-id>
</element-citation>
</ref>
<ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rebbeck</surname>
<given-names>CA</given-names>
</name>
<name><surname>Leroi</surname>
<given-names>AM</given-names>
</name>
<name><surname>Burt</surname>
<given-names>A</given-names>
</name>
</person-group>
<year>2011</year>
<article-title>Mitochondrial capture by a transmissible cancer</article-title>
<source>Science</source>
<volume>331</volume>
<fpage>303</fpage>
<pub-id pub-id-type="doi">10.1126/science.1197696</pub-id>
<pub-id pub-id-type="pmid">21252340</pub-id>
</element-citation>
</ref>
<ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Robinson</surname>
<given-names>JT</given-names>
</name>
<name><surname>Thorvaldsdóttir</surname>
<given-names>H</given-names>
</name>
<name><surname>Winckler</surname>
<given-names>W</given-names>
</name>
<name><surname>Guttman</surname>
<given-names>M</given-names>
</name>
<name><surname>Lander</surname>
<given-names>ES</given-names>
</name>
<name><surname>Getz</surname>
<given-names>G</given-names>
</name>
<name><surname>Mesirov</surname>
<given-names>JP</given-names>
</name>
</person-group>
<year>2011</year>
<article-title>Integrative genomics viewer</article-title>
<source>Nature Biotechnology</source>
<volume>29</volume>
<fpage>24</fpage>
<lpage>26</lpage>
<pub-id pub-id-type="doi">10.1038/nbt.1754</pub-id>
</element-citation>
</ref>
<ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Savolainen</surname>
<given-names>P</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>YP</given-names>
</name>
<name><surname>Luo</surname>
<given-names>J</given-names>
</name>
<name><surname>Lundeberg</surname>
<given-names>J</given-names>
</name>
<name><surname>Leitner</surname>
<given-names>T</given-names>
</name>
</person-group>
<year>2002</year>
<article-title>Genetic evidence for an east asian origin of domestic dogs</article-title>
<source>Science</source>
<volume>298</volume>
<fpage>1610</fpage>
<lpage>1613</lpage>
<pub-id pub-id-type="doi">10.1126/science.1073906</pub-id>
<pub-id pub-id-type="pmid">12446907</pub-id>
</element-citation>
</ref>
<ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shannon</surname>
<given-names>LM</given-names>
</name>
<name><surname>Boyko</surname>
<given-names>RH</given-names>
</name>
<name><surname>Castelhano</surname>
<given-names>M</given-names>
</name>
<name><surname>Corey</surname>
<given-names>E</given-names>
</name>
<name><surname>Hayward</surname>
<given-names>JJ</given-names>
</name>
<name><surname>McLean</surname>
<given-names>C</given-names>
</name>
<name><surname>White</surname>
<given-names>ME</given-names>
</name>
<name><surname>Abi Said</surname>
<given-names>M</given-names>
</name>
<name><surname>Anita</surname>
<given-names>BA</given-names>
</name>
<name><surname>Bondjengo</surname>
<given-names>NI</given-names>
</name>
<name><surname>Calero</surname>
<given-names>J</given-names>
</name>
<name><surname>Galov</surname>
<given-names>A</given-names>
</name>
<name><surname>Hedimbi</surname>
<given-names>M</given-names>
</name>
<name><surname>Imam</surname>
<given-names>B</given-names>
</name>
<name><surname>Khalap</surname>
<given-names>R</given-names>
</name>
<name><surname>Lally</surname>
<given-names>D</given-names>
</name>
<name><surname>Masta</surname>
<given-names>A</given-names>
</name>
<name><surname>Oliveira</surname>
<given-names>KC</given-names>
</name>
<name><surname>Pérez</surname>
<given-names>L</given-names>
</name>
<name><surname>Randall</surname>
<given-names>J</given-names>
</name>
<name><surname>Tam</surname>
<given-names>NM</given-names>
</name>
<name><surname>Trujillo-Cornejo</surname>
<given-names>FJ</given-names>
</name>
<name><surname>Valeriano</surname>
<given-names>C</given-names>
</name>
<name><surname>Sutter</surname>
<given-names>NB</given-names>
</name>
<name><surname>Todhunter</surname>
<given-names>RJ</given-names>
</name>
<name><surname>Bustamante</surname>
<given-names>CD</given-names>
</name>
<name><surname>Boyko</surname>
<given-names>AR</given-names>
</name>
</person-group>
<year>2015</year>
<article-title>Genetic structure in village dogs reveals a central asian domestication origin</article-title>
<source>Proceedings of the National Academy of Sciences of the United States of America</source>
<volume>112</volume>
<fpage>13639</fpage>
<lpage>13644</lpage>
<pub-id pub-id-type="doi">10.1073/pnas.1516215112</pub-id>
<pub-id pub-id-type="pmid">26483491</pub-id>
</element-citation>
</ref>
<ref id="bib42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sievers</surname>
<given-names>F</given-names>
</name>
<name><surname>Wilm</surname>
<given-names>A</given-names>
</name>
<name><surname>Dineen</surname>
<given-names>D</given-names>
</name>
<name><surname>Gibson</surname>
<given-names>TJ</given-names>
</name>
<name><surname>Karplus</surname>
<given-names>K</given-names>
</name>
<name><surname>Li</surname>
<given-names>W</given-names>
</name>
<name><surname>Lopez</surname>
<given-names>R</given-names>
</name>
<name><surname>McWilliam</surname>
<given-names>H</given-names>
</name>
<name><surname>Remmert</surname>
<given-names>M</given-names>
</name>
<name><surname>Söding</surname>
<given-names>J</given-names>
</name>
<name><surname>Thompson</surname>
<given-names>JD</given-names>
</name>
<name><surname>Higgins</surname>
<given-names>DG</given-names>
</name>
</person-group>
<year>2011</year>
<article-title>Fast, scalable generation of high-quality protein multiple sequence alignments using clustal omega</article-title>
<source>Molecular Systems Biology</source>
<volume>7</volume>
<fpage>539</fpage>
<pub-id pub-id-type="doi">10.1038/msb.2011.75</pub-id>
<pub-id pub-id-type="pmid">21988835</pub-id>
</element-citation>
</ref>
<ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Slater</surname>
<given-names>GS</given-names>
</name>
<name><surname>Birney</surname>
<given-names>E</given-names>
</name>
</person-group>
<year>2005</year>
<article-title>Automated generation of heuristics for biological sequence comparison</article-title>
<source>BMC Bioinformatics</source>
<volume>6</volume>
<fpage>31</fpage>
<pub-id pub-id-type="doi">10.1186/1471-2105-6-31</pub-id>
<pub-id pub-id-type="pmid">15713233</pub-id>
</element-citation>
</ref>
<ref id="bib44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Smith</surname>
<given-names>JM</given-names>
</name>
</person-group>
<year>1992</year>
<article-title>Analyzing the mosaic structure of genes</article-title>
<source>Journal of Molecular Evolution</source>
<volume>34</volume>
<fpage>126</fpage>
<lpage>129</lpage>
<pub-id pub-id-type="doi">10.1007/bf00182389</pub-id>
<pub-id pub-id-type="pmid">1556748</pub-id>
</element-citation>
</ref>
<ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Spees</surname>
<given-names>JL</given-names>
</name>
<name><surname>Olson</surname>
<given-names>SD</given-names>
</name>
<name><surname>Whitney</surname>
<given-names>MJ</given-names>
</name>
<name><surname>Prockop</surname>
<given-names>DJ</given-names>
</name>
</person-group>
<year>2006</year>
<article-title>Mitochondrial transfer between cells can rescue aerobic respiration</article-title>
<source>Proceedings of the National Academy of Sciences of the United States of America</source>
<volume>103</volume>
<fpage>1283</fpage>
<lpage>1288</lpage>
<pub-id pub-id-type="doi">10.1073/pnas.0510511103</pub-id>
<pub-id pub-id-type="pmid">16432190</pub-id>
</element-citation>
</ref>
<ref id="bib46"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Stewart</surname>
<given-names>JB</given-names>
</name>
<name><surname>Alaei-Mahabadi</surname>
<given-names>B</given-names>
</name>
<name><surname>Sabarinathan</surname>
<given-names>R</given-names>
</name>
<name><surname>Samuelsson</surname>
<given-names>T</given-names>
</name>
<name><surname>Gorodkin</surname>
<given-names>J</given-names>
</name>
<name><surname>Gustafsson</surname>
<given-names>CM</given-names>
</name>
<name><surname>Larsson</surname>
<given-names>E</given-names>
</name>
</person-group>
<year>2015</year>
<article-title>Simultaneous DNA and RNA mapping of somatic mitochondrial mutations across diverse human cancers</article-title>
<source>PLoS Genetics</source>
<elocation-id>e14552</elocation-id>
<pub-id pub-id-type="doi">10.1371/journal.pgen.1005333</pub-id>
</element-citation>
</ref>
<ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Strakova</surname>
<given-names>A</given-names>
</name>
<name><surname>Murchison</surname>
<given-names>EP</given-names>
</name>
</person-group>
<year>2014</year>
<article-title>The changing global distribution and prevalence of canine transmissible venereal tumour</article-title>
<source>BMC Veterinary Research</source>
<volume>10</volume>
<fpage>168</fpage>
<pub-id pub-id-type="doi">10.1186/s12917-014-0168-9</pub-id>
<pub-id pub-id-type="pmid">25186078</pub-id>
</element-citation>
</ref>
<ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Strakova</surname>
<given-names>A</given-names>
</name>
<name><surname>Murchison</surname>
<given-names>EP</given-names>
</name>
</person-group>
<year>2015</year>
<article-title>The cancer which survived: Insights from the genome of an 11000 year-old cancer</article-title>
<source>Current Opinion in Genetics & Development</source>
<volume>30</volume>
<fpage>49</fpage>
<lpage>55</lpage>
<pub-id pub-id-type="doi">10.1016/j.gde.2015.03.005</pub-id>
<pub-id pub-id-type="pmid">25867244</pub-id>
</element-citation>
</ref>
<ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Stratton</surname>
<given-names>MR</given-names>
</name>
<name><surname>Campbell</surname>
<given-names>PJ</given-names>
</name>
<name><surname>Futreal</surname>
<given-names>PA</given-names>
</name>
</person-group>
<year>2009</year>
<article-title>The cancer genome</article-title>
<source>Nature</source>
<volume>458</volume>
<fpage>719</fpage>
<lpage>724</lpage>
<pub-id pub-id-type="doi">10.1038/nature07943</pub-id>
<pub-id pub-id-type="pmid">19360079</pub-id>
</element-citation>
</ref>
<ref id="bib50"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tamura</surname>
<given-names>K</given-names>
</name>
<name><surname>Stecher</surname>
<given-names>G</given-names>
</name>
<name><surname>Peterson</surname>
<given-names>D</given-names>
</name>
<name><surname>Filipski</surname>
<given-names>A</given-names>
</name>
<name><surname>Kumar</surname>
<given-names>S</given-names>
</name>
</person-group>
<year>2013</year>
<article-title>Mega6: Molecular evolutionary genetics analysis version 6.0</article-title>
<source>Molecular Biology and Evolution</source>
<volume>30</volume>
<fpage>2725</fpage>
<lpage>2729</lpage>
<pub-id pub-id-type="doi">10.1093/molbev/mst197</pub-id>
<pub-id pub-id-type="pmid">24132122</pub-id>
</element-citation>
</ref>
<ref id="bib51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tan</surname>
<given-names>AS</given-names>
</name>
<name><surname>Baty</surname>
<given-names>JW</given-names>
</name>
<name><surname>Dong</surname>
<given-names>LF</given-names>
</name>
<name><surname>Bezawork-Geleta</surname>
<given-names>A</given-names>
</name>
<name><surname>Endaya</surname>
<given-names>B</given-names>
</name>
<name><surname>Goodwin</surname>
<given-names>J</given-names>
</name>
<name><surname>Bajzikova</surname>
<given-names>M</given-names>
</name>
<name><surname>Kovarova</surname>
<given-names>J</given-names>
</name>
<name><surname>Peterka</surname>
<given-names>M</given-names>
</name>
<name><surname>Yan</surname>
<given-names>B</given-names>
</name>
<name><surname>Pesdar</surname>
<given-names>EA</given-names>
</name>
<name><surname>Sobol</surname>
<given-names>M</given-names>
</name>
<name><surname>Filimonenko</surname>
<given-names>A</given-names>
</name>
<name><surname>Stuart</surname>
<given-names>S</given-names>
</name>
<name><surname>Vondrusova</surname>
<given-names>M</given-names>
</name>
<name><surname>Kluckova</surname>
<given-names>K</given-names>
</name>
<name><surname>Sachaphibulkij</surname>
<given-names>K</given-names>
</name>
<name><surname>Rohlena</surname>
<given-names>J</given-names>
</name>
<name><surname>Hozak</surname>
<given-names>P</given-names>
</name>
<name><surname>Truksa</surname>
<given-names>J</given-names>
</name>
<name><surname>Eccles</surname>
<given-names>D</given-names>
</name>
<name><surname>Haupt</surname>
<given-names>LM</given-names>
</name>
<name><surname>Griffiths</surname>
<given-names>LR</given-names>
</name>
<name><surname>Neuzil</surname>
<given-names>J</given-names>
</name>
<name><surname>Berridge</surname>
<given-names>MV</given-names>
</name>
</person-group>
<year>2015</year>
<article-title>Mitochondrial genome acquisition restores respiratory function and tumorigenic potential of cancer cells without mitochondrial DNA</article-title>
<source>Cell Metabolism</source>
<volume>21</volume>
<fpage>81</fpage>
<lpage>94</lpage>
<pub-id pub-id-type="doi">10.1016/j.cmet.2014.12.003</pub-id>
<pub-id pub-id-type="pmid">25565207</pub-id>
</element-citation>
</ref>
<ref id="bib52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Thorvaldsdóttir</surname>
<given-names>H</given-names>
</name>
<name><surname>Robinson</surname>
<given-names>JT</given-names>
</name>
<name><surname>Mesirov</surname>
<given-names>JP</given-names>
</name>
</person-group>
<year>2013</year>
<article-title>Integrative genomics viewer (IGV): High-performance genomics data visualization and exploration</article-title>
<source>Briefings in Bioinformatics</source>
<volume>14</volume>
<fpage>178</fpage>
<lpage>192</lpage>
<pub-id pub-id-type="doi">10.1093/bib/bbs017</pub-id>
<pub-id pub-id-type="pmid">22517427</pub-id>
</element-citation>
</ref>
<ref id="bib53"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Thyagarajan</surname>
<given-names>B</given-names>
</name>
<name><surname>Padua</surname>
<given-names>RA</given-names>
</name>
<name><surname>Campbell</surname>
<given-names>C</given-names>
</name>
</person-group>
<year>1996</year>
<article-title>Mammalian mitochondria possess homologous DNA recombination activity</article-title>
<source>The Journal of Biological Chemistry</source>
<volume>271</volume>
<fpage>27536</fpage>
<lpage>27543</lpage>
<pub-id pub-id-type="doi">10.1074/jbc.271.44.27536</pub-id>
<pub-id pub-id-type="pmid">8910339</pub-id>
</element-citation>
</ref>
<ref id="bib54"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ujvari</surname>
<given-names>B</given-names>
</name>
<name><surname>Dowton</surname>
<given-names>M</given-names>
</name>
<name><surname>Madsen</surname>
<given-names>T</given-names>
</name>
</person-group>
<year>2007</year>
<article-title>Mitochondrial DNA recombination in a free-ranging australian lizard</article-title>
<source>Biology Letters</source>
<volume>3</volume>
<fpage>189</fpage>
<lpage>192</lpage>
<pub-id pub-id-type="doi">10.1098/rsbl.2006.0587</pub-id>
<pub-id pub-id-type="pmid">17251121</pub-id>
</element-citation>
</ref>
<ref id="bib55"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Verscheure</surname>
<given-names>S</given-names>
</name>
<name><surname>Backeljau</surname>
<given-names>T</given-names>
</name>
<name><surname>Desmyter</surname>
<given-names>S</given-names>
</name>
</person-group>
<year>2015</year>
<article-title>In silico discovery of a nearly complete mitochondrial genome numt in the dog (canis lupus familiaris) nuclear genome</article-title>
<source>Genetica</source>
<volume>143</volume>
<fpage>453</fpage>
<lpage>458</lpage>
<pub-id pub-id-type="doi">10.1007/s10709-015-9844-3</pub-id>
<pub-id pub-id-type="pmid">25991039</pub-id>
</element-citation>
</ref>
<ref id="bib56"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Vilà</surname>
<given-names>C</given-names>
</name>
<name><surname>Savolainen</surname>
<given-names>P</given-names>
</name>
<name><surname>Maldonado</surname>
<given-names>JE</given-names>
</name>
<name><surname>Amorim</surname>
<given-names>IR</given-names>
</name>
<name><surname>Rice</surname>
<given-names>JE</given-names>
</name>
<name><surname>Honeycutt</surname>
<given-names>RL</given-names>
</name>
<name><surname>Crandall</surname>
<given-names>KA</given-names>
</name>
<name><surname>Lundeberg</surname>
<given-names>J</given-names>
</name>
<name><surname>Wayne</surname>
<given-names>RK</given-names>
</name>
</person-group>
<year>1997</year>
<article-title>Multiple and ancient origins of the domestic dog</article-title>
<source>Science</source>
<volume>276</volume>
<fpage>1687</fpage>
<lpage>1689</lpage>
<pub-id pub-id-type="doi">10.1126/science.276.5319.1687</pub-id>
<pub-id pub-id-type="pmid">9180076</pub-id>
</element-citation>
</ref>
<ref id="bib57"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zsurka</surname>
<given-names>G</given-names>
</name>
<name><surname>Kraytsberg</surname>
<given-names>Y</given-names>
</name>
<name><surname>Kudina</surname>
<given-names>T</given-names>
</name>
<name><surname>Kornblum</surname>
<given-names>C</given-names>
</name>
<name><surname>Elger</surname>
<given-names>CE</given-names>
</name>
<name><surname>Khrapko</surname>
<given-names>K</given-names>
</name>
<name><surname>Kunz</surname>
<given-names>WS</given-names>
</name>
</person-group>
<year>2005</year>
<article-title>Recombination of mitochondrial DNA in skeletal muscle of individuals with multiple mitochondrial DNA heteroplasmy</article-title>
<source>Nature Genetics</source>
<volume>37</volume>
<fpage>873</fpage>
<lpage>877</lpage>
<pub-id pub-id-type="doi">10.1038/ng1606</pub-id>
<pub-id pub-id-type="pmid">16025113</pub-id>
</element-citation>
</ref>
</ref-list>
</back>
<sub-article id="SA1" article-type="article-commentary"><front-stub><article-id pub-id-type="doi">10.7554/eLife.14552.033</article-id>
<title-group><article-title>Decision letter</article-title>
</title-group>
<contrib-group><contrib contrib-type="editor"><name><surname>Ostrander</surname>
<given-names>Elaine</given-names>
</name>
<role>Reviewing editor</role>
<aff id="aff49"><institution>National Human Genome Research Institute, National Institutes of Health</institution>
,<country>United States</country>
</aff>
</contrib>
</contrib-group>
</front-stub>
<body><boxed-text position="float" orientation="portrait"><p>In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.</p>
</boxed-text>
<p>Thank you for submitting your article "Mitochondrial genetic diversity, selection and recombination in a canine transmissible cancer" for consideration by <italic>eLife</italic>
. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by Elaine Ostrander as the Reviewing Editor and Mark McCarthy as the Senior Editor.</p>
<p>The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.</p>
<p>Summary:</p>
<p>This is a well-written and concise paper that addressed the next natural step in unraveling the mystery of CTVT in the dog. The figures are clear (and attractive). Overall the paper does an outstanding job documenting, through low-coverage sequencing and phylogenetic analysis, the frequent transfer of mitochondrial DNA from the affected host to the canine transmissible venereal tumor (CTVT). Sequencing reveals that acquisition of host mtDNA has occurred at least five times during the worldwide spread of the clonal tumor, and that these five clades acquired their mtDNAs around 1,000 years ago. The sequences further suggest that there has been retention of ORFs, suggesting selection for function in the acquired DNAs. The data for the five clade hypothesis and horizontal transfer is convincing. The paper can be strengthened however in a few ways.</p>
<p>Essential revisions:</p>
<p>The reviewers felt this was a strong and important contribution to an interesting field. They identified several issues, however, that need to be addressed. These include:</p>
<p>1) Two reviewers raised the issue of the Indian-CTVT clade (IV), which implies highly non-clock-like evolutionary rates within the ancestor of the lineage. It is found at the end of fairly long branches and it may not be accurately placed within the phylogeny. One possibility is that this observation may be the result of the ML search that was performed [(Phyml with rudimentary branch swapping – a "combination of NNI and SPR")]. This approach may be insufficient to search treespace with such a large number of OTUs. The reviewers ask that the analysis be repeated with the newest version of RAxML which has more thorough search options. Alternatively, the authors should closely check the sequences or alignment as this could be due to minor alignment errors.</p>
<p>2) Two reviewers also raised the issue of the full-length mitochondrial NUMT that is found in the dog genome. The reviewers state that NuMTs are a major confounder in many species, and it was well-served to be addressed. However, over 150 NuMTs have been discovered in the canine genome. It is unclear how the wgsim recreation of reduced CTVT reads aligned to the canine genome would demonstrate how NuMTs are unlikely to contribute significantly to mtDNA variant calling. During CTVT evolution, particularly in an organism purported to engage in mictochondrial capture, it is likely that novel NuMTs were introduced that diverge from the canine genome. While the authors are likely correct that current mtDNA assemblies have not been compromised by NuMTs, if the NuMT is tandemly arrayed (as they are in many mammalian genomes) it could be highly multicopy and approach the read depth of the true cytoplasmic copies. The authors should check this by estimating read depth of the dog NuMT insertion within the nuclear genome and see if is collapsed and determine the expected depth based on this measurement, rather than assuming one copy. This will certainly raise the caliber of the paper.</p>
<p>3) The time estimate of 11,000 years cited in this work was estimated using a subset of extant canine variation to isolate ~1.9 million somatic mutations, and perform a strict clock approach based on the mutation signature of human medulloblastoma. Subsequent work used a more comprehensive catalog of canine variation resulting in a 50% reduction in total somatic mutations. A reanalysis of the timing of CTVT origin may be warranted and particularly useful for the field.</p>
<p>4) The authors discuss the phenomenon of mitochondrial recombination, but do not discuss the likelihood of heteroplasmy. If mitocapture is a mechanism prevalent in CTVT, it is likely that these tumors are heteroplasmic. Are the authors indicating that mitochondria from the original CTVT founder, or a subsequent host prior to Clade A is no longer present, and has been supplanted completely by now homoplastic horizontal transfer? The issue of tumor clonality / subclonality is not addressed.</p>
<p>5) The authors use an in-house variant caller that is based on paired tumor-normal samples. Since CTVT by its nature does not have a normal sample, why was another caller that did not rely on tumor /simulated normal used? Please explain.</p>
<p>6) Why was ploidy estimated to be 1.5 for CTVT and 2.0 for host? The reference indicates that CTVT is diploid.</p>
<p>7) Importantly, there is no indication of where the mtDNA alignments or variants, and low coverage nuclear data is deposited for future replication. This must be done <italic>prior</italic>
to acceptance of the paper for publication.</p>
</body>
</sub-article>
<sub-article id="SA2" article-type="reply"><front-stub><article-id pub-id-type="doi">10.7554/eLife.14552.034</article-id>
<title-group><article-title>Author response</article-title>
</title-group>
</front-stub>
<body><p>Essential revisions:</p>
<p><italic>The reviewers felt this was a strong and important contribution to an interesting field. They identified several issues, however, that need to be addressed. These include: 1) Two reviewers raised the issue of the Indian-CTVT clade (IV), which implies highly non-clock-like evolutionary rates within the ancestor of the lineage. It is found at the end of fairly long branches and it may not be accurately placed within the phylogeny. One possibility is that this observation may be the result of the ML search that was performed [(Phyml with rudimentary branch swapping – a "combination of NNI and SPR")]. This approach may be insufficient to search treespace with such a large number of OTUs. The reviewers ask that the analysis be repeated with the newest version of RAxML which has more thorough search options. Alternatively, the authors should closely check the sequences or alignment as this could be due to minor alignment errors.</italic>
We thank the reviewers for their comments regarding the phylogenetic position of CTVT clade 4 tumours in <xref ref-type="fig" rid="fig1">Figure 1A</xref>
, and for raising the concern that this group may be inaccurately positioned due to limitations in the phylogenetic analysis algorithm or errors in alignment.</p>
<p>We repeated the phylogenetic analysis shown in <xref ref-type="fig" rid="fig1">Figure 1A</xref>
using RAxML 8.2.6 using the default rapid hill climbing algorithm. The phylogenetic position of the clade 4 tumours was consistent between the PhyML and RAxML trees (see <xref ref-type="fig" rid="fig4">Author response image 1</xref>
). We have now included a statement in the Methods section: “Phylogenetic trees constructed using RAxML 8.2.6 with a rapid climbing algorithm and identical model specification were consistent with the phylogenetic trees obtained using PhyML.”<fig id="fig4" orientation="portrait" position="float"><object-id pub-id-type="doi">10.7554/eLife.14552.028</object-id>
<label>Author response image 1.</label>
<caption><title>Diagram showing phylogenetic trees constructed using PhyML and RAxML.</title>
<p><bold>DOI:</bold>
<ext-link ext-link-type="doi" xlink:href="10.7554/eLife.14552.028">http://dx.doi.org/10.7554/eLife.14552.028</ext-link>
</p>
</caption>
<graphic xlink:href="elife-14552-resp-fig1"></graphic>
</fig>
</p>
<p>In addition, we performed manual validation of each of the variants identified in CTVT clade 4 tumours, and visualised the alignment of clade 4 haplotypes to confirm the absence of alignment errors. We have added the following statement to the Methods section: “The long branch-lengths in CTVT clade 4 were further investigated by visually validating sequence alignments involving these samples.”</p>
<p>We would further like to clarify that we do not wish to imply that clade 4 mtDNA represents the “ancestor of the lineage”. Our interpretation of the data is that the clade 4 group is derived from one of the five distinct horizontal transfer events detected in our analysis; we do not believe that the clade 4 mtDNA was originally present within the founder CTVT dog.</p>
<p>2) Two reviewers also raised the issue of the full-length mitochondrial NUMT that is found in the dog genome. The reviewers state that NuMTs are a major confounder in many species, and it was well-served to be addressed. However, over 150 NuMTs have been discovered in the canine genome. It is unclear how the wgsim recreation of reduced CTVT reads aligned to the canine genome would demonstrate how NuMTs are unlikely to contribute significantly to mtDNA variant calling. During CTVT evolution, particularly in an organism purported to engage in mictochondrial capture, it is likely that novel NuMTs were introduced that diverge from the canine genome. While the authors are likely correct that current mtDNA assemblies have not been compromised by NuMTs, if the NuMT is tandemly arrayed (as they are in many mammalian genomes) it could be highly multicopy and approach the read depth of the true cytoplasmic copies. The authors should check this by estimating read depth of the dog NuMT insertion within the nuclear genome and see if is collapsed and determine the expected depth based on this measurement, rather than assuming one copy. This will certainly raise the caliber of the paper.</p>
<p>We appreciate the reviewers’ comment about nuclear copies of mitochondrial DNA (NuMTs). Further to the concern raised, we have expanded the Methods subsection entitled “Nuclear copies of mtDNA (NuMT) analysis” to clarify the rationale behind the NuMT analysis that we have performed and to provide further justification for our conclusion that NuMTs have not significantly impacted on our CTVT mtDNA variant catalogue.</p>
<p><italic>3) The time estimate of 11,000 years cited in this work was estimated using a subset of extant canine variation to isolate ~1.9 million somatic mutations, and perform a strict clock approach based on the mutation signature of human medulloblastoma. Subsequent work used a more comprehensive catalog of canine variation resulting in a 50% reduction in total somatic mutations. A reanalysis of the timing of CTVT origin may be warranted and particularly useful for the field.</italic>
</p>
<p>We thank the reviewers for raising this point regarding the timing of CTVT origin. We agree that future re-analysis of the timing of CTVT’s origin will be an important contribution to the field. However, we believe that re-analysis of the timing of CTVT origin is beyond the scope of this work, whose focus is on mtDNA evolution in CTVT (and as mtDNA in CTVT has been acquired by horizontal transfer, analysis of CTVT mtDNA cannot cast light on the timing of CTVT’s origin). Nevertheless, we are aware of the uncertainty in CTVT origin timing estimates, and have emphasised this uncertainty by stating “approximately” or “around” whenever 11,000 years is mentioned. Additionally, we have now cited the paper to which the reviewers refer (Decker et al., 2015) (see the Introduction).</p>
<p><italic>4) The authors discuss the phenomenon of mitochondrial recombination, but do not discuss the likelihood of heteroplasmy. If mitocapture is a mechanism prevalent in CTVT, it is likely that these tumors are heteroplasmic. Are the authors indicating that mitochondria from the original CTVT founder, or a subsequent host prior to Clade A is no longer present, and has been supplanted completely by now homoplastic horizontal transfer? The issue of tumor clonality / subclonality is not addressed.</italic>
We thank the reviewers for raising this interesting point. As the reviewers suggest, we do believe that the absence of haplotype-level heteroplasmy suggests that mtDNA horizontal transfer is either (i) not common or (ii) does not frequently reach levels that are detectable in our analysis. Following from this, we are indeed suggesting that the original CTVT mtDNA haplotype has been replaced and is no longer present, as stated in the third paragraph of the Results and Discussion section.</p>
<p>Following on from this, we would like to thank the reviewers for the very valid point regarding tumour subclonality. The variable VAFs reported in <xref ref-type="fig" rid="fig2">Figure 2</xref>
may well be due to both intracellular heteroplasmy as well as intercellular heterogeneity (subclonality). We have addressed this point by adding a sentence to the Methods section, reading “Tumour variants with normalised VAF<1 most likely represent heteroplasmic variants; however, we cannot exclude that these represent distinct cellular subclones harbouring distinct homoplasmic mtDNA populations”.</p>
<p><italic>5) The authors use an in-house variant caller that is based on paired tumor-normal samples. Since CTVT by its nature does not have a normal sample, why was another caller that did not rely on tumor /simulated normal used? Please explain.</italic>
We appreciate the reviewers’ concerns about the variant caller that we used in our analysis. The unavailability of matched normal DNA from the original founder dog that first gave rise to CTVT poses challenges for the computational analysis of CTVT. Somatic variant callers, which usually require paired tumour-normal samples, generally have greater sensitivity for variant detection and do not invoke underlying diploid segregation models. We selected CaVEMan as a variant caller, as this algorithm is widely used and validated as a somatic variant caller.</p>
<p><italic>6) Why was ploidy estimated to be 1.5 for CTVT and 2.0 for host? The reference indicates that CTVT is diploid.</italic>
We are very grateful to the reviewers for pointing out this error. The reference indeed indicates that CTVT is diploid and we have now corrected the calculations to reflect this (please see Results and discussion, first paragraph and subsection “DNA sequencing”, first paragraph).</p>
<p>7) Importantly, there is no indication of where the mtDNA alignments or variants, and low coverage nuclear data is deposited for future replication. This must be done prior to acceptance of the paper for publication.</p>
<p>Further information about deposition of the data associated with this study is detailed below:</p>
<p>a) The mtDNA data associated with this study are available in GenBank with accession numbers: KU290400 – KU291095.</p>
<p>b) All the variant lists are available as Supplementary datasets 1 and 2.</p>
<p>c) The low coverage sequence data associated with this study are available in the ENA with accession number ERP014691.</p>
</body>
</sub-article>
</pmc>
</record>
Pour manipuler ce document sous Unix (Dilib)
EXPLOR_STEP=$WICRI_ROOT/Wicri/Asie/explor/AustralieFrV1/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000647 | SxmlIndent | more
Ou
HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 000647 | SxmlIndent | more
Pour mettre un lien sur cette page dans le réseau Wicri
{{Explor lien |wiki= Wicri/Asie |area= AustralieFrV1 |flux= Pmc |étape= Corpus |type= RBID |clé= PMC:4869914 |texte= Mitochondrial genetic diversity, selection and recombination in a canine transmissible cancer }}
Pour générer des pages wiki
HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/RBID.i -Sk "pubmed:27185408" \ | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd \ | NlmPubMed2Wicri -a AustralieFrV1
![]() | This area was generated with Dilib version V0.6.33. | ![]() |