Serveur d'exploration sur les relations entre la France et l'Australie

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.

Prokineticin 1 induces a pro-inflammatory response in murine fetal membranes but does not induce preterm delivery

Identifieur interne : 001470 ( Ncbi/Merge ); précédent : 001469; suivant : 001471

Prokineticin 1 induces a pro-inflammatory response in murine fetal membranes but does not induce preterm delivery

Auteurs : Tamsin R M. Lannagan ; Martin R. Wilson ; Fiona Denison ; Jane E. Norman ; Rob D. Catalano ; Henry N. Jabbour

Source :

RBID : PMC:3805954

Abstract

The mechanisms that regulate the induction of term or preterm delivery (PTD) are not fully understood. Infection is known to play a role in the induction of pro-inflammatory cascades in uteroplacental tissues associated with preterm pathological parturition. Similar but not identical cascades are evident in term labour. In the current study, we used a mouse model to evaluate the role of prokineticins in term and preterm parturition. Prokineticins are multi-functioning secreted proteins that signal through G-protein-coupled receptors to induce gene expression, including genes important in inflammatory responses. Expression of prokineticins (Prok1 and Prok2) was quantified in murine uteroplacental tissues by QPCR in the days preceding labour (days 16–19). Prok1 mRNA expression increased significantly on D18 in fetal membranes (compared with D16) but not in uterus or placenta. Intrauterine injection of PROK1 on D17 induced fetal membrane mRNA expression of the pro-inflammatory mediators Il6, Il1b, Tnf, Cxcl2 and Cxcl5, which are not normally up-regulated until D19 of pregnancy. However, intrauterine injection of PROK1 did not result in PTD. As expected, injection of lipopolysaccharide (LPS) induced PTD, but this was not associated with changes in expression of Prok1 or its receptor (Prokr1) in fetal membranes. These results suggest that although Prok1 exhibits dynamic mRNA regulation in fetal membranes preceding labour and induces a pro-inflammatory response when injected into the uterus on D17, it is insufficient to induce PTD. Additionally, prokineticin up-regulation appears not to be part of the LPS-induced inflammatory response in mouse fetal membranes.


Url:
DOI: 10.1530/REP-13-0295
PubMed: 24051059
PubMed Central: 3805954

Links toward previous steps (curation, corpus...)


Links to Exploration step

PMC:3805954

Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Prokineticin 1 induces a pro-inflammatory response in murine fetal membranes but does not induce preterm delivery</title>
<author>
<name sortKey="Lannagan, Tamsin R M" sort="Lannagan, Tamsin R M" uniqKey="Lannagan T" first="Tamsin R M" last="Lannagan">Tamsin R M. Lannagan</name>
<affiliation>
<nlm:aff id="aff1"></nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff2"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Wilson, Martin R" sort="Wilson, Martin R" uniqKey="Wilson M" first="Martin R" last="Wilson">Martin R. Wilson</name>
<affiliation>
<nlm:aff id="aff1"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Denison, Fiona" sort="Denison, Fiona" uniqKey="Denison F" first="Fiona" last="Denison">Fiona Denison</name>
<affiliation>
<nlm:aff id="aff2"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Norman, Jane E" sort="Norman, Jane E" uniqKey="Norman J" first="Jane E" last="Norman">Jane E. Norman</name>
<affiliation>
<nlm:aff id="aff2"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Catalano, Rob D" sort="Catalano, Rob D" uniqKey="Catalano R" first="Rob D" last="Catalano">Rob D. Catalano</name>
<affiliation>
<nlm:aff id="aff1"></nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff2"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Jabbour, Henry N" sort="Jabbour, Henry N" uniqKey="Jabbour H" first="Henry N" last="Jabbour">Henry N. Jabbour</name>
<affiliation>
<nlm:aff id="aff1"></nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">24051059</idno>
<idno type="pmc">3805954</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3805954</idno>
<idno type="RBID">PMC:3805954</idno>
<idno type="doi">10.1530/REP-13-0295</idno>
<date when="2013">2013</date>
<idno type="wicri:Area/Pmc/Corpus">002D05</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">002D05</idno>
<idno type="wicri:Area/Pmc/Curation">002B55</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Curation">002B55</idno>
<idno type="wicri:Area/Pmc/Checkpoint">001933</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Checkpoint">001933</idno>
<idno type="wicri:Area/Ncbi/Merge">001470</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Prokineticin 1 induces a pro-inflammatory response in murine fetal membranes but does not induce preterm delivery</title>
<author>
<name sortKey="Lannagan, Tamsin R M" sort="Lannagan, Tamsin R M" uniqKey="Lannagan T" first="Tamsin R M" last="Lannagan">Tamsin R M. Lannagan</name>
<affiliation>
<nlm:aff id="aff1"></nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff2"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Wilson, Martin R" sort="Wilson, Martin R" uniqKey="Wilson M" first="Martin R" last="Wilson">Martin R. Wilson</name>
<affiliation>
<nlm:aff id="aff1"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Denison, Fiona" sort="Denison, Fiona" uniqKey="Denison F" first="Fiona" last="Denison">Fiona Denison</name>
<affiliation>
<nlm:aff id="aff2"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Norman, Jane E" sort="Norman, Jane E" uniqKey="Norman J" first="Jane E" last="Norman">Jane E. Norman</name>
<affiliation>
<nlm:aff id="aff2"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Catalano, Rob D" sort="Catalano, Rob D" uniqKey="Catalano R" first="Rob D" last="Catalano">Rob D. Catalano</name>
<affiliation>
<nlm:aff id="aff1"></nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff2"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Jabbour, Henry N" sort="Jabbour, Henry N" uniqKey="Jabbour H" first="Henry N" last="Jabbour">Henry N. Jabbour</name>
<affiliation>
<nlm:aff id="aff1"></nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">Reproduction (Cambridge, England)</title>
<idno type="ISSN">1470-1626</idno>
<idno type="eISSN">1741-7899</idno>
<imprint>
<date when="2013">2013</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<p>The mechanisms that regulate the induction of term or preterm delivery (PTD) are not fully understood. Infection is known to play a role in the induction of pro-inflammatory cascades in uteroplacental tissues associated with preterm pathological parturition. Similar but not identical cascades are evident in term labour. In the current study, we used a mouse model to evaluate the role of prokineticins in term and preterm parturition. Prokineticins are multi-functioning secreted proteins that signal through G-protein-coupled receptors to induce gene expression, including genes important in inflammatory responses. Expression of prokineticins (
<italic>Prok1</italic>
and
<italic>Prok2</italic>
) was quantified in murine uteroplacental tissues by QPCR in the days preceding labour (days 16–19).
<italic>Prok1</italic>
mRNA expression increased significantly on D18 in fetal membranes (compared with D16) but not in uterus or placenta. Intrauterine injection of PROK1 on D17 induced fetal membrane mRNA expression of the pro-inflammatory mediators
<italic>Il6</italic>
,
<italic>Il1b</italic>
,
<italic>Tnf</italic>
,
<italic>Cxcl2</italic>
and
<italic>Cxcl5</italic>
, which are not normally up-regulated until D19 of pregnancy. However, intrauterine injection of PROK1 did not result in PTD. As expected, injection of lipopolysaccharide (LPS) induced PTD, but this was not associated with changes in expression of
<italic>Prok1</italic>
or its receptor (
<italic>Prokr1</italic>
) in fetal membranes. These results suggest that although
<italic>Prok1</italic>
exhibits dynamic mRNA regulation in fetal membranes preceding labour and induces a pro-inflammatory response when injected into the uterus on D17, it is insufficient to induce PTD. Additionally, prokineticin up-regulation appears not to be part of the LPS-induced inflammatory response in mouse fetal membranes.</p>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Akira, S" uniqKey="Akira S">S Akira</name>
</author>
<author>
<name sortKey="Uematsu, S" uniqKey="Uematsu S">S Uematsu</name>
</author>
<author>
<name sortKey="Takeuchi, O" uniqKey="Takeuchi O">O Takeuchi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Allport, Vc" uniqKey="Allport V">VC Allport</name>
</author>
<author>
<name sortKey="Pieber, D" uniqKey="Pieber D">D Pieber</name>
</author>
<author>
<name sortKey="Slater, Dm" uniqKey="Slater D">DM Slater</name>
</author>
<author>
<name sortKey="Newton, R" uniqKey="Newton R">R Newton</name>
</author>
<author>
<name sortKey="White, Jo" uniqKey="White J">JO White</name>
</author>
<author>
<name sortKey="Bennett, Pr" uniqKey="Bennett P">PR Bennett</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Beck, S" uniqKey="Beck S">S Beck</name>
</author>
<author>
<name sortKey="Wojdyla, D" uniqKey="Wojdyla D">D Wojdyla</name>
</author>
<author>
<name sortKey="Say, L" uniqKey="Say L">L Say</name>
</author>
<author>
<name sortKey="Betran, Ap" uniqKey="Betran A">AP Betran</name>
</author>
<author>
<name sortKey="Merialdi, M" uniqKey="Merialdi M">M Merialdi</name>
</author>
<author>
<name sortKey="Requejo, Jh" uniqKey="Requejo J">JH Requejo</name>
</author>
<author>
<name sortKey="Rubens, C" uniqKey="Rubens C">C Rubens</name>
</author>
<author>
<name sortKey="Menon, R" uniqKey="Menon R">R Menon</name>
</author>
<author>
<name sortKey="Van Look, Pf" uniqKey="Van Look P">PF Van Look</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bollapragada, S" uniqKey="Bollapragada S">S Bollapragada</name>
</author>
<author>
<name sortKey="Youssef, R" uniqKey="Youssef R">R Youssef</name>
</author>
<author>
<name sortKey="Jordan, F" uniqKey="Jordan F">F Jordan</name>
</author>
<author>
<name sortKey="Greer, I" uniqKey="Greer I">I Greer</name>
</author>
<author>
<name sortKey="Norman, J" uniqKey="Norman J">J Norman</name>
</author>
<author>
<name sortKey="Nelson, S" uniqKey="Nelson S">S Nelson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bowen, Jm" uniqKey="Bowen J">JM Bowen</name>
</author>
<author>
<name sortKey="Chamley, L" uniqKey="Chamley L">L Chamley</name>
</author>
<author>
<name sortKey="Keelan, Ja" uniqKey="Keelan J">JA Keelan</name>
</author>
<author>
<name sortKey="Mitchell, Md" uniqKey="Mitchell M">MD Mitchell</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Burd, I" uniqKey="Burd I">I Burd</name>
</author>
<author>
<name sortKey="Bentz, Ai" uniqKey="Bentz A">AI Bentz</name>
</author>
<author>
<name sortKey="Chai, J" uniqKey="Chai J">J Chai</name>
</author>
<author>
<name sortKey="Gonzalez, J" uniqKey="Gonzalez J">J Gonzalez</name>
</author>
<author>
<name sortKey="Monnerie, H" uniqKey="Monnerie H">H Monnerie</name>
</author>
<author>
<name sortKey="Le Roux, Pd" uniqKey="Le Roux P">PD Le Roux</name>
</author>
<author>
<name sortKey="Cohen, As" uniqKey="Cohen A">AS Cohen</name>
</author>
<author>
<name sortKey="Yudkoff, M" uniqKey="Yudkoff M">M Yudkoff</name>
</author>
<author>
<name sortKey="Elovitz, Ma" uniqKey="Elovitz M">MA Elovitz</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Catalano, Rd" uniqKey="Catalano R">RD Catalano</name>
</author>
<author>
<name sortKey="Lannagan, Tr" uniqKey="Lannagan T">TR Lannagan</name>
</author>
<author>
<name sortKey="Gorowiec, M" uniqKey="Gorowiec M">M Gorowiec</name>
</author>
<author>
<name sortKey="Denison, Fc" uniqKey="Denison F">FC Denison</name>
</author>
<author>
<name sortKey="Norman, Je" uniqKey="Norman J">JE Norman</name>
</author>
<author>
<name sortKey="Jabbour, Hn" uniqKey="Jabbour H">HN Jabbour</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Catalano, Rd" uniqKey="Catalano R">RD Catalano</name>
</author>
<author>
<name sortKey="Wilson, Mr" uniqKey="Wilson M">MR Wilson</name>
</author>
<author>
<name sortKey="Boddy, Sc" uniqKey="Boddy S">SC Boddy</name>
</author>
<author>
<name sortKey="Jabbour, Hn" uniqKey="Jabbour H">HN Jabbour</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Challis, Jr" uniqKey="Challis J">JR Challis</name>
</author>
<author>
<name sortKey="Lye, Sj" uniqKey="Lye S">SJ Lye</name>
</author>
<author>
<name sortKey="Gibb, W" uniqKey="Gibb W">W Gibb</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Challis, Jr" uniqKey="Challis J">JR Challis</name>
</author>
<author>
<name sortKey="Lockwood, Cj" uniqKey="Lockwood C">CJ Lockwood</name>
</author>
<author>
<name sortKey="Myatt, L" uniqKey="Myatt L">L Myatt</name>
</author>
<author>
<name sortKey="Norman, Je" uniqKey="Norman J">JE Norman</name>
</author>
<author>
<name sortKey="Strauss, Jf" uniqKey="Strauss J">JF Strauss</name>
</author>
<author>
<name sortKey="Petraglia, F" uniqKey="Petraglia F">F Petraglia</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cheng, My" uniqKey="Cheng M">MY Cheng</name>
</author>
<author>
<name sortKey="Bittman, El" uniqKey="Bittman E">EL Bittman</name>
</author>
<author>
<name sortKey="Hattar, S" uniqKey="Hattar S">S Hattar</name>
</author>
<author>
<name sortKey="Zhou, Qy" uniqKey="Zhou Q">QY Zhou</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Condon, Jc" uniqKey="Condon J">JC Condon</name>
</author>
<author>
<name sortKey="Jeyasuria, P" uniqKey="Jeyasuria P">P Jeyasuria</name>
</author>
<author>
<name sortKey="Faust, Jm" uniqKey="Faust J">JM Faust</name>
</author>
<author>
<name sortKey="Mendelson, Cr" uniqKey="Mendelson C">CR Mendelson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Denison, Fc" uniqKey="Denison F">FC Denison</name>
</author>
<author>
<name sortKey="Kelly, Rw" uniqKey="Kelly R">RW Kelly</name>
</author>
<author>
<name sortKey="Calder, Aa" uniqKey="Calder A">AA Calder</name>
</author>
<author>
<name sortKey="Riley, Sc" uniqKey="Riley S">SC Riley</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Denison, Fc" uniqKey="Denison F">FC Denison</name>
</author>
<author>
<name sortKey="Battersby, S" uniqKey="Battersby S">S Battersby</name>
</author>
<author>
<name sortKey="King, Ae" uniqKey="King A">AE King</name>
</author>
<author>
<name sortKey="Szuber, M" uniqKey="Szuber M">M Szuber</name>
</author>
<author>
<name sortKey="Jabbour, Hn" uniqKey="Jabbour H">HN Jabbour</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dorsch, M" uniqKey="Dorsch M">M Dorsch</name>
</author>
<author>
<name sortKey="Qiu, Y" uniqKey="Qiu Y">Y Qiu</name>
</author>
<author>
<name sortKey="Soler, D" uniqKey="Soler D">D Soler</name>
</author>
<author>
<name sortKey="Frank, N" uniqKey="Frank N">N Frank</name>
</author>
<author>
<name sortKey="Duong, T" uniqKey="Duong T">T Duong</name>
</author>
<author>
<name sortKey="Goodearl, A" uniqKey="Goodearl A">A Goodearl</name>
</author>
<author>
<name sortKey="O Neil, S" uniqKey="O Neil S">S O'Neil</name>
</author>
<author>
<name sortKey="Lora, J" uniqKey="Lora J">J Lora</name>
</author>
<author>
<name sortKey="Fraser, Cc" uniqKey="Fraser C">CC Fraser</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Doyle, Sl" uniqKey="Doyle S">SL Doyle</name>
</author>
<author>
<name sortKey="O Neill, La" uniqKey="O Neill L">LA O'Neill</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Elovitz, Ma" uniqKey="Elovitz M">MA Elovitz</name>
</author>
<author>
<name sortKey="Wang, Z" uniqKey="Wang Z">Z Wang</name>
</author>
<author>
<name sortKey="Chien, Ek" uniqKey="Chien E">EK Chien</name>
</author>
<author>
<name sortKey="Rychlik, Df" uniqKey="Rychlik D">DF Rychlik</name>
</author>
<author>
<name sortKey="Phillippe, M" uniqKey="Phillippe M">M Phillippe</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Evans, J" uniqKey="Evans J">J Evans</name>
</author>
<author>
<name sortKey="Catalano, Rd" uniqKey="Catalano R">RD Catalano</name>
</author>
<author>
<name sortKey="Morgan, K" uniqKey="Morgan K">K Morgan</name>
</author>
<author>
<name sortKey="Critchley, Ho" uniqKey="Critchley H">HO Critchley</name>
</author>
<author>
<name sortKey="Millar, Rp" uniqKey="Millar R">RP Millar</name>
</author>
<author>
<name sortKey="Jabbour, Hn" uniqKey="Jabbour H">HN Jabbour</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Evans, J" uniqKey="Evans J">J Evans</name>
</author>
<author>
<name sortKey="Catalano, Rd" uniqKey="Catalano R">RD Catalano</name>
</author>
<author>
<name sortKey="Brown, P" uniqKey="Brown P">P Brown</name>
</author>
<author>
<name sortKey="Sherwin, R" uniqKey="Sherwin R">R Sherwin</name>
</author>
<author>
<name sortKey="Critchley, Ho" uniqKey="Critchley H">HO Critchley</name>
</author>
<author>
<name sortKey="Fazleabas, At" uniqKey="Fazleabas A">AT Fazleabas</name>
</author>
<author>
<name sortKey="Jabbour, Hn" uniqKey="Jabbour H">HN Jabbour</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fitzgibbon, J" uniqKey="Fitzgibbon J">J Fitzgibbon</name>
</author>
<author>
<name sortKey="Morrison, Jj" uniqKey="Morrison J">JJ Morrison</name>
</author>
<author>
<name sortKey="Smith, Tj" uniqKey="Smith T">TJ Smith</name>
</author>
<author>
<name sortKey="O Brien, M" uniqKey="O Brien M">M O'Brien</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Friebe Hoffmann, U" uniqKey="Friebe Hoffmann U">U Friebe-Hoffmann</name>
</author>
<author>
<name sortKey="Chiao, Jp" uniqKey="Chiao J">JP Chiao</name>
</author>
<author>
<name sortKey="Rauk, Pn" uniqKey="Rauk P">PN Rauk</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Goepfert, Ar" uniqKey="Goepfert A">AR Goepfert</name>
</author>
<author>
<name sortKey="Andrews, Ww" uniqKey="Andrews W">WW Andrews</name>
</author>
<author>
<name sortKey="Carlo, W" uniqKey="Carlo W">W Carlo</name>
</author>
<author>
<name sortKey="Ramsey, Ps" uniqKey="Ramsey P">PS Ramsey</name>
</author>
<author>
<name sortKey="Cliver, Sp" uniqKey="Cliver S">SP Cliver</name>
</author>
<author>
<name sortKey="Goldenberg, Rl" uniqKey="Goldenberg R">RL Goldenberg</name>
</author>
<author>
<name sortKey="Hauth, Jc" uniqKey="Hauth J">JC Hauth</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Goldenberg, Rl" uniqKey="Goldenberg R">RL Goldenberg</name>
</author>
<author>
<name sortKey="Hauth, Jc" uniqKey="Hauth J">JC Hauth</name>
</author>
<author>
<name sortKey="Andrews, Ww" uniqKey="Andrews W">WW Andrews</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Goldenberg, Rl" uniqKey="Goldenberg R">RL Goldenberg</name>
</author>
<author>
<name sortKey="Culhane, Jf" uniqKey="Culhane J">JF Culhane</name>
</author>
<author>
<name sortKey="Iams, Jd" uniqKey="Iams J">JD Iams</name>
</author>
<author>
<name sortKey="Romero, R" uniqKey="Romero R">R Romero</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Golightly, E" uniqKey="Golightly E">E Golightly</name>
</author>
<author>
<name sortKey="Jabbour, Hn" uniqKey="Jabbour H">HN Jabbour</name>
</author>
<author>
<name sortKey="Norman, Je" uniqKey="Norman J">JE Norman</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gomez Lopez, N" uniqKey="Gomez Lopez N">N Gomez-Lopez</name>
</author>
<author>
<name sortKey="Laresgoiti Servitje, E" uniqKey="Laresgoiti Servitje E">E Laresgoiti-Servitje</name>
</author>
<author>
<name sortKey="Olson, Dm" uniqKey="Olson D">DM Olson</name>
</author>
<author>
<name sortKey="Estrada Gutierrez, G" uniqKey="Estrada Gutierrez G">G Estrada-Gutierrez</name>
</author>
<author>
<name sortKey="Vadillo Ortega, F" uniqKey="Vadillo Ortega F">F Vadillo-Ortega</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gonzalez, Jm" uniqKey="Gonzalez J">JM Gonzalez</name>
</author>
<author>
<name sortKey="Franzke, Cw" uniqKey="Franzke C">CW Franzke</name>
</author>
<author>
<name sortKey="Yang, F" uniqKey="Yang F">F Yang</name>
</author>
<author>
<name sortKey="Romero, R" uniqKey="Romero R">R Romero</name>
</author>
<author>
<name sortKey="Girardi, G" uniqKey="Girardi G">G Girardi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gorowiec, Mr" uniqKey="Gorowiec M">MR Gorowiec</name>
</author>
<author>
<name sortKey="Catalano, Rd" uniqKey="Catalano R">RD Catalano</name>
</author>
<author>
<name sortKey="Norman, Je" uniqKey="Norman J">JE Norman</name>
</author>
<author>
<name sortKey="Denison, Fc" uniqKey="Denison F">FC Denison</name>
</author>
<author>
<name sortKey="Jabbour, Hn" uniqKey="Jabbour H">HN Jabbour</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gross, G" uniqKey="Gross G">G Gross</name>
</author>
<author>
<name sortKey="Imamura, T" uniqKey="Imamura T">T Imamura</name>
</author>
<author>
<name sortKey="Vogt, Sk" uniqKey="Vogt S">SK Vogt</name>
</author>
<author>
<name sortKey="Wozniak, Df" uniqKey="Wozniak D">DF Wozniak</name>
</author>
<author>
<name sortKey="Nelson, Dm" uniqKey="Nelson D">DM Nelson</name>
</author>
<author>
<name sortKey="Sadovsky, Y" uniqKey="Sadovsky Y">Y Sadovsky</name>
</author>
<author>
<name sortKey="Muglia, Lj" uniqKey="Muglia L">LJ Muglia</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Haddad, R" uniqKey="Haddad R">R Haddad</name>
</author>
<author>
<name sortKey="Tromp, G" uniqKey="Tromp G">G Tromp</name>
</author>
<author>
<name sortKey="Kuivaniemi, H" uniqKey="Kuivaniemi H">H Kuivaniemi</name>
</author>
<author>
<name sortKey="Chaiworapongsa, T" uniqKey="Chaiworapongsa T">T Chaiworapongsa</name>
</author>
<author>
<name sortKey="Kim, Ym" uniqKey="Kim Y">YM Kim</name>
</author>
<author>
<name sortKey="Mazor, M" uniqKey="Mazor M">M Mazor</name>
</author>
<author>
<name sortKey="Romero, R" uniqKey="Romero R">R Romero</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Harju, K" uniqKey="Harju K">K Harju</name>
</author>
<author>
<name sortKey="Ojaniemi, M" uniqKey="Ojaniemi M">M Ojaniemi</name>
</author>
<author>
<name sortKey="Rounioja, S" uniqKey="Rounioja S">S Rounioja</name>
</author>
<author>
<name sortKey="Glumoff, V" uniqKey="Glumoff V">V Glumoff</name>
</author>
<author>
<name sortKey="Paananen, R" uniqKey="Paananen R">R Paananen</name>
</author>
<author>
<name sortKey="Vuolteenaho, R" uniqKey="Vuolteenaho R">R Vuolteenaho</name>
</author>
<author>
<name sortKey="Hallman, M" uniqKey="Hallman M">M Hallman</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hoffmann, P" uniqKey="Hoffmann P">P Hoffmann</name>
</author>
<author>
<name sortKey="Feige, Jj" uniqKey="Feige J">JJ Feige</name>
</author>
<author>
<name sortKey="Alfaidy, N" uniqKey="Alfaidy N">N Alfaidy</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hoffmann, P" uniqKey="Hoffmann P">P Hoffmann</name>
</author>
<author>
<name sortKey="Feige, Jj" uniqKey="Feige J">JJ Feige</name>
</author>
<author>
<name sortKey="Alfaidy, N" uniqKey="Alfaidy N">N Alfaidy</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hoffmann, P" uniqKey="Hoffmann P">P Hoffmann</name>
</author>
<author>
<name sortKey="Saoudi, Y" uniqKey="Saoudi Y">Y Saoudi</name>
</author>
<author>
<name sortKey="Benharouga, M" uniqKey="Benharouga M">M Benharouga</name>
</author>
<author>
<name sortKey="Graham, Ch" uniqKey="Graham C">CH Graham</name>
</author>
<author>
<name sortKey="Schaal, Jp" uniqKey="Schaal J">JP Schaal</name>
</author>
<author>
<name sortKey="Mazouni, C" uniqKey="Mazouni C">C Mazouni</name>
</author>
<author>
<name sortKey="Feige, Jj" uniqKey="Feige J">JJ Feige</name>
</author>
<author>
<name sortKey="Alfaidy, N" uniqKey="Alfaidy N">N Alfaidy</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jobe, Ah" uniqKey="Jobe A">AH Jobe</name>
</author>
<author>
<name sortKey="Ikegami, M" uniqKey="Ikegami M">M Ikegami</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kallapur, Sg" uniqKey="Kallapur S">SG Kallapur</name>
</author>
<author>
<name sortKey="Moss, Tj" uniqKey="Moss T">TJ Moss</name>
</author>
<author>
<name sortKey="Ikegami, M" uniqKey="Ikegami M">M Ikegami</name>
</author>
<author>
<name sortKey="Jasman, Rl" uniqKey="Jasman R">RL Jasman</name>
</author>
<author>
<name sortKey="Newnham, Jp" uniqKey="Newnham J">JP Newnham</name>
</author>
<author>
<name sortKey="Jobe, Ah" uniqKey="Jobe A">AH Jobe</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Keelan, Ja" uniqKey="Keelan J">JA Keelan</name>
</author>
<author>
<name sortKey="Yang, J" uniqKey="Yang J">J Yang</name>
</author>
<author>
<name sortKey="Romero, Rj" uniqKey="Romero R">RJ Romero</name>
</author>
<author>
<name sortKey="Chaiworapongsa, T" uniqKey="Chaiworapongsa T">T Chaiworapongsa</name>
</author>
<author>
<name sortKey="Marvin, Kw" uniqKey="Marvin K">KW Marvin</name>
</author>
<author>
<name sortKey="Sato, Ta" uniqKey="Sato T">TA Sato</name>
</author>
<author>
<name sortKey="Mitchell, Md" uniqKey="Mitchell M">MD Mitchell</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kelly, Rw" uniqKey="Kelly R">RW Kelly</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lecouter, J" uniqKey="Lecouter J">J LeCouter</name>
</author>
<author>
<name sortKey="Kowalski, J" uniqKey="Kowalski J">J Kowalski</name>
</author>
<author>
<name sortKey="Foster, J" uniqKey="Foster J">J Foster</name>
</author>
<author>
<name sortKey="Hass, P" uniqKey="Hass P">P Hass</name>
</author>
<author>
<name sortKey="Zhang, Z" uniqKey="Zhang Z">Z Zhang</name>
</author>
<author>
<name sortKey="Dillard Telm, L" uniqKey="Dillard Telm L">L Dillard-Telm</name>
</author>
<author>
<name sortKey="Frantz, G" uniqKey="Frantz G">G Frantz</name>
</author>
<author>
<name sortKey="Rangell, L" uniqKey="Rangell L">L Rangell</name>
</author>
<author>
<name sortKey="Deguzman, L" uniqKey="Deguzman L">L DeGuzman</name>
</author>
<author>
<name sortKey="Keller, Ga" uniqKey="Keller G">GA Keller</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Li, M" uniqKey="Li M">M Li</name>
</author>
<author>
<name sortKey="Bullock, Cm" uniqKey="Bullock C">CM Bullock</name>
</author>
<author>
<name sortKey="Knauer, Dj" uniqKey="Knauer D">DJ Knauer</name>
</author>
<author>
<name sortKey="Ehlert, Fj" uniqKey="Ehlert F">FJ Ehlert</name>
</author>
<author>
<name sortKey="Zhou, Qy" uniqKey="Zhou Q">QY Zhou</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Maldonado Perez, D" uniqKey="Maldonado Perez D">D Maldonado-Perez</name>
</author>
<author>
<name sortKey="Evans, J" uniqKey="Evans J">J Evans</name>
</author>
<author>
<name sortKey="Denison, F" uniqKey="Denison F">F Denison</name>
</author>
<author>
<name sortKey="Millar, Rp" uniqKey="Millar R">RP Millar</name>
</author>
<author>
<name sortKey="Jabbour, Hn" uniqKey="Jabbour H">HN Jabbour</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Maldonado Perez, D" uniqKey="Maldonado Perez D">D Maldonado-Perez</name>
</author>
<author>
<name sortKey="Brown, P" uniqKey="Brown P">P Brown</name>
</author>
<author>
<name sortKey="Morgan, K" uniqKey="Morgan K">K Morgan</name>
</author>
<author>
<name sortKey="Millar, Rp" uniqKey="Millar R">RP Millar</name>
</author>
<author>
<name sortKey="Thompson, Ea" uniqKey="Thompson E">EA Thompson</name>
</author>
<author>
<name sortKey="Jabbour, Hn" uniqKey="Jabbour H">HN Jabbour</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Menon, R" uniqKey="Menon R">R Menon</name>
</author>
<author>
<name sortKey="Fortunato, Sj" uniqKey="Fortunato S">SJ Fortunato</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Monnier, J" uniqKey="Monnier J">J Monnier</name>
</author>
<author>
<name sortKey="Samson, M" uniqKey="Samson M">M Samson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Myatt, L" uniqKey="Myatt L">L Myatt</name>
</author>
<author>
<name sortKey="Sun, K" uniqKey="Sun K">K Sun</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Negri, L" uniqKey="Negri L">L Negri</name>
</author>
<author>
<name sortKey="Lattanzi, R" uniqKey="Lattanzi R">R Lattanzi</name>
</author>
<author>
<name sortKey="Giannini, E" uniqKey="Giannini E">E Giannini</name>
</author>
<author>
<name sortKey="Metere, A" uniqKey="Metere A">A Metere</name>
</author>
<author>
<name sortKey="Colucci, M" uniqKey="Colucci M">M Colucci</name>
</author>
<author>
<name sortKey="Barra, D" uniqKey="Barra D">D Barra</name>
</author>
<author>
<name sortKey="Kreil, G" uniqKey="Kreil G">G Kreil</name>
</author>
<author>
<name sortKey="Melchiorri, P" uniqKey="Melchiorri P">P Melchiorri</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ngan, Es" uniqKey="Ngan E">ES Ngan</name>
</author>
<author>
<name sortKey="Tam, Pk" uniqKey="Tam P">PK Tam</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Norman, Je" uniqKey="Norman J">JE Norman</name>
</author>
<author>
<name sortKey="Morris, C" uniqKey="Morris C">C Morris</name>
</author>
<author>
<name sortKey="Chalmers, J" uniqKey="Chalmers J">J Chalmers</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Orsi, Nm" uniqKey="Orsi N">NM Orsi</name>
</author>
<author>
<name sortKey="Gopichandran, N" uniqKey="Gopichandran N">N Gopichandran</name>
</author>
<author>
<name sortKey="Bulsara, H" uniqKey="Bulsara H">H Bulsara</name>
</author>
<author>
<name sortKey="Ekbote, Uv" uniqKey="Ekbote U">UV Ekbote</name>
</author>
<author>
<name sortKey="Walker, Jj" uniqKey="Walker J">JJ Walker</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Osman, I" uniqKey="Osman I">I Osman</name>
</author>
<author>
<name sortKey="Young, A" uniqKey="Young A">A Young</name>
</author>
<author>
<name sortKey="Ledingham, Ma" uniqKey="Ledingham M">MA Ledingham</name>
</author>
<author>
<name sortKey="Thomson, Aj" uniqKey="Thomson A">AJ Thomson</name>
</author>
<author>
<name sortKey="Jordan, F" uniqKey="Jordan F">F Jordan</name>
</author>
<author>
<name sortKey="Greer, Ia" uniqKey="Greer I">IA Greer</name>
</author>
<author>
<name sortKey="Norman, Je" uniqKey="Norman J">JE Norman</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Osman, I" uniqKey="Osman I">I Osman</name>
</author>
<author>
<name sortKey="Young, A" uniqKey="Young A">A Young</name>
</author>
<author>
<name sortKey="Jordan, F" uniqKey="Jordan F">F Jordan</name>
</author>
<author>
<name sortKey="Greer, Ia" uniqKey="Greer I">IA Greer</name>
</author>
<author>
<name sortKey="Norman, Je" uniqKey="Norman J">JE Norman</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Peltier, Mr" uniqKey="Peltier M">MR Peltier</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pirianov, G" uniqKey="Pirianov G">G Pirianov</name>
</author>
<author>
<name sortKey="Waddington, Sn" uniqKey="Waddington S">SN Waddington</name>
</author>
<author>
<name sortKey="Lindstrom, Tm" uniqKey="Lindstrom T">TM Lindstrom</name>
</author>
<author>
<name sortKey="Terzidou, V" uniqKey="Terzidou V">V Terzidou</name>
</author>
<author>
<name sortKey="Mehmet, H" uniqKey="Mehmet H">H Mehmet</name>
</author>
<author>
<name sortKey="Bennett, Pr" uniqKey="Bennett P">PR Bennett</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Reznikov, Ll" uniqKey="Reznikov L">LL Reznikov</name>
</author>
<author>
<name sortKey="Fantuzzi, G" uniqKey="Fantuzzi G">G Fantuzzi</name>
</author>
<author>
<name sortKey="Selzman, Ch" uniqKey="Selzman C">CH Selzman</name>
</author>
<author>
<name sortKey="Shames, Bd" uniqKey="Shames B">BD Shames</name>
</author>
<author>
<name sortKey="Barton, Ha" uniqKey="Barton H">HA Barton</name>
</author>
<author>
<name sortKey="Bell, H" uniqKey="Bell H">H Bell</name>
</author>
<author>
<name sortKey="Mcgregor, Ja" uniqKey="Mcgregor J">JA McGregor</name>
</author>
<author>
<name sortKey="Dinarello, Ca" uniqKey="Dinarello C">CA Dinarello</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Robertson, Sa" uniqKey="Robertson S">SA Robertson</name>
</author>
<author>
<name sortKey="Christiaens, I" uniqKey="Christiaens I">I Christiaens</name>
</author>
<author>
<name sortKey="Dorian, Cl" uniqKey="Dorian C">CL Dorian</name>
</author>
<author>
<name sortKey="Zaragoza, Db" uniqKey="Zaragoza D">DB Zaragoza</name>
</author>
<author>
<name sortKey="Care, As" uniqKey="Care A">AS Care</name>
</author>
<author>
<name sortKey="Banks, Am" uniqKey="Banks A">AM Banks</name>
</author>
<author>
<name sortKey="Olson, Dm" uniqKey="Olson D">DM Olson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Romero, R" uniqKey="Romero R">R Romero</name>
</author>
<author>
<name sortKey="Espinoza, J" uniqKey="Espinoza J">J Espinoza</name>
</author>
<author>
<name sortKey="Goncalves, Lf" uniqKey="Goncalves L">LF Goncalves</name>
</author>
<author>
<name sortKey="Kusanovic, Jp" uniqKey="Kusanovic J">JP Kusanovic</name>
</author>
<author>
<name sortKey="Friel, La" uniqKey="Friel L">LA Friel</name>
</author>
<author>
<name sortKey="Nien, Jk" uniqKey="Nien J">JK Nien</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sato, Ta" uniqKey="Sato T">TA Sato</name>
</author>
<author>
<name sortKey="Gupta, Dk" uniqKey="Gupta D">DK Gupta</name>
</author>
<author>
<name sortKey="Keelan, Ja" uniqKey="Keelan J">JA Keelan</name>
</author>
<author>
<name sortKey="Marvin, Kw" uniqKey="Marvin K">KW Marvin</name>
</author>
<author>
<name sortKey="Mitchell, Md" uniqKey="Mitchell M">MD Mitchell</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shaw, Jl" uniqKey="Shaw J">JL Shaw</name>
</author>
<author>
<name sortKey="Denison, Fc" uniqKey="Denison F">FC Denison</name>
</author>
<author>
<name sortKey="Evans, J" uniqKey="Evans J">J Evans</name>
</author>
<author>
<name sortKey="Durno, K" uniqKey="Durno K">K Durno</name>
</author>
<author>
<name sortKey="Williams, Ar" uniqKey="Williams A">AR Williams</name>
</author>
<author>
<name sortKey="Entrican, G" uniqKey="Entrican G">G Entrican</name>
</author>
<author>
<name sortKey="Critchley, Ho" uniqKey="Critchley H">HO Critchley</name>
</author>
<author>
<name sortKey="Jabbour, Hn" uniqKey="Jabbour H">HN Jabbour</name>
</author>
<author>
<name sortKey="Horne, Aw" uniqKey="Horne A">AW Horne</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Thiex, Nw" uniqKey="Thiex N">NW Thiex</name>
</author>
<author>
<name sortKey="Chames, Mc" uniqKey="Chames M">MC Chames</name>
</author>
<author>
<name sortKey="Loch Caruso, Rk" uniqKey="Loch Caruso R">RK Loch-Caruso</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Thomson, Aj" uniqKey="Thomson A">AJ Thomson</name>
</author>
<author>
<name sortKey="Telfer, Jf" uniqKey="Telfer J">JF Telfer</name>
</author>
<author>
<name sortKey="Young, A" uniqKey="Young A">A Young</name>
</author>
<author>
<name sortKey="Campbell, S" uniqKey="Campbell S">S Campbell</name>
</author>
<author>
<name sortKey="Stewart, Cj" uniqKey="Stewart C">CJ Stewart</name>
</author>
<author>
<name sortKey="Cameron, It" uniqKey="Cameron I">IT Cameron</name>
</author>
<author>
<name sortKey="Greer, Ia" uniqKey="Greer I">IA Greer</name>
</author>
<author>
<name sortKey="Norman, Je" uniqKey="Norman J">JE Norman</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Timmons, Bc" uniqKey="Timmons B">BC Timmons</name>
</author>
<author>
<name sortKey="Mahendroo, Ms" uniqKey="Mahendroo M">MS Mahendroo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Timmons, B" uniqKey="Timmons B">B Timmons</name>
</author>
<author>
<name sortKey="Akins, M" uniqKey="Akins M">M Akins</name>
</author>
<author>
<name sortKey="Mahendroo, M" uniqKey="Mahendroo M">M Mahendroo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tornblom, Sa" uniqKey="Tornblom S">SA Tornblom</name>
</author>
<author>
<name sortKey="Klimaviciute, A" uniqKey="Klimaviciute A">A Klimaviciute</name>
</author>
<author>
<name sortKey="Bystrom, B" uniqKey="Bystrom B">B Bystrom</name>
</author>
<author>
<name sortKey="Chromek, M" uniqKey="Chromek M">M Chromek</name>
</author>
<author>
<name sortKey="Brauner, A" uniqKey="Brauner A">A Brauner</name>
</author>
<author>
<name sortKey="Ekman Ordeberg, G" uniqKey="Ekman Ordeberg G">G Ekman-Ordeberg</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tribe, Rm" uniqKey="Tribe R">RM Tribe</name>
</author>
<author>
<name sortKey="Moriarty, P" uniqKey="Moriarty P">P Moriarty</name>
</author>
<author>
<name sortKey="Dalrymple, A" uniqKey="Dalrymple A">A Dalrymple</name>
</author>
<author>
<name sortKey="Hassoni, Aa" uniqKey="Hassoni A">AA Hassoni</name>
</author>
<author>
<name sortKey="Poston, L" uniqKey="Poston L">L Poston</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Waddell, Jm" uniqKey="Waddell J">JM Waddell</name>
</author>
<author>
<name sortKey="Evans, J" uniqKey="Evans J">J Evans</name>
</author>
<author>
<name sortKey="Jabbour, Hn" uniqKey="Jabbour H">HN Jabbour</name>
</author>
<author>
<name sortKey="Denison, Fc" uniqKey="Denison F">FC Denison</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wade, Pr" uniqKey="Wade P">PR Wade</name>
</author>
<author>
<name sortKey="Palmer, Jm" uniqKey="Palmer J">JM Palmer</name>
</author>
<author>
<name sortKey="Mabus, J" uniqKey="Mabus J">J Mabus</name>
</author>
<author>
<name sortKey="Saunders, Pr" uniqKey="Saunders P">PR Saunders</name>
</author>
<author>
<name sortKey="Prouty, S" uniqKey="Prouty S">S Prouty</name>
</author>
<author>
<name sortKey="Chevalier, K" uniqKey="Chevalier K">K Chevalier</name>
</author>
<author>
<name sortKey="Gareau, Mg" uniqKey="Gareau M">MG Gareau</name>
</author>
<author>
<name sortKey="Mckenney, S" uniqKey="Mckenney S">S McKenney</name>
</author>
<author>
<name sortKey="Hornby, Pj" uniqKey="Hornby P">PJ Hornby</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Watari, M" uniqKey="Watari M">M Watari</name>
</author>
<author>
<name sortKey="Watari, H" uniqKey="Watari H">H Watari</name>
</author>
<author>
<name sortKey="Disanto, Me" uniqKey="Disanto M">ME DiSanto</name>
</author>
<author>
<name sortKey="Chacko, S" uniqKey="Chacko S">S Chacko</name>
</author>
<author>
<name sortKey="Shi, Gp" uniqKey="Shi G">GP Shi</name>
</author>
<author>
<name sortKey="Strauss, Jf" uniqKey="Strauss J">JF Strauss</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Xu, P" uniqKey="Xu P">P Xu</name>
</author>
<author>
<name sortKey="Alfaidy, N" uniqKey="Alfaidy N">N Alfaidy</name>
</author>
<author>
<name sortKey="Challis, Jr" uniqKey="Challis J">JR Challis</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Young, A" uniqKey="Young A">A Young</name>
</author>
<author>
<name sortKey="Thomson, Aj" uniqKey="Thomson A">AJ Thomson</name>
</author>
<author>
<name sortKey="Ledingham, M" uniqKey="Ledingham M">M Ledingham</name>
</author>
<author>
<name sortKey="Jordan, F" uniqKey="Jordan F">F Jordan</name>
</author>
<author>
<name sortKey="Greer, Ia" uniqKey="Greer I">IA Greer</name>
</author>
<author>
<name sortKey="Norman, Je" uniqKey="Norman J">JE Norman</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yuan, M" uniqKey="Yuan M">M Yuan</name>
</author>
<author>
<name sortKey="Jordan, F" uniqKey="Jordan F">F Jordan</name>
</author>
<author>
<name sortKey="Mcinnes, Ib" uniqKey="Mcinnes I">IB McInnes</name>
</author>
<author>
<name sortKey="Harnett, Mm" uniqKey="Harnett M">MM Harnett</name>
</author>
<author>
<name sortKey="Norman, Je" uniqKey="Norman J">JE Norman</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zaragoza, Db" uniqKey="Zaragoza D">DB Zaragoza</name>
</author>
<author>
<name sortKey="Wilson, Rr" uniqKey="Wilson R">RR Wilson</name>
</author>
<author>
<name sortKey="Mitchell, Bf" uniqKey="Mitchell B">BF Mitchell</name>
</author>
<author>
<name sortKey="Olson, Dm" uniqKey="Olson D">DM Olson</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Reproduction</journal-id>
<journal-id journal-id-type="iso-abbrev">Reproduction</journal-id>
<journal-id journal-id-type="publisher-id">REPRO</journal-id>
<journal-title-group>
<journal-title>Reproduction (Cambridge, England)</journal-title>
</journal-title-group>
<issn pub-type="ppub">1470-1626</issn>
<issn pub-type="epub">1741-7899</issn>
<publisher>
<publisher-name>BioScientifica</publisher-name>
<publisher-loc>Bristol</publisher-loc>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">24051059</article-id>
<article-id pub-id-type="pmc">3805954</article-id>
<article-id pub-id-type="publisher-id">REP130295</article-id>
<article-id pub-id-type="doi">10.1530/REP-13-0295</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Research</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Prokineticin 1 induces a pro-inflammatory response in murine fetal membranes but does not induce preterm delivery</article-title>
<alt-title alt-title-type="short">Prokineticin 1 and mouse fetal membranes</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Lannagan</surname>
<given-names>Tamsin R M</given-names>
</name>
<xref ref-type="aff" rid="aff1">1</xref>
<xref ref-type="aff" rid="aff2">2</xref>
<xref ref-type="corresp" rid="cor1"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wilson</surname>
<given-names>Martin R</given-names>
</name>
<xref ref-type="aff" rid="aff1">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Denison</surname>
<given-names>Fiona</given-names>
</name>
<xref ref-type="aff" rid="aff2">2</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Norman</surname>
<given-names>Jane E</given-names>
</name>
<xref ref-type="aff" rid="aff2">2</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Catalano</surname>
<given-names>Rob D</given-names>
</name>
<xref ref-type="aff" rid="aff1">1</xref>
<xref ref-type="aff" rid="aff2">2</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Jabbour</surname>
<given-names>Henry N</given-names>
</name>
<xref ref-type="aff" rid="aff1">1</xref>
</contrib>
</contrib-group>
<aff id="aff1">
<institution>MRC Human Reproductive Science Unit</institution>
<institution>The Queen's Medical Research Centre, University of Edinburgh</institution>
<addr-line>47 Little France Crescent, Edinburgh, EH16 4TY</addr-line>
<country>UK</country>
</aff>
<aff id="aff2">
<institution>MRC Centre for Reproductive Health</institution>
<institution>The Queen's Medical Research Centre, University of Edinburgh</institution>
<addr-line>47 Little France Crescent, Edinburgh, EH16 4TY</addr-line>
<country>UK</country>
</aff>
<author-notes>
<corresp id="cor1">Correspondence should be addressed to T R M Lannagan who is now at CSIRO Animal, Food and Health Sciences, Gate 13, Kintore Avenue, Adelaide, South Australia 5000, Australia
<email>tamsin.lannagan@csiro.au</email>
</corresp>
</author-notes>
<pub-date pub-type="ppub">
<month>12</month>
<year>2013</year>
</pub-date>
<pub-date pub-type="epreprint">
<day>13</day>
<month>8</month>
<year>2013</year>
</pub-date>
<volume>146</volume>
<issue>6</issue>
<fpage>581</fpage>
<lpage>591</lpage>
<history>
<date date-type="received">
<day>9</day>
<month>7</month>
<year>2013</year>
</date>
<date date-type="rev-recd">
<day>13</day>
<month>9</month>
<year>2013</year>
</date>
<date date-type="accepted">
<day>19</day>
<month>9</month>
<year>2013</year>
</date>
</history>
<permissions>
<copyright-statement>© 2013 Society for Reproduction and Fertility</copyright-statement>
<copyright-year>2013</copyright-year>
<license license-type="open-access" xlink:href="http://creativecommons.org/licenses/by/3.0/deed.en_GB">
<license-p>This work is licensed under a
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/3.0/deed.en_GB">Creative Commons Attribution 3.0 Unported License</ext-link>
</license-p>
</license>
</permissions>
<abstract>
<p>The mechanisms that regulate the induction of term or preterm delivery (PTD) are not fully understood. Infection is known to play a role in the induction of pro-inflammatory cascades in uteroplacental tissues associated with preterm pathological parturition. Similar but not identical cascades are evident in term labour. In the current study, we used a mouse model to evaluate the role of prokineticins in term and preterm parturition. Prokineticins are multi-functioning secreted proteins that signal through G-protein-coupled receptors to induce gene expression, including genes important in inflammatory responses. Expression of prokineticins (
<italic>Prok1</italic>
and
<italic>Prok2</italic>
) was quantified in murine uteroplacental tissues by QPCR in the days preceding labour (days 16–19).
<italic>Prok1</italic>
mRNA expression increased significantly on D18 in fetal membranes (compared with D16) but not in uterus or placenta. Intrauterine injection of PROK1 on D17 induced fetal membrane mRNA expression of the pro-inflammatory mediators
<italic>Il6</italic>
,
<italic>Il1b</italic>
,
<italic>Tnf</italic>
,
<italic>Cxcl2</italic>
and
<italic>Cxcl5</italic>
, which are not normally up-regulated until D19 of pregnancy. However, intrauterine injection of PROK1 did not result in PTD. As expected, injection of lipopolysaccharide (LPS) induced PTD, but this was not associated with changes in expression of
<italic>Prok1</italic>
or its receptor (
<italic>Prokr1</italic>
) in fetal membranes. These results suggest that although
<italic>Prok1</italic>
exhibits dynamic mRNA regulation in fetal membranes preceding labour and induces a pro-inflammatory response when injected into the uterus on D17, it is insufficient to induce PTD. Additionally, prokineticin up-regulation appears not to be part of the LPS-induced inflammatory response in mouse fetal membranes.</p>
</abstract>
</article-meta>
</front>
<floats-group>
<fig id="fig1" position="float">
<label>Figure 1</label>
<caption>
<p>
<italic>Prok1</italic>
mRNA expression peaks on D18 of pregnancy in murine fetal membranes. QPCR expression analysis of
<italic>Prok1</italic>
(A) and
<italic>Prokr1</italic>
(B) in murine fetal membranes reveals dynamic regulation preceding labour (D16–19). The graphs show individual values for each sample (one membrane analysed per mouse), mean expression levels are in arbitrary units normalised to
<italic>Actb</italic>
mRNA, error bars represent±
<sc>s.e.m</sc>
. (ANOVA). D16 (
<italic>n</italic>
=10), D17 (
<italic>n</italic>
=9), D18 (
<italic>n</italic>
=10) and D19 (
<italic>n</italic>
=10). Note: logarithmic scale.</p>
</caption>
<graphic xlink:href="REPRO130295f01"></graphic>
</fig>
<fig id="fig2" position="float">
<label>Figure 2</label>
<caption>
<p>PROK1 and PROKR1 are expressed at the protein level by murine fetal membranes preceding labour. Immunohistochemical localisation of PROK1 (A, B, C and D) and PROKR1 (F, G, H and I) in D16 (A, B, F and G) and D19 (C, D, H and I) murine fetal membranes revealed that PROK1 is localised in the epithelium of amnion and yolk sac (see arrows in (A, B, C and D)) and in mesenchyme (asterisk) and endothelium (arrowhead) of the yolk sac (B). PROKR1 is expressed in the epithelium of amnion and yolk sac (see arrows in (F, G, H and I)) and in mesenchyme (asterisk in (G)) and endothelium of yolk sac (arrowhead in (I)). (E and J) Negative controls for PROK1 and PROKR1 respectively.</p>
</caption>
<graphic xlink:href="REPRO130295f02"></graphic>
</fig>
<fig id="fig3" position="float">
<label>Figure 3</label>
<caption>
<p>Intrauterine injection of LPS induces a pro-inflammatory response in murine fetal membranes but does not regulate
<italic>Prok1</italic>
or
<italic>Prokr1</italic>
. QPCR mRNA expression analysis of (A)
<italic>Ptgs2</italic>
, (B)
<italic>Il6</italic>
, (C)
<italic>Il1b</italic>
, (D)
<italic>Tnf</italic>
, (E)
<italic>Cxcl2</italic>
, (F)
<italic>Cxcl5</italic>
, (G)
<italic>Prok1</italic>
, (H)
<italic>Prokr1</italic>
and (I)
<italic>Ptgs1</italic>
in murine fetal membranes 6 h after intrauterine injection of LPS reveals up-regulation of pro-inflammatory mediators but not of
<italic>Prok1</italic>
,
<italic>Prokr1</italic>
or
<italic>Ptgs1</italic>
(negative control). The graphs show mean values for each dam (three membranes analysed per dam), mean expression levels are in arbitrary units normalised to
<italic>Actb</italic>
mRNA, error bars represent±
<sc>s.e.m</sc>
. (
<italic>t</italic>
-test). Saline (
<italic>n</italic>
=4 dams) and LPS (
<italic>n</italic>
=4 dams). NS, non-significant. Note: logarithmic scale.</p>
</caption>
<graphic xlink:href="REPRO130295f03"></graphic>
</fig>
<fig id="fig4" position="float">
<label>Figure 4</label>
<caption>
<p>Intrauterine injection of PROK1 induces a pro-inflammatory response in murine fetal membranes. QPCR expression analysis of pro-inflammatory mediators (B)
<italic>Il6</italic>
, (C)
<italic>Il1b</italic>
, (D)
<italic>Tnf</italic>
, (E)
<italic>Cxcl2</italic>
and (F)
<italic>Cxcl5</italic>
in murine membranes 6 h after intrauterine injection of PROK1 reveals their up-regulation but not of (A)
<italic>Ptgs2</italic>
or (G)
<italic>Ptgs1</italic>
(negative control). Each data point represents the mean response for each dam (three membranes per dam) and the graphs show the mean response per treatment group. Mean expression levels are in arbitrary units normalised to
<italic>Actb</italic>
mRNA, error bars represent±
<sc>s.e.m</sc>
. (
<italic>t</italic>
-test). Saline (
<italic>n</italic>
=4 dams) and PROK1 (
<italic>n</italic>
=6 dams). NS, non-significant. Note: logarithmic scale.</p>
</caption>
<graphic xlink:href="REPRO130295f04"></graphic>
</fig>
<fig id="fig5" position="float">
<label>Figure 5</label>
<caption>
<p>Intrauterine injection of LPS but not PROK1 increases the levels of secreted cytokines in murine amniotic fluid. Protein quantification of IL1B, TNF and CXCL2 by ELISA in amniotic fluid 6 h after intrauterine injection of LPS (A, C and E) or PROK1 (B, D and F) reveals significant up-regulation of TNF and CXCL2 in response to LPS but not PROK1 and no increase in IL1B to either treatment. Each data point represents the mean response for each dam (amniotic fluid from four to six sacs per dam) and the graphs show the mean response per treatment group. Mean expression levels (pg/ml), error bars represent±
<sc>s.e.m</sc>
. (
<italic>t</italic>
-test). NS, non-significant.</p>
</caption>
<graphic xlink:href="REPRO130295f05"></graphic>
</fig>
<fig id="fig6" position="float">
<label>Figure 6</label>
<caption>
<p>Intrauterine injection of PROK1 does not induce PTD. Time to delivery of first pup (A) and percentage pup survival per dam (B) following intrauterine injection of saline, LPS (20 μg) or PROK1 (350 nM) were compared. The number of hours to natural delivery (nonsurgical) was not significantly different from saline-treated dams but LPS treatment significantly reduced the time to delivery. Error bars represent±
<sc>s.e.m</sc>
. (ANOVA). Natural delivery (
<italic>n</italic>
=5 dams), saline (
<italic>n</italic>
=15 dams), LPS (
<italic>n</italic>
=10 dams) and PROK1 (
<italic>n</italic>
=16 dams). NS, non-significant.</p>
</caption>
<graphic xlink:href="REPRO130295f06"></graphic>
</fig>
<table-wrap id="tbl1" position="float">
<label>Table 1</label>
<caption>
<p>Treatments and sample size for mouse model of PTL.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th rowspan="1" colspan="1">
<bold>Treatment group</bold>
</th>
<th align="center" rowspan="1" colspan="1">
<bold>Number of dams</bold>
</th>
</tr>
</thead>
<tbody>
<tr>
<td rowspan="1" colspan="1">Natural delivery</td>
<td align="char" rowspan="1" colspan="1">5</td>
</tr>
<tr>
<td rowspan="1" colspan="1">Saline</td>
<td align="char" rowspan="1" colspan="1">15</td>
</tr>
<tr>
<td rowspan="1" colspan="1">LPS</td>
<td align="char" rowspan="1" colspan="1">10</td>
</tr>
<tr>
<td rowspan="1" colspan="1">PROK1</td>
<td align="char" rowspan="1" colspan="1">16</td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="tbl2" position="float">
<label>Table 2</label>
<caption>
<p>Treatments and sample size for gestational tissue and
<italic>in vivo</italic>
experiments.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th rowspan="1" colspan="1">
<bold>Tissue sample</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>Stage of gestation/treatment</bold>
</th>
<th align="center" rowspan="1" colspan="1">
<bold>Number of dams/samples collected per dam</bold>
</th>
</tr>
</thead>
<tbody>
<tr>
<td rowspan="1" colspan="1">Fetal membranes</td>
<td rowspan="1" colspan="1">D16 gestation</td>
<td align="center" rowspan="1" colspan="1">10/1</td>
</tr>
<tr>
<td rowspan="1" colspan="1">Fetal membranes</td>
<td rowspan="1" colspan="1">D17 gestation</td>
<td align="center" rowspan="1" colspan="1">9/1</td>
</tr>
<tr>
<td rowspan="1" colspan="1">Fetal membranes</td>
<td rowspan="1" colspan="1">D18 gestation</td>
<td align="center" rowspan="1" colspan="1">10/1</td>
</tr>
<tr>
<td rowspan="1" colspan="1">Fetal membranes</td>
<td rowspan="1" colspan="1">D19 gestation</td>
<td align="center" rowspan="1" colspan="1">10/1</td>
</tr>
<tr>
<td rowspan="1" colspan="1">Fetal membranes</td>
<td rowspan="1" colspan="1">D17 6 h saline</td>
<td align="center" rowspan="1" colspan="1">4/3</td>
</tr>
<tr>
<td rowspan="1" colspan="1">Fetal membranes</td>
<td rowspan="1" colspan="1">D17 6 h LPS</td>
<td align="center" rowspan="1" colspan="1">4/3</td>
</tr>
<tr>
<td rowspan="1" colspan="1">Fetal membranes</td>
<td rowspan="1" colspan="1">D17 6 h PROK1</td>
<td align="center" rowspan="1" colspan="1">6/3</td>
</tr>
<tr>
<td rowspan="1" colspan="1">Amniotic fluid</td>
<td rowspan="1" colspan="1">D17 6 h saline</td>
<td align="center" rowspan="1" colspan="1">4/4–6</td>
</tr>
<tr>
<td rowspan="1" colspan="1">Amniotic fluid</td>
<td rowspan="1" colspan="1">D17 6 h LPS</td>
<td align="center" rowspan="1" colspan="1">4/4–6</td>
</tr>
<tr>
<td rowspan="1" colspan="1">Amniotic fluid</td>
<td rowspan="1" colspan="1">D17 6 h PROK1</td>
<td align="center" rowspan="1" colspan="1">≥5/4–6</td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="tbl3" position="float">
<label>Table 3</label>
<caption>
<p>Sequences of mouse primers and probes used in QPCR.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th rowspan="1" colspan="1">
<bold>Gene</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>Primer/probe sequence</bold>
(5′–3′)</th>
<th align="left" rowspan="1" colspan="1">
<bold>Control tissue</bold>
</th>
</tr>
</thead>
<tbody>
<tr>
<td rowspan="1" colspan="1">
<italic>Prok1</italic>
</td>
<td rowspan="1" colspan="1">F: GAAGCCACAAGATCCCCTTCT</td>
<td rowspan="1" colspan="1">D19 fetal membrane</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">R: TGCCGTCCGGGAACCT</td>
<td rowspan="1" colspan="1"></td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">Probe (FAM/TAM): AAACGCCAACACCATACCTGTCCCTG</td>
<td rowspan="1" colspan="1"></td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Prokr1</italic>
</td>
<td rowspan="1" colspan="1">F: TGGCCCGCTACAAAAAGCT</td>
<td rowspan="1" colspan="1">Adult liver</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">R: CCACGAGGAAGTCTGAAATGG</td>
<td rowspan="1" colspan="1"></td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">Probe (FAM/TAM): CGCAACCTCACCAACCTGCTTATCG</td>
<td rowspan="1" colspan="1"></td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Il6</italic>
</td>
<td rowspan="1" colspan="1">F: CCACGGCCTTCCCTACTTC</td>
<td rowspan="1" colspan="1">D19 fetal membrane</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">R: TGCACAACTCTTTTCTCATTCCA</td>
<td rowspan="1" colspan="1"></td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">Probe (FAM/TAM): TCACAGAGGATACCACTCCCAACAGACCTG</td>
<td rowspan="1" colspan="1"></td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Ptgs2</italic>
</td>
<td rowspan="1" colspan="1">F: GCTTCGGGAGCACAACAG</td>
<td rowspan="1" colspan="1">D19 fetal membrane</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">R: TGGTTTGGAATAGTTGCTC</td>
<td rowspan="1" colspan="1"></td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">Probe (FAM/TAM): TGTGCGACATACTCAAGCA</td>
<td rowspan="1" colspan="1"></td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Actb</italic>
</td>
<td rowspan="1" colspan="1">F: GCTTCTTTGCAGCTCCTTCGT</td>
<td rowspan="1" colspan="1">NA</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">R: GCGCAGCGATATCGTCATC</td>
<td rowspan="1" colspan="1"></td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">Probe (JOE/TAM): CACCCGCCACCAGTTCGCCAT</td>
<td rowspan="1" colspan="1"></td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="tbl4" position="float">
<label>Table 4</label>
<caption>
<p>Mouse ABI TaqMan gene expression assays used in QPCR.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th rowspan="1" colspan="1">
<bold>Gene</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>ABI assay code</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>Control tissue</bold>
</th>
</tr>
</thead>
<tbody>
<tr>
<td rowspan="1" colspan="1">
<italic>Prok2</italic>
</td>
<td rowspan="1" colspan="1">Mm01182450_g1</td>
<td rowspan="1" colspan="1">D16 uterus</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Prokr2</italic>
</td>
<td rowspan="1" colspan="1">Mm00769571_m1</td>
<td rowspan="1" colspan="1">D16 uterus</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Cxcl2</italic>
</td>
<td rowspan="1" colspan="1">Mm00436450_m1</td>
<td rowspan="1" colspan="1">D19 fetal membrane</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Cxcl5</italic>
</td>
<td rowspan="1" colspan="1">Mm00436451_g1</td>
<td rowspan="1" colspan="1">D19 fetal membrane</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Il1b</italic>
</td>
<td rowspan="1" colspan="1">Mm01336189_m1</td>
<td rowspan="1" colspan="1">D19 uterus</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Tnf</italic>
</td>
<td rowspan="1" colspan="1">Mm00443258_m1 </td>
<td rowspan="1" colspan="1">D19 uterus</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Ptgs1</italic>
</td>
<td rowspan="1" colspan="1">Mm00477214_m1</td>
<td rowspan="1" colspan="1">D19 uterus</td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="tbl5" position="float">
<label>Table 5</label>
<caption>
<p>Fold changes in relative expression of pro-inflammatory mediators in mouse fetal membranes between D17 (
<italic>n</italic>
=9) and D19 (
<italic>n</italic>
=10) of pregnancy, between 6-h saline (
<italic>n</italic>
=4) and PROK1 (
<italic>n</italic>
=6) intrauterine injection, and between 6-h saline and LPS (
<italic>n</italic>
=4) intrauterine injection.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th rowspan="1" colspan="1">
<bold>Gene</bold>
</th>
<th align="center" rowspan="1" colspan="1">
<bold>Endogenous D17 vs 19</bold>
</th>
<th align="center" rowspan="1" colspan="1">
<bold>Saline vs PROK1</bold>
</th>
<th align="center" rowspan="1" colspan="1">
<bold>Saline vs LPS</bold>
</th>
</tr>
</thead>
<tbody>
<tr>
<td rowspan="1" colspan="1">
<italic>Ptgs2</italic>
</td>
<td align="char" rowspan="1" colspan="1">1.73</td>
<td align="char" rowspan="1" colspan="1">2.61</td>
<td align="char" rowspan="1" colspan="1">13.74</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Il6</italic>
</td>
<td align="char" rowspan="1" colspan="1">12.04</td>
<td align="char" rowspan="1" colspan="1">18.68</td>
<td align="char" rowspan="1" colspan="1">62.80</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Il1b</italic>
</td>
<td align="char" rowspan="1" colspan="1">11.08</td>
<td align="char" rowspan="1" colspan="1">17.74</td>
<td align="char" rowspan="1" colspan="1">81.43</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Tnf</italic>
</td>
<td align="char" rowspan="1" colspan="1">2.94</td>
<td align="char" rowspan="1" colspan="1">12.54</td>
<td align="char" rowspan="1" colspan="1">12.76</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Cxcl2</italic>
</td>
<td align="char" rowspan="1" colspan="1">90.19</td>
<td align="char" rowspan="1" colspan="1">37.52</td>
<td align="char" rowspan="1" colspan="1">290.67</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Cxcl5</italic>
</td>
<td align="char" rowspan="1" colspan="1">440.16</td>
<td align="char" rowspan="1" colspan="1">22.45</td>
<td align="char" rowspan="1" colspan="1">62.26</td>
</tr>
</tbody>
</table>
</table-wrap>
</floats-group>
</pmc>
<affiliations>
<list></list>
<tree>
<noCountry>
<name sortKey="Catalano, Rob D" sort="Catalano, Rob D" uniqKey="Catalano R" first="Rob D" last="Catalano">Rob D. Catalano</name>
<name sortKey="Denison, Fiona" sort="Denison, Fiona" uniqKey="Denison F" first="Fiona" last="Denison">Fiona Denison</name>
<name sortKey="Jabbour, Henry N" sort="Jabbour, Henry N" uniqKey="Jabbour H" first="Henry N" last="Jabbour">Henry N. Jabbour</name>
<name sortKey="Lannagan, Tamsin R M" sort="Lannagan, Tamsin R M" uniqKey="Lannagan T" first="Tamsin R M" last="Lannagan">Tamsin R M. Lannagan</name>
<name sortKey="Norman, Jane E" sort="Norman, Jane E" uniqKey="Norman J" first="Jane E" last="Norman">Jane E. Norman</name>
<name sortKey="Wilson, Martin R" sort="Wilson, Martin R" uniqKey="Wilson M" first="Martin R" last="Wilson">Martin R. Wilson</name>
</noCountry>
</tree>
</affiliations>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Wicri/Asie/explor/AustralieFrV1/Data/Ncbi/Merge
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 001470 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Ncbi/Merge/biblio.hfd -nk 001470 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Wicri/Asie
   |area=    AustralieFrV1
   |flux=    Ncbi
   |étape=   Merge
   |type=    RBID
   |clé=     PMC:3805954
   |texte=   Prokineticin 1 induces a pro-inflammatory response in murine fetal membranes but does not induce preterm delivery
}}

Pour générer des pages wiki

HfdIndexSelect -h $EXPLOR_AREA/Data/Ncbi/Merge/RBID.i   -Sk "pubmed:24051059" \
       | HfdSelect -Kh $EXPLOR_AREA/Data/Ncbi/Merge/biblio.hfd   \
       | NlmPubMed2Wicri -a AustralieFrV1 

Wicri

This area was generated with Dilib version V0.6.33.
Data generation: Tue Dec 5 10:43:12 2017. Site generation: Tue Mar 5 14:07:20 2024