Differential Expression of Anthocyanin Biosynthetic Genes in Relation to Anthocyanin Accumulation in the Pericarp of Litchi Chinensis Sonn
Identifieur interne : 001218 ( Pmc/Corpus ); précédent : 001217; suivant : 001219Differential Expression of Anthocyanin Biosynthetic Genes in Relation to Anthocyanin Accumulation in the Pericarp of Litchi Chinensis Sonn
Auteurs : Yong-Zan Wei ; Fu-Chu Hu ; Gui-Bing Hu ; Xiao-Jing Li ; Xu-Ming Huang ; Hui-Cong WangSource :
- PLoS ONE [ 1932-6203 ] ; 2011.
Abstract
Litchi has diverse fruit color phenotypes, yet no research reflects the biochemical background of this diversity. In this study, we evaluated 12 litchi cultivars for chromatic parameters and pigments, and investigated the effects of abscisic acid, forchlorofenron (CPPU), bagging and debagging treatments on fruit coloration in cv. Feizixiao, an unevenly red cultivar. Six genes encoding chalcone synthase (CHS), chalcone isomerase (CHI), flavanone 3-hydroxylase (F3H), dihydroflavonol 4-reductase (DFR), anthocyanidin synthase (ANS) and UDP-glucose: flavonoid 3-
Url:
DOI: 10.1371/journal.pone.0019455
PubMed: 21559331
PubMed Central: 3084873
Links to Exploration step
PMC:3084873Le document en format XML
<record><TEI><teiHeader><fileDesc><titleStmt><title xml:lang="en">Differential Expression of Anthocyanin Biosynthetic Genes in Relation to Anthocyanin Accumulation in the Pericarp of <italic>Litchi Chinensis</italic>
Sonn</title>
<author><name sortKey="Wei, Yong Zan" sort="Wei, Yong Zan" uniqKey="Wei Y" first="Yong-Zan" last="Wei">Yong-Zan Wei</name>
<affiliation><nlm:aff id="aff1"><addr-line>Physiological Laboratory for South China Fruits, College of Horticulture, South China Agricultural University, Guangzhou, China</addr-line>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2"><addr-line>The South Subtropical Crops Research Institute, Chinese Academy of Tropical Agricultural Sciences, Zhanjiang, Guangdong, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Hu, Fu Chu" sort="Hu, Fu Chu" uniqKey="Hu F" first="Fu-Chu" last="Hu">Fu-Chu Hu</name>
<affiliation><nlm:aff id="aff1"><addr-line>Physiological Laboratory for South China Fruits, College of Horticulture, South China Agricultural University, Guangzhou, China</addr-line>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff3"><addr-line>Institute of Tropical Fruit Trees, Hainan Academy of Agricultural Sciences, Haikou, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Hu, Gui Bing" sort="Hu, Gui Bing" uniqKey="Hu G" first="Gui-Bing" last="Hu">Gui-Bing Hu</name>
<affiliation><nlm:aff id="aff1"><addr-line>Physiological Laboratory for South China Fruits, College of Horticulture, South China Agricultural University, Guangzhou, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Li, Xiao Jing" sort="Li, Xiao Jing" uniqKey="Li X" first="Xiao-Jing" last="Li">Xiao-Jing Li</name>
<affiliation><nlm:aff id="aff1"><addr-line>Physiological Laboratory for South China Fruits, College of Horticulture, South China Agricultural University, Guangzhou, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Huang, Xu Ming" sort="Huang, Xu Ming" uniqKey="Huang X" first="Xu-Ming" last="Huang">Xu-Ming Huang</name>
<affiliation><nlm:aff id="aff1"><addr-line>Physiological Laboratory for South China Fruits, College of Horticulture, South China Agricultural University, Guangzhou, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Wang, Hui Cong" sort="Wang, Hui Cong" uniqKey="Wang H" first="Hui-Cong" last="Wang">Hui-Cong Wang</name>
<affiliation><nlm:aff id="aff1"><addr-line>Physiological Laboratory for South China Fruits, College of Horticulture, South China Agricultural University, Guangzhou, China</addr-line>
</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt><idno type="wicri:source">PMC</idno>
<idno type="pmid">21559331</idno>
<idno type="pmc">3084873</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3084873</idno>
<idno type="RBID">PMC:3084873</idno>
<idno type="doi">10.1371/journal.pone.0019455</idno>
<date when="2011">2011</date>
<idno type="wicri:Area/Pmc/Corpus">001218</idno>
</publicationStmt>
<sourceDesc><biblStruct><analytic><title xml:lang="en" level="a" type="main">Differential Expression of Anthocyanin Biosynthetic Genes in Relation to Anthocyanin Accumulation in the Pericarp of <italic>Litchi Chinensis</italic>
Sonn</title>
<author><name sortKey="Wei, Yong Zan" sort="Wei, Yong Zan" uniqKey="Wei Y" first="Yong-Zan" last="Wei">Yong-Zan Wei</name>
<affiliation><nlm:aff id="aff1"><addr-line>Physiological Laboratory for South China Fruits, College of Horticulture, South China Agricultural University, Guangzhou, China</addr-line>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff2"><addr-line>The South Subtropical Crops Research Institute, Chinese Academy of Tropical Agricultural Sciences, Zhanjiang, Guangdong, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Hu, Fu Chu" sort="Hu, Fu Chu" uniqKey="Hu F" first="Fu-Chu" last="Hu">Fu-Chu Hu</name>
<affiliation><nlm:aff id="aff1"><addr-line>Physiological Laboratory for South China Fruits, College of Horticulture, South China Agricultural University, Guangzhou, China</addr-line>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff3"><addr-line>Institute of Tropical Fruit Trees, Hainan Academy of Agricultural Sciences, Haikou, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Hu, Gui Bing" sort="Hu, Gui Bing" uniqKey="Hu G" first="Gui-Bing" last="Hu">Gui-Bing Hu</name>
<affiliation><nlm:aff id="aff1"><addr-line>Physiological Laboratory for South China Fruits, College of Horticulture, South China Agricultural University, Guangzhou, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Li, Xiao Jing" sort="Li, Xiao Jing" uniqKey="Li X" first="Xiao-Jing" last="Li">Xiao-Jing Li</name>
<affiliation><nlm:aff id="aff1"><addr-line>Physiological Laboratory for South China Fruits, College of Horticulture, South China Agricultural University, Guangzhou, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Huang, Xu Ming" sort="Huang, Xu Ming" uniqKey="Huang X" first="Xu-Ming" last="Huang">Xu-Ming Huang</name>
<affiliation><nlm:aff id="aff1"><addr-line>Physiological Laboratory for South China Fruits, College of Horticulture, South China Agricultural University, Guangzhou, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Wang, Hui Cong" sort="Wang, Hui Cong" uniqKey="Wang H" first="Hui-Cong" last="Wang">Hui-Cong Wang</name>
<affiliation><nlm:aff id="aff1"><addr-line>Physiological Laboratory for South China Fruits, College of Horticulture, South China Agricultural University, Guangzhou, China</addr-line>
</nlm:aff>
</affiliation>
</author>
</analytic>
<series><title level="j">PLoS ONE</title>
<idno type="eISSN">1932-6203</idno>
<imprint><date when="2011">2011</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc><textClass></textClass>
</profileDesc>
</teiHeader>
<front><div type="abstract" xml:lang="en"><p>Litchi has diverse fruit color phenotypes, yet no research reflects the biochemical background of this diversity. In this study, we evaluated 12 litchi cultivars for chromatic parameters and pigments, and investigated the effects of abscisic acid, forchlorofenron (CPPU), bagging and debagging treatments on fruit coloration in cv. Feizixiao, an unevenly red cultivar. Six genes encoding chalcone synthase (CHS), chalcone isomerase (CHI), flavanone 3-hydroxylase (F3H), dihydroflavonol 4-reductase (DFR), anthocyanidin synthase (ANS) and UDP-glucose: flavonoid 3-<italic>O</italic>
-glucosyltransferase (UFGT) were isolated from the pericarp of the fully red litchi cv. Nuomici, and their expression was analyzed in different cultivars and under the above mentioned treatments. Pericarp anthocyanin concentration varied from none to 734 mg m<sup>−2</sup>
among the 12 litchi cultivars, which were divided into three coloration types, i.e. non-red (‘Kuixingqingpitian’, ‘Xingqiumili’, ‘Yamulong’and ‘Yongxing No. 2′), unevenly red (‘Feizixiao’ and ‘Sanyuehong’) and fully red (‘Meiguili’, ‘Baila’, Baitangying’ ’Guiwei’, ‘Nuomici’ and ‘Guinuo’). The fully red type cultivars had different levels of anthocyanin but with the same composition. The expression of the six genes, especially <italic>LcF3H</italic>
, <italic>LcDFR</italic>
, <italic>LcANS</italic>
and <italic>LcUFGT</italic>
, in the pericarp of non-red cultivars was much weaker as compared to those red cultivars. Their expression, <italic>LcDFR</italic>
and <italic>LcUFGT</italic>
in particular, was positively correlated with anthocyanin concentrations in the pericarp. These results suggest the late genes in the anthocyanin biosynthetic pathway were coordinately expressed during red coloration of litchi fruits. Low expression of these genes resulted in absence or extremely low anthocyanin accumulation in non-red cultivars. Zero-red pericarp from either immature or CPPU treated fruits appeared to be lacking in anthocyanins due to the absence of UFGT expression. Among these six genes, only the expression of UFGT was found significantly correlated with the pericarp anthocyanin concentration (r = 0.84). These results suggest that UFGT played a predominant role in the anthocyanin accumulation in litchi as well as pericarp coloration of a given cultivar.</p>
</div>
</front>
<back><div1 type="bibliography"><listBibl><biblStruct><analytic><author><name sortKey="Macheix" uniqKey="Macheix">Macheix</name>
</author>
<author><name sortKey="Jj" uniqKey="Jj">JJ</name>
</author>
<author><name sortKey="Fluriet, A" uniqKey="Fluriet A">A Fluriet</name>
</author>
<author><name sortKey="Billot, J" uniqKey="Billot J">J Billot</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Holton, Ta" uniqKey="Holton T">TA Holton</name>
</author>
<author><name sortKey="Cornish, Ec" uniqKey="Cornish E">EC Cornish</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Deroles, S" uniqKey="Deroles S">S Deroles</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lee, Hs" uniqKey="Lee H">HS Lee</name>
</author>
<author><name sortKey="Wicker, L" uniqKey="Wicker L">L Wicker</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Rivera L Pez, J" uniqKey="Rivera L Pez J">J Rivera-López</name>
</author>
<author><name sortKey="Ordorrica Falomir, C" uniqKey="Ordorrica Falomir C">C Ordorrica-Falomir</name>
</author>
<author><name sortKey="Wesche Ebeling, P" uniqKey="Wesche Ebeling P">P Wesche-Ebeling</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Zhang, Z" uniqKey="Zhang Z">Z Zhang</name>
</author>
<author><name sortKey="Pang, X" uniqKey="Pang X">X Pang</name>
</author>
<author><name sortKey="Yang, C" uniqKey="Yang C">C Yang</name>
</author>
<author><name sortKey="Ji, Z" uniqKey="Ji Z">Z Ji</name>
</author>
<author><name sortKey="Jiang, Y" uniqKey="Jiang Y">Y Jiang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wheelwright, Nt" uniqKey="Wheelwright N">NT Wheelwright</name>
</author>
<author><name sortKey="Janson, Ch" uniqKey="Janson C">CH Janson</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Boss, Pk" uniqKey="Boss P">PK Boss</name>
</author>
<author><name sortKey="Davies, C" uniqKey="Davies C">C Davies</name>
</author>
<author><name sortKey="Robinson, Sp" uniqKey="Robinson S">SP Robinson</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kobayashi, S" uniqKey="Kobayashi S">S Kobayashi</name>
</author>
<author><name sortKey="Ishimaru, M" uniqKey="Ishimaru M">M Ishimaru</name>
</author>
<author><name sortKey="Ding, Ck" uniqKey="Ding C">CK Ding</name>
</author>
<author><name sortKey="Yakushiji, H" uniqKey="Yakushiji H">H Yakushiji</name>
</author>
<author><name sortKey="Goto, N" uniqKey="Goto N">N Goto</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Honda, C" uniqKey="Honda C">C Honda</name>
</author>
<author><name sortKey="Kotoda, N" uniqKey="Kotoda N">N Kotoda</name>
</author>
<author><name sortKey="Wada, M" uniqKey="Wada M">M Wada</name>
</author>
<author><name sortKey="Kondo, S" uniqKey="Kondo S">S Kondo</name>
</author>
<author><name sortKey="Kobayashi, S" uniqKey="Kobayashi S">S Kobayashi</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kobayashi, S" uniqKey="Kobayashi S">S Kobayashi</name>
</author>
<author><name sortKey="Ishimaru, M" uniqKey="Ishimaru M">M Ishimaru</name>
</author>
<author><name sortKey="Hiraoka, K" uniqKey="Hiraoka K">K Hiraoka</name>
</author>
<author><name sortKey="Honda, C" uniqKey="Honda C">C Honda</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Takos, Am" uniqKey="Takos A">AM Takos</name>
</author>
<author><name sortKey="Jaffe, Fw" uniqKey="Jaffe F">FW Jaffé ´</name>
</author>
<author><name sortKey="Jacob, Sr" uniqKey="Jacob S">SR Jacob</name>
</author>
<author><name sortKey="Bogs, J" uniqKey="Bogs J">J Bogs</name>
</author>
<author><name sortKey="Robinson, Sp" uniqKey="Robinson S">SP Robinson</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Espley, Rv" uniqKey="Espley R">RV Espley</name>
</author>
<author><name sortKey="Hellens, Rp" uniqKey="Hellens R">RP Hellens</name>
</author>
<author><name sortKey="Putterill, J" uniqKey="Putterill J">J Putterill</name>
</author>
<author><name sortKey="Stevenson, De" uniqKey="Stevenson D">DE Stevenson</name>
</author>
<author><name sortKey="Kutty Amma, S" uniqKey="Kutty Amma S">S Kutty-Amma</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Palapol, Y" uniqKey="Palapol Y">Y Palapol</name>
</author>
<author><name sortKey="Ketsa, S" uniqKey="Ketsa S">S Ketsa</name>
</author>
<author><name sortKey="Lin Wang, K" uniqKey="Lin Wang K">K Lin-Wang</name>
</author>
<author><name sortKey="Ferguson, Ib" uniqKey="Ferguson I">IB Ferguson</name>
</author>
<author><name sortKey="Allan, Ac" uniqKey="Allan A">AC Allan</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Niu, Ss" uniqKey="Niu S">SS Niu</name>
</author>
<author><name sortKey="Xu, Cj" uniqKey="Xu C">CJ Xu</name>
</author>
<author><name sortKey="Zhang, Ws" uniqKey="Zhang W">WS Zhang</name>
</author>
<author><name sortKey="Zhang, B" uniqKey="Zhang B">B Zhang</name>
</author>
<author><name sortKey="Li, X" uniqKey="Li X">X Li</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Zhang, X" uniqKey="Zhang X">X Zhang</name>
</author>
<author><name sortKey="Allan, Ac" uniqKey="Allan A">AC Allan</name>
</author>
<author><name sortKey="Yi, Q" uniqKey="Yi Q">Q Yi</name>
</author>
<author><name sortKey="Chen, L" uniqKey="Chen L">L Chen</name>
</author>
<author><name sortKey="Li, K" uniqKey="Li K">K Li</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Chen, D" uniqKey="Chen D">D Chen</name>
</author>
<author><name sortKey="Li, P" uniqKey="Li P">P Li</name>
</author>
<author><name sortKey="Hu, G" uniqKey="Hu G">G Hu</name>
</author>
<author><name sortKey="Ouyang, R" uniqKey="Ouyang R">R Ouyang</name>
</author>
<author><name sortKey="Gao, F" uniqKey="Gao F">F Gao</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wang, H" uniqKey="Wang H">H Wang</name>
</author>
<author><name sortKey="Huang, H" uniqKey="Huang H">H Huang</name>
</author>
<author><name sortKey="Huang, X" uniqKey="Huang X">X Huang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Underhill, S" uniqKey="Underhill S">S Underhill</name>
</author>
<author><name sortKey="Critchley, C" uniqKey="Critchley C">C Critchley</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Goncalves, B" uniqKey="Goncalves B">B Gonçalves</name>
</author>
<author><name sortKey="Silva, Ap" uniqKey="Silva A">AP Silva</name>
</author>
<author><name sortKey="Moutinho Pereira, J" uniqKey="Moutinho Pereira J">J Moutinho-Pereira</name>
</author>
<author><name sortKey="Bacelar, E" uniqKey="Bacelar E">E Bacelar</name>
</author>
<author><name sortKey="Rosa, E" uniqKey="Rosa E">E Rosa</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kim, Sh" uniqKey="Kim S">SH Kim</name>
</author>
<author><name sortKey="Lee, Jr" uniqKey="Lee J">JR Lee</name>
</author>
<author><name sortKey="Hong, St" uniqKey="Hong S">ST Hong</name>
</author>
<author><name sortKey="Yoo, Yk" uniqKey="Yoo Y">YK Yoo</name>
</author>
<author><name sortKey="An, G" uniqKey="An G">G An</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Takos, Am" uniqKey="Takos A">AM Takos</name>
</author>
<author><name sortKey="Robinson, Sp" uniqKey="Robinson S">SP Robinson</name>
</author>
<author><name sortKey="Walker, Ar" uniqKey="Walker A">AR Walker</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Feng, Sq" uniqKey="Feng S">SQ Feng</name>
</author>
<author><name sortKey="Wang, Yl" uniqKey="Wang Y">YL Wang</name>
</author>
<author><name sortKey="Yang, S" uniqKey="Yang S">S Yang</name>
</author>
<author><name sortKey="Xu, Yt" uniqKey="Xu Y">YT Xu</name>
</author>
<author><name sortKey="Chen, Xs" uniqKey="Chen X">XS Chen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Jia, Hj" uniqKey="Jia H">HJ Jia</name>
</author>
<author><name sortKey="Araki, A" uniqKey="Araki A">A Araki</name>
</author>
<author><name sortKey="Okamoto, G" uniqKey="Okamoto G">G Okamoto</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lister, Ce" uniqKey="Lister C">CE Lister</name>
</author>
<author><name sortKey="Lancaster, Je" uniqKey="Lancaster J">JE Lancaster</name>
</author>
<author><name sortKey="Walker, Jrl" uniqKey="Walker J">JRL Walker</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ju, Z" uniqKey="Ju Z">Z Ju</name>
</author>
<author><name sortKey="Liu, C" uniqKey="Liu C">C Liu</name>
</author>
<author><name sortKey="Yuan, Y" uniqKey="Yuan Y">Y Yuan</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ju, Z" uniqKey="Ju Z">Z Ju</name>
</author>
<author><name sortKey="Yuan, Y" uniqKey="Yuan Y">Y Yuan</name>
</author>
<author><name sortKey="Liu, C" uniqKey="Liu C">C Liu</name>
</author>
<author><name sortKey="Wang, Y" uniqKey="Wang Y">Y Wang</name>
</author>
<author><name sortKey="Tian, X" uniqKey="Tian X">X Tian</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wang, H" uniqKey="Wang H">H Wang</name>
</author>
<author><name sortKey="Huang, X" uniqKey="Huang X">X Huang</name>
</author>
<author><name sortKey="Hu, G" uniqKey="Hu G">G Hu</name>
</author>
<author><name sortKey="Huang, H" uniqKey="Huang H">H Huang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Koyama, K" uniqKey="Koyama K">K Koyama</name>
</author>
<author><name sortKey="Sadamatsu, K" uniqKey="Sadamatsu K">K Sadamatsu</name>
</author>
<author><name sortKey="Goto Yamamoto, N" uniqKey="Goto Yamamoto N">N Goto-Yamamoto</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Mcguire, Rg" uniqKey="Mcguire R">RG McGuire</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Voss, Dh" uniqKey="Voss D">DH Voss</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Fuleki, T" uniqKey="Fuleki T">T Fuleki</name>
</author>
<author><name sortKey="Francis, Fj" uniqKey="Francis F">FJ Francis</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Arnon, Di" uniqKey="Arnon D">DI Arnon</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wu, X" uniqKey="Wu X">X Wu</name>
</author>
<author><name sortKey="Prior, Rl" uniqKey="Prior R">RL Prior</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Huang, Z" uniqKey="Huang Z">Z Huang</name>
</author>
<author><name sortKey="Fasco, Mj" uniqKey="Fasco M">MJ Fasco</name>
</author>
<author><name sortKey="Kaminsky, Ls" uniqKey="Kaminsky L">LS Kaminsky</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Altschul, Sf" uniqKey="Altschul S">SF Altschul</name>
</author>
<author><name sortKey="Madden, Tl" uniqKey="Madden T">TL Madden</name>
</author>
<author><name sortKey="Sch Ffer, Aa" uniqKey="Sch Ffer A">AA Schäffer</name>
</author>
<author><name sortKey="Zhang, J" uniqKey="Zhang J">J Zhang</name>
</author>
<author><name sortKey="Zhang, Z" uniqKey="Zhang Z">Z Zhang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Thompson, Jd" uniqKey="Thompson J">JD Thompson</name>
</author>
<author><name sortKey="Gibson, Tj" uniqKey="Gibson T">TJ Gibson</name>
</author>
<author><name sortKey="Plewniak, F" uniqKey="Plewniak F">F Plewniak</name>
</author>
<author><name sortKey="Jeanmougin, F" uniqKey="Jeanmougin F">F Jeanmougin</name>
</author>
<author><name sortKey="Higgins, Dg" uniqKey="Higgins D">DG Higgins</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lefever, S" uniqKey="Lefever S">S Lefever</name>
</author>
<author><name sortKey="Hellemans, J" uniqKey="Hellemans J">J Hellemans</name>
</author>
<author><name sortKey="Pattyn, F" uniqKey="Pattyn F">F Pattyn</name>
</author>
<author><name sortKey="Przybylski, Dr" uniqKey="Przybylski D">DR Przybylski</name>
</author>
<author><name sortKey="Tayor, C" uniqKey="Tayor C">C Tayor</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Zhong, Hy" uniqKey="Zhong H">HY Zhong</name>
</author>
<author><name sortKey="Chen, Jw" uniqKey="Chen J">JW Chen</name>
</author>
<author><name sortKey="Li, Cq" uniqKey="Li C">CQ Li</name>
</author>
<author><name sortKey="Chen, L" uniqKey="Chen L">L Chen</name>
</author>
<author><name sortKey="Wu, Jy" uniqKey="Wu J">JY Wu</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Livak, Kj" uniqKey="Livak K">KJ Livak</name>
</author>
<author><name sortKey="Schmittgen, Td" uniqKey="Schmittgen T">TD Schmittgen</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article"><pmc-dir>properties open_access</pmc-dir>
<front><journal-meta><journal-id journal-id-type="nlm-ta">PLoS One</journal-id>
<journal-id journal-id-type="publisher-id">plos</journal-id>
<journal-id journal-id-type="pmc">plosone</journal-id>
<journal-title-group><journal-title>PLoS ONE</journal-title>
</journal-title-group>
<issn pub-type="epub">1932-6203</issn>
<publisher><publisher-name>Public Library of Science</publisher-name>
<publisher-loc>San Francisco, USA</publisher-loc>
</publisher>
</journal-meta>
<article-meta><article-id pub-id-type="pmid">21559331</article-id>
<article-id pub-id-type="pmc">3084873</article-id>
<article-id pub-id-type="publisher-id">PONE-D-10-06540</article-id>
<article-id pub-id-type="doi">10.1371/journal.pone.0019455</article-id>
<article-categories><subj-group subj-group-type="heading"><subject>Research Article</subject>
</subj-group>
<subj-group subj-group-type="Discipline-v2"><subject>Agriculture</subject>
<subj-group><subject>Crops</subject>
<subj-group><subject>Fruits</subject>
</subj-group>
</subj-group>
</subj-group>
<subj-group subj-group-type="Discipline-v2"><subject>Biology</subject>
<subj-group><subject>Molecular Cell Biology</subject>
<subj-group><subject>Gene Expression</subject>
</subj-group>
</subj-group>
<subj-group><subject>Plant Science</subject>
<subj-group><subject>Plant Physiology</subject>
</subj-group>
</subj-group>
</subj-group>
</article-categories>
<title-group><article-title>Differential Expression of Anthocyanin Biosynthetic Genes in Relation to Anthocyanin Accumulation in the Pericarp of <italic>Litchi Chinensis</italic>
Sonn</article-title>
<alt-title alt-title-type="running-head">Anthocyanin Accumulation in the Pericarp of Litchi</alt-title>
</title-group>
<contrib-group><contrib contrib-type="author" equal-contrib="yes"><name><surname>Wei</surname>
<given-names>Yong-Zan</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author" equal-contrib="yes"><name><surname>Hu</surname>
<given-names>Fu-Chu</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff3"><sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author" equal-contrib="yes"><name><surname>Hu</surname>
<given-names>Gui-Bing</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Li</surname>
<given-names>Xiao-Jing</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Huang</surname>
<given-names>Xu-Ming</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Wang</surname>
<given-names>Hui-Cong</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup>
</xref>
<xref ref-type="corresp" rid="cor1"><sup>*</sup>
</xref>
</contrib>
</contrib-group>
<aff id="aff1"><label>1</label>
<addr-line>Physiological Laboratory for South China Fruits, College of Horticulture, South China Agricultural University, Guangzhou, China</addr-line>
</aff>
<aff id="aff2"><label>2</label>
<addr-line>The South Subtropical Crops Research Institute, Chinese Academy of Tropical Agricultural Sciences, Zhanjiang, Guangdong, China</addr-line>
</aff>
<aff id="aff3"><label>3</label>
<addr-line>Institute of Tropical Fruit Trees, Hainan Academy of Agricultural Sciences, Haikou, China</addr-line>
</aff>
<contrib-group><contrib contrib-type="editor"><name><surname>Baxter</surname>
<given-names>Ivan</given-names>
</name>
<role>Editor</role>
<xref ref-type="aff" rid="edit1"></xref>
</contrib>
</contrib-group>
<aff id="edit1">United States Department of Agriculture, Agricultural Research Service, United States of America</aff>
<author-notes><corresp id="cor1">* E-mail: <email>wanghc1972@263.net</email>
</corresp>
<fn fn-type="con"><p>Conceived and designed the experiments: H-CW G-BH X-MH. Performed the experiments: Y-ZW F-CH X-JL H-CW. Analyzed the data: H-CW Y-ZW F-CH. Contributed reagents/materials/analysis tools: H-CW G-BH Y-ZW F-ZH. Wrote the paper: H-GB H-CW. Gene sequence upload: F-CH X-JL.</p>
</fn>
</author-notes>
<pub-date pub-type="collection"><year>2011</year>
</pub-date>
<pub-date pub-type="epub"><day>29</day>
<month>4</month>
<year>2011</year>
</pub-date>
<volume>6</volume>
<issue>4</issue>
<elocation-id>e19455</elocation-id>
<history><date date-type="received"><day>14</day>
<month>12</month>
<year>2010</year>
</date>
<date date-type="accepted"><day>30</day>
<month>3</month>
<year>2011</year>
</date>
</history>
<permissions><copyright-statement>Wei et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.</copyright-statement>
</permissions>
<abstract><p>Litchi has diverse fruit color phenotypes, yet no research reflects the biochemical background of this diversity. In this study, we evaluated 12 litchi cultivars for chromatic parameters and pigments, and investigated the effects of abscisic acid, forchlorofenron (CPPU), bagging and debagging treatments on fruit coloration in cv. Feizixiao, an unevenly red cultivar. Six genes encoding chalcone synthase (CHS), chalcone isomerase (CHI), flavanone 3-hydroxylase (F3H), dihydroflavonol 4-reductase (DFR), anthocyanidin synthase (ANS) and UDP-glucose: flavonoid 3-<italic>O</italic>
-glucosyltransferase (UFGT) were isolated from the pericarp of the fully red litchi cv. Nuomici, and their expression was analyzed in different cultivars and under the above mentioned treatments. Pericarp anthocyanin concentration varied from none to 734 mg m<sup>−2</sup>
among the 12 litchi cultivars, which were divided into three coloration types, i.e. non-red (‘Kuixingqingpitian’, ‘Xingqiumili’, ‘Yamulong’and ‘Yongxing No. 2′), unevenly red (‘Feizixiao’ and ‘Sanyuehong’) and fully red (‘Meiguili’, ‘Baila’, Baitangying’ ’Guiwei’, ‘Nuomici’ and ‘Guinuo’). The fully red type cultivars had different levels of anthocyanin but with the same composition. The expression of the six genes, especially <italic>LcF3H</italic>
, <italic>LcDFR</italic>
, <italic>LcANS</italic>
and <italic>LcUFGT</italic>
, in the pericarp of non-red cultivars was much weaker as compared to those red cultivars. Their expression, <italic>LcDFR</italic>
and <italic>LcUFGT</italic>
in particular, was positively correlated with anthocyanin concentrations in the pericarp. These results suggest the late genes in the anthocyanin biosynthetic pathway were coordinately expressed during red coloration of litchi fruits. Low expression of these genes resulted in absence or extremely low anthocyanin accumulation in non-red cultivars. Zero-red pericarp from either immature or CPPU treated fruits appeared to be lacking in anthocyanins due to the absence of UFGT expression. Among these six genes, only the expression of UFGT was found significantly correlated with the pericarp anthocyanin concentration (r = 0.84). These results suggest that UFGT played a predominant role in the anthocyanin accumulation in litchi as well as pericarp coloration of a given cultivar.</p>
</abstract>
<counts><page-count count="11"></page-count>
</counts>
</article-meta>
</front>
<body><sec id="s1"><title>Introduction</title>
<p>Pigmentation is an appealing feature of fruits. Among the four pigment groups, i.e. anthocyanins, betalains, chlorophylls and carotenoids, anthocyanins are the most prominent imparting red, blue and black hues to the fruits in which they accumulate <xref ref-type="bibr" rid="pone.0019455-Macheix1">[1]</xref>
.</p>
<p>Anthocyanin biosynthesis is probably the most thoroughly studied plant secondary metabolism pathway. The metabolic pathway leading to their production has been well characterised in some model plants <xref ref-type="bibr" rid="pone.0019455-Holton1">[2]</xref>
. This pathway is usually divided into two sections, the early and the late sections <xref ref-type="bibr" rid="pone.0019455-Deroles1">[3]</xref>
. The early sections leads to the formation of the dihydro-flavonols, comprising phenylalanine ammonialyase (PAL), cinnimate 4-hydroxylase (C4H), 4-coumarate: CoA ligase (4CL), chalcone synthase (CHS), chalcone isomerase (CHI), and flavanone 3-hydroxylase (F3H). Genes of these enzymes in the early section are here called the early genes. The late section leads to the formation of the anthocyanin molecule involving actions of dihydroflavonol reductase (DFR), anthocyanidin synthase (ANS) and UDPGlucose: flavonoid 3-<italic>O</italic>
-glucosyltranferase (UFGT). Genes expressing the three enzymes are thus called the late genes in anthocyanin biosynthesis.</p>
<p>Litchi (<italic>Litchi chinensis</italic>
Sonn.) is one of the important subtropical fruit crops, which is indigenous to South China. Red color on litchi fruit is the expression of anthocyanins <xref ref-type="bibr" rid="pone.0019455-Lee1">[4]</xref>
, <xref ref-type="bibr" rid="pone.0019455-RiveraLpez1">[5]</xref>
, <xref ref-type="bibr" rid="pone.0019455-Zhang1">[6]</xref>
. Anthocyanin-accumulating fruit often display a range of intermediary colors from green to pink, then red or blue and finally purple to black with increasing anthocyanin and decreasing chlorophyll levels <xref ref-type="bibr" rid="pone.0019455-Wheelwright1">[7]</xref>
. Litchi has diverse varieties with different fruit colors, yet no research reflects the biochemical background of this diversity. The diversity of fruit coloration in litchi genotypes provides interesting experimental materials for litchi anthocyanin studies.</p>
<p>Cloning of the structural genes in the anthocyanin biosynthetic pathway and the identification of genes encoding transcription factors that regulate the expression of the structural genes have been extensively reported in fruit crops because of market acceptance and health benefits. The expression of the UDP-glucose: flavonoid 3-<italic>O</italic>
-glucosyltransferase (UFGT) gene was critical for anthocyanin biosynthesis in the grape berry <xref ref-type="bibr" rid="pone.0019455-Boss1">[8]</xref>
. White grape cultivars appear to be lacking in anthocyanins because of the absence of UFGT <xref ref-type="bibr" rid="pone.0019455-Kobayashi1">[9]</xref>
. In apple fruits, five anthocyanin biosynthetic genes, <italic>CHS</italic>
, <italic>F3H</italic>
, <italic>DFR</italic>
, <italic>ANS</italic>
and <italic>UFGT</italic>
, are coordinately expressed during red coloration in skin and their levels of expression are positively related to anthocyanin concentration <xref ref-type="bibr" rid="pone.0019455-Honda1">[10]</xref>
. Recently, studies indicate that expression of biosynthetic genes in anthocyanin accumulation is regulated by MYB transcription factor in the fruit of grapes <xref ref-type="bibr" rid="pone.0019455-Kobayashi2">[11]</xref>
, apples <xref ref-type="bibr" rid="pone.0019455-Takos1">[12]</xref>
, <xref ref-type="bibr" rid="pone.0019455-Espley1">[13]</xref>
, mangosteen <xref ref-type="bibr" rid="pone.0019455-Palapol1">[14]</xref>
, Chinese bayberries <xref ref-type="bibr" rid="pone.0019455-Niu1">[15]</xref>
and red pear <xref ref-type="bibr" rid="pone.0019455-Zhang2">[16]</xref>
.</p>
<p>In litchi, however, the information on molecular physiology of anthocyanin biosynthesis is quite limited. More data are available concerning anthocyanin concentration and composition changes during fruit development <xref ref-type="bibr" rid="pone.0019455-Lee1">[4]</xref>
, <xref ref-type="bibr" rid="pone.0019455-RiveraLpez1">[5]</xref>
and coloration improved by bagging or spraying growth regulators <xref ref-type="bibr" rid="pone.0019455-Chen1">[17]</xref>
, <xref ref-type="bibr" rid="pone.0019455-Wang1">[18]</xref>
. In this study, we cloned six structural genes of anthocyanin biosynthetic enzymes, CHS, CHI, F3H, DFR, ANS and UFGT and studied the expression of these genes in cultivars of three different color types. Effects of abscisic acid (ABA), forchlorofenron (CPPU) and cluster bagging and debagging treatments on anthocyanin accumulation and the expression of the genes in the pericarp were also examined.</p>
</sec>
<sec id="s2"><title>Results</title>
<sec id="s2a"><title>Pericarp color</title>
<p>The differences in pericarp color among the cultivars tested, expressed as the Hunter L*, a*, b*, and hue angle (h*) are shown in <xref ref-type="table" rid="pone-0019455-t001">Table 1</xref>
. Different cultivars displayed significant differences in color parameters. Basically, Hunter L*, b* showed a gradual decrease, while Hunter a* gradually increased as fruit color changed from green to light green-yellow, to yellow-red and to dark red among the cultivars (as shown in <xref ref-type="fig" rid="pone-0019455-g001">Figure 1</xref>
). Hue angle (h*) derived from Hunter a* and b* color space, and therefore is a more practical parameter in reflecting fruit color. The h* value of ‘Kuixingqingpitian’, ‘Xingqiumili’, ‘Yamulong’ and ‘Yongxing No. 2′ were always significantly higher than those of ‘Feizixiao’, ‘Sanyuehong’, ‘Meiguili’, ‘Baila’, ‘Baitangying’, ‘Guiwei’, ‘Nuomici’ and ‘Guinuo’. The lower the hue angle, the redder the fruit skin. This result was consistent with the visual fruit color phenotypes.</p>
<fig id="pone-0019455-g001" position="float"><object-id pub-id-type="doi">10.1371/journal.pone.0019455.g001</object-id>
<label>Figure 1</label>
<caption><title>Appearance of 12 litchi cultivars.</title>
<p>C1, ‘Kuixingqingpitian’; C2, ‘Xinqiumili’; C3, ‘Yamulong’; C4, ‘Yongxing No. 2′; C5, ‘Feizixiao’; C6, ‘Sanyuehong’; C7, ‘Meiguili’; C8, ‘Baila’; C9, ‘Baitangying’; C10, ‘Guiwei’; C11, ‘Nuomici’; C12, ‘Guinuo’.</p>
</caption>
<graphic xlink:href="pone.0019455.g001"></graphic>
</fig>
<table-wrap id="pone-0019455-t001" position="float"><object-id pub-id-type="doi">10.1371/journal.pone.0019455.t001</object-id>
<label>Table 1</label>
<caption><title>Color parameters (L*, a*, b*) and hue angle (h*) of litchis at maturity.</title>
</caption>
<alternatives><graphic id="pone-0019455-t001-1" xlink:href="pone.0019455.t001"></graphic>
<table frame="hsides" rules="groups"><colgroup span="1"><col align="left" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead><tr><td align="left" rowspan="1" colspan="1">Cultivars</td>
<td align="left" rowspan="1" colspan="1">L*</td>
<td align="left" rowspan="1" colspan="1">a*</td>
<td align="left" rowspan="1" colspan="1">b*</td>
<td align="left" rowspan="1" colspan="1">h*</td>
</tr>
</thead>
<tbody><tr><td align="left" rowspan="1" colspan="1">‘Kuixingqingpitian’</td>
<td align="left" rowspan="1" colspan="1">42.9±0.40de</td>
<td align="left" rowspan="1" colspan="1">−11.0±0.45h</td>
<td align="left" rowspan="1" colspan="1">30.8±0.46bc</td>
<td align="left" rowspan="1" colspan="1">109.5±0.59a</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">‘Xingquimili’</td>
<td align="left" rowspan="1" colspan="1">50.3±0.76a</td>
<td align="left" rowspan="1" colspan="1">−7.9±0.86gh</td>
<td align="left" rowspan="1" colspan="1">40.0±0.66a</td>
<td align="left" rowspan="1" colspan="1">107.1±5.52a</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">‘Yamulong’</td>
<td align="left" rowspan="1" colspan="1">44.7±0.65cd</td>
<td align="left" rowspan="1" colspan="1">−5.4±0.35g</td>
<td align="left" rowspan="1" colspan="1">32.6±0.46b</td>
<td align="left" rowspan="1" colspan="1">99.3±0.56b</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">‘Yongxing No. 2’</td>
<td align="left" rowspan="1" colspan="1">46.7±0.63bc</td>
<td align="left" rowspan="1" colspan="1">5.7±1.31f</td>
<td align="left" rowspan="1" colspan="1">33.1±0.72b</td>
<td align="left" rowspan="1" colspan="1">80.0±2.36c</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">‘Feizixiao’</td>
<td align="left" rowspan="1" colspan="1">39.9±0.83f</td>
<td align="left" rowspan="1" colspan="1">8.4±1.47ef</td>
<td align="left" rowspan="1" colspan="1">26.2±1.45d</td>
<td align="left" rowspan="1" colspan="1">72.0±3.06d</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">‘Sanyuehong’</td>
<td align="left" rowspan="1" colspan="1">47.8±1.25b</td>
<td align="left" rowspan="1" colspan="1">9.4±2.60e</td>
<td align="left" rowspan="1" colspan="1">29.6±1.59c</td>
<td align="left" rowspan="1" colspan="1">70.4±4.93d</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">‘Meiguili’</td>
<td align="left" rowspan="1" colspan="1">43.4±0.97de</td>
<td align="left" rowspan="1" colspan="1">13.6±1.03d</td>
<td align="left" rowspan="1" colspan="1">29.7±0.87c</td>
<td align="left" rowspan="1" colspan="1">65.1±2.13d</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">‘Baila’</td>
<td align="left" rowspan="1" colspan="1">41.8±1.21ef</td>
<td align="left" rowspan="1" colspan="1">20.4±1.65c</td>
<td align="left" rowspan="1" colspan="1">26.7±0.71d</td>
<td align="left" rowspan="1" colspan="1">53.3±2.74e</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">‘Baitangying’</td>
<td align="left" rowspan="1" colspan="1">36.8±0.66g</td>
<td align="left" rowspan="1" colspan="1">22.8±1.17bc</td>
<td align="left" rowspan="1" colspan="1">22.3±0.49e</td>
<td align="left" rowspan="1" colspan="1">45.0±1.88f</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">‘Guiwei’</td>
<td align="left" rowspan="1" colspan="1">41.6±0.60ef</td>
<td align="left" rowspan="1" colspan="1">25.2±0.67ab</td>
<td align="left" rowspan="1" colspan="1">22.0±0.53e</td>
<td align="left" rowspan="1" colspan="1">41.2±1.24f</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">‘Nuomici’</td>
<td align="left" rowspan="1" colspan="1">37.1±0.99g</td>
<td align="left" rowspan="1" colspan="1">22.2±0.55bc</td>
<td align="left" rowspan="1" colspan="1">18.01±0.59f</td>
<td align="left" rowspan="1" colspan="1">39.0±1.39f</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">‘Guinuo’</td>
<td align="left" rowspan="1" colspan="1">31.9±0.31h</td>
<td align="left" rowspan="1" colspan="1">27.0±0.27a</td>
<td align="left" rowspan="1" colspan="1">15.00±0.16g</td>
<td align="left" rowspan="1" colspan="1">29.1±0.40g</td>
</tr>
</tbody>
</table>
</alternatives>
<table-wrap-foot><fn id="nt101"><label></label>
<p>For each cultivar, means within a column followed by different letters are significantly different at p<0.05. Results of ANOVA test (n = 15) are presented in <xref ref-type="supplementary-material" rid="pone.0019455.s002">Table S1</xref>
.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s2b"><title>Concentration of anthocyanins, chlorophylls and carotenoids and their correlations with hue angle</title>
<p>Anthocyanins, chlorophylls and carotenoids are almost exclusively found in the pericarp of litchi but not equally distributed within the pericarp. Anthocyanins and chlorophylls present mainly in the outer cell layers of the pericarp <xref ref-type="bibr" rid="pone.0019455-Underhill1">[19]</xref>
. Therefore, concentration of the pigments on per square meter basis will be more applicable than on per gram basis to the comparison among different cultivars.</p>
<p>Total anthocyanin concentration was measured using the pH-differential spectrum method. Fruit color was mainly influenced by the concentration and distribution of anthocyanins in the skin. Anthocyanin concentration in the 12 cultivars ranged from none to 734 mg m<sup>−2</sup>
(<xref ref-type="fig" rid="pone-0019455-g002">Fig. 2A</xref>
). ‘Kuixingqingpitian’, ‘Xingqiumili’, ‘Yamulong’ and ‘Yongxing No. 2′ contained extremely low or non-detectable levels of anthocyanins, while the rest cultivars accumulated quite a bit anthocyanins. In our study, anthocyanin levels of the tested cultivars were significantly negatively correlated with their hue angles (r = −0.78) (<xref ref-type="fig" rid="pone-0019455-g002">Fig. 2 B</xref>
), which is consistent with sweet cherry <xref ref-type="bibr" rid="pone.0019455-Gonalves1">[20]</xref>
. Contrarily, the concentrations of chlorophylls in the pericarp of ‘Kuixingqingpitian’, ‘Xingqiumili’, and ‘Yamulong’ were much higher than those in the rest cultivars (<xref ref-type="fig" rid="pone-0019455-g002">Fig. 2 C</xref>
). And the concentrations of chlorophylls were significantly positively correlated with their hue angles (r = 0.86) (<xref ref-type="fig" rid="pone-0019455-g002">Fig. 2 D</xref>
). The pericarp of litchi contained carotenoids at levels ranging from 22 mg m<sup>−2</sup>
in cultivar ‘Sanyuehong’ to 122 mg m<sup>−2</sup>
in ‘Guiwei’ but displayed no visible patterns among the tested cultivars (<xref ref-type="fig" rid="pone-0019455-g002">Fig. 2 E, F</xref>
).</p>
<fig id="pone-0019455-g002" position="float"><object-id pub-id-type="doi">10.1371/journal.pone.0019455.g002</object-id>
<label>Figure 2</label>
<caption><title>Concentrations of anthocyanins (A), chlorophylls (C), and carotenoids (E) and their correlations with hue angle (B, D, F) in the pericarp of twelve litchi cultivars.</title>
<p>Each point is mean ± standard error (n = 15). C1 to C12 are different cultivars explained in <xref ref-type="fig" rid="pone-0019455-g001">Figure 1</xref>
. Relative coefficient r with ‘*’ indicated significantly correlated at the level of P<0.05.</p>
</caption>
<graphic xlink:href="pone.0019455.g002"></graphic>
</fig>
<p>According to the color appearance and concentrations and distribution of anthocyanins and chlorophylls, the tested 12 cultivars could be basically divided into three types: (a) the non-red ones that accumulate no or extremely low anthocyanins, including ‘Quixingqingpitian’, ‘Xingqiumili’, ‘Yamulong’ and ‘Yongxing No. 2′; (b) the unevenly red cultivars, ‘Feizixiao’ and ‘Sanyuehong’, which accumulate some anthocyanins while retaining relatively high levels of chlorophylls; (c) the evenly red cultivars that accumulate significant amount of anthocyanins with decreased chlorophylls, including ‘Meiguili’, ‘Baila’, ‘Baitangying’, ‘Guiwei’, ‘Nuomici’ and ‘Guinuo’ which display a serial color progressing from pink to dark red.</p>
</sec>
<sec id="s2c"><title>Composition and relative content of anthocyanins in the pericarp of red litchi</title>
<p>Previous works using reverse-phase high performance liquid chromatography (HPLC) revealed that the major pigment in ‘Brewster’ was cyanidin-3-rutinoside, and the minor pigments indentified were cyanidin-3-glucoside and malvidin-3-acetylglucoside <xref ref-type="bibr" rid="pone.0019455-Lee1">[4]</xref>
, <xref ref-type="bibr" rid="pone.0019455-RiveraLpez1">[5]</xref>
. Zhang et al confirmed that the major anthocyanin in ‘Huaizhi’ was cyanidin-3-rutinoside (>91%) using HPLC equipped with mass spectrometry <xref ref-type="bibr" rid="pone.0019455-Zhang1">[6]</xref>
. However, there is no available information by HPLC on other red litchi cultivars. To examine the composition and relative content of individual anthocyanins in red litchi varieties, anthocyanins were extracted and analyzed by HPLC. A very similar pattern of HPLC elution profiles for all the six red varieties was obtained. An example of a typical elution profile of red cultivar ‘Nuomici’ is shown in <xref ref-type="fig" rid="pone-0019455-g003">Fig. 3 A</xref>
.</p>
<fig id="pone-0019455-g003" position="float"><object-id pub-id-type="doi">10.1371/journal.pone.0019455.g003</object-id>
<label>Figure 3</label>
<caption><title>HPLC elution profile and peak area of individual anthocyanins.</title>
<p>All the red cultivars examined contained the same three peaks: A) typical HPLC elution profile of anthocyanins from pericarp of litchi cv. Nuomici; B) anthocyanin compositions and their relative levels in the pericarp of red litchi cultivars. Asterisk represents that peak 1 to 3 were cyanidin (Peak 1), cyanidin-3-glucoside (Peak 2), cyanidin-3-rutinoside (Peak 3) respectively, which were putatively identified through the comparison of retention time and spectrum characters with the published data (Lee and Wicker,1991; Rivera-López et al,1999; Zhang et al., 2004). HPLC elution profiles of anthocyanins from pericarp of the rest cultivars are presented in <xref ref-type="supplementary-material" rid="pone.0019455.s001">Figure S1</xref>
.</p>
</caption>
<graphic xlink:href="pone.0019455.g003"></graphic>
</fig>
<p>All the red cultivars examined contained the same three peaks and displayed similar relative levels (<xref ref-type="fig" rid="pone-0019455-g003">Fig 3 B</xref>
). Peak 3 was the dominant anthoycanin in litchi pericarp, which was putatively identified as cyanidin-3-rutinoside through the comparison of retention time and spectrum characters with the published data <xref ref-type="bibr" rid="pone.0019455-Lee1">[4]</xref>
, <xref ref-type="bibr" rid="pone.0019455-RiveraLpez1">[5]</xref>
, <xref ref-type="bibr" rid="pone.0019455-Zhang1">[6]</xref>
. The relative peak area of this compound (Peak 3) was around 94% in the six red cultivars. Peak 1 and Peak 2 which putatively identified as cyanidin and cyanidin-3-glucoside represented less abundant anthocyanins which had a relative area around 1% and 5%, respectively. These results indicated that red litchi cultivars had the same composition of anthocyanins and displayed similar relative levels of these three anthocyanins.</p>
</sec>
<sec id="s2d"><title>Isolation and sequence analysis of anthocyanin biosynthetic genes</title>
<p>Fragments of the anthocyanin biosynthetic genes were isolated following the traditional cloning procedures including RT-PCR and TA ligation from ‘Nuomici’. Six anthocyanin biosynthetic genes, including <italic>LcCHS</italic>
(450 bp), <italic>LcCHI</italic>
(300 bp), <italic>LcF3H</italic>
(450 bp), <italic>LcDFR</italic>
(250 bp), <italic>LcANS</italic>
(430 bp) and <italic>LcUFGT</italic>
(950 bp), were obtained using degenerate primers (<xref ref-type="table" rid="pone-0019455-t002">Table 2</xref>
).</p>
<table-wrap id="pone-0019455-t002" position="float"><object-id pub-id-type="doi">10.1371/journal.pone.0019455.t002</object-id>
<label>Table 2</label>
<caption><title>Degenerate primers for cloning of anthocyanin biosynthetic genes in litchi pericarp.</title>
</caption>
<alternatives><graphic id="pone-0019455-t002-2" xlink:href="pone.0019455.t002"></graphic>
<table frame="hsides" rules="groups"><colgroup span="1"><col align="left" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead><tr><td align="left" rowspan="1" colspan="1">Gene</td>
<td align="left" rowspan="1" colspan="1">Forward primer (5′ to 3′)</td>
<td align="left" rowspan="1" colspan="1">Reverse primer (5′ to 3′)</td>
<td align="left" rowspan="1" colspan="1">Product (bp)</td>
</tr>
</thead>
<tbody><tr><td align="left" rowspan="1" colspan="1"><italic>CHS</italic>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">GAGAAGTTCAAGCGCATGTGTGA</named-content>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">CCACGGAAAGTGACTGCAGTGAT</named-content>
</td>
<td align="left" rowspan="1" colspan="1">450</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><italic>CHI</italic>
</td>
<td align="left" rowspan="1" colspan="1">TTCCTCGGCGGCGCAGGGGWGAG</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">CTTCTGCATCAGTGTAAATTCC</named-content>
</td>
<td align="left" rowspan="1" colspan="1">300</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><italic>F3H</italic>
</td>
<td align="left" rowspan="1" colspan="1">TGGCGTGAAATWGTGACCTAYTT</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">TTCTTGAACCTCCCATTGCTCA</named-content>
</td>
<td align="left" rowspan="1" colspan="1">450</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><italic>DFR</italic>
</td>
<td align="left" rowspan="1" colspan="1">GAATCCAAGGATCCYGAGAAYGA</td>
<td align="left" rowspan="1" colspan="1">AAGTACATCCATCCAGTCATYTT</td>
<td align="left" rowspan="1" colspan="1">250</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><italic>ANS</italic>
</td>
<td align="left" rowspan="1" colspan="1">AAGGAGAAGTATGCMAATGAYC</td>
<td align="left" rowspan="1" colspan="1">AARAGCTGCAGRCCVGGRACCAT</td>
<td align="left" rowspan="1" colspan="1">430</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><italic>UFGT</italic>
</td>
<td align="left" rowspan="1" colspan="1">CATGTGGCCGTCCTRGCCTTYCC</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">GAGGAGCCCATTCCACCACA</named-content>
</td>
<td align="left" rowspan="1" colspan="1">950</td>
</tr>
</tbody>
</table>
</alternatives>
</table-wrap>
<p>The full lengths or longer fragments of these genes were obtained after 3′ and 5′-RACE. And then the sequences obtained were compared with known sequences from other species using NCBI Blast server (<xref ref-type="table" rid="pone-0019455-t003">Table 3</xref>
). Genbank accession codes of the six isolated genes were listed in <xref ref-type="table" rid="pone-0019455-t003">Table 3</xref>
. The coding region of <italic>LcCHS</italic>
was <bold>1279 </bold>
bp long, encoding a deduced 393-amino acid sequence. <italic>LcCHS</italic>
was 81% homologous with the <italic>CHSs</italic>
from <italic>Dictamnus albus</italic>
. The coding sequence of <italic>LcF3H</italic>
(<bold>1196</bold>
bp) which was deduced to encode a <bold>364</bold>
-amino acid sequence, showed 97% identity with that of <italic>Dimocarpus longan</italic>
. The fragments for <italic>LcCHI</italic>
(912 bp), <italic>LcDFR</italic>
(1017 bp), <italic>LcANS</italic>
(1074 bp) and <italic>LcUFGT</italic>
(1560 bp) of ‘Nuomici’ showed 86%, 79%, 95% and 67% identities to those of other plants excluding <italic>Arabidopsis</italic>
, respectively. In the case of UFGT, the similarity was the lowest, which was in agreement with previous reports in other plants <xref ref-type="bibr" rid="pone.0019455-Niu1">[15]</xref>
, <xref ref-type="bibr" rid="pone.0019455-Kim1">[21]</xref>
. The main anthocyanin identified in litchi pericarp is cyanidin-3-rutinoside, while the cyanidin-3-glucoside level is very low and no cyanidin-3-galactoside can be detected (<xref ref-type="fig" rid="pone-0019455-g003">Fig. 3</xref>
). This suggests that the key enzyme catalyzing the conversion of anthocyanidin to anthocyanin in litchi may be neither UDP glucose:flavonoid 3-<italic>O</italic>
-glucosyltransferase (UFGluT) nor UDP galactose:flavonoid 3-<italic>O</italic>
-galactosyltransferase (UFGalT). Further characterization of substrate and sugar specificity of litchi UFGT will be necessary to investigate.</p>
<table-wrap id="pone-0019455-t003" position="float"><object-id pub-id-type="doi">10.1371/journal.pone.0019455.t003</object-id>
<label>Table 3</label>
<caption><title>Homologies based on nucleotide sequences for anthocyanin biosynthetic genes isolated from litchi cv. Nuomici.</title>
</caption>
<alternatives><graphic id="pone-0019455-t003-3" xlink:href="pone.0019455.t003"></graphic>
<table frame="hsides" rules="groups"><colgroup span="1"><col align="left" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead><tr><td align="left" rowspan="1" colspan="1">Gene</td>
<td align="left" rowspan="1" colspan="1">GenBank number</td>
<td align="left" rowspan="1" colspan="1">Top <italic>Arabidopsis</italic>
BLAST match</td>
<td align="left" rowspan="1" colspan="1">Top BLAST match excluding <italic>Arabidopsis</italic>
</td>
<td align="left" rowspan="1" colspan="1">Homology (%)</td>
</tr>
</thead>
<tbody><tr><td align="left" rowspan="1" colspan="1"><italic>LcCHS</italic>
</td>
<td align="left" rowspan="1" colspan="1">GU288820.1</td>
<td align="left" rowspan="1" colspan="1">AT5G13930 ATCHS TT4</td>
<td align="left" rowspan="1" colspan="1">AJ850132.1 <italic>CHS</italic>
1 <italic>Dictamnus albus</italic>
</td>
<td align="left" rowspan="1" colspan="1">76<xref ref-type="table-fn" rid="nt102">a</xref>
, 81<xref ref-type="table-fn" rid="nt103">b</xref>
</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><italic>LcCHI</italic>
</td>
<td align="left" rowspan="1" colspan="1">HQ402910</td>
<td align="left" rowspan="1" colspan="1">AT3G55120 ATCHI TT5</td>
<td align="left" rowspan="1" colspan="1">FJ887897.1 <italic>CHI Citrus unshiu</italic>
</td>
<td align="left" rowspan="1" colspan="1">70<xref ref-type="table-fn" rid="nt102">a</xref>
, 86<xref ref-type="table-fn" rid="nt103">b</xref>
</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><italic>LcF3H</italic>
</td>
<td align="left" rowspan="1" colspan="1">HQ402911</td>
<td align="left" rowspan="1" colspan="1">AT3G51240 ATF3H TT6</td>
<td align="left" rowspan="1" colspan="1">EF468104.1 <italic>F3H Dimocarpus longan</italic>
</td>
<td align="left" rowspan="1" colspan="1">77<xref ref-type="table-fn" rid="nt102">a</xref>
, 97<xref ref-type="table-fn" rid="nt103">b</xref>
</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><italic>LcDFR</italic>
</td>
<td align="left" rowspan="1" colspan="1">HQ402912</td>
<td align="left" rowspan="1" colspan="1">AT5G42800 ATDFR TT3</td>
<td align="left" rowspan="1" colspan="1">AY519363.1 <italic>DFR Citrus sinensis</italic>
</td>
<td align="left" rowspan="1" colspan="1">73<xref ref-type="table-fn" rid="nt102">a</xref>
, 79<xref ref-type="table-fn" rid="nt103">b</xref>
</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><italic>LcANS</italic>
</td>
<td align="left" rowspan="1" colspan="1">HQ402913</td>
<td align="left" rowspan="1" colspan="1">AT4G22880 ATANS TT18</td>
<td align="left" rowspan="1" colspan="1">FJ479616.1 <italic>ANS Dimocarpus longan</italic>
</td>
<td align="left" rowspan="1" colspan="1">73<xref ref-type="table-fn" rid="nt102">a</xref>
, 95<xref ref-type="table-fn" rid="nt103">b</xref>
</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><italic>LcUFGT</italic>
</td>
<td align="left" rowspan="1" colspan="1">HQ402914</td>
<td align="left" rowspan="1" colspan="1">AT5G17050 ATUFGT</td>
<td align="left" rowspan="1" colspan="1">FJ169463.1 <italic>UFGT Vitis amurensis</italic>
</td>
<td align="left" rowspan="1" colspan="1">64<xref ref-type="table-fn" rid="nt102">a</xref>
, 67<xref ref-type="table-fn" rid="nt103">b</xref>
</td>
</tr>
</tbody>
</table>
</alternatives>
<table-wrap-foot><fn id="nt102"><label>a</label>
<p>% Similarity to <italic>Arabidopsis.</italic>
</p>
</fn>
<fn id="nt103"><label>b</label>
<p>% Similarity to other plant sequence.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s2e"><title>Expression of six anthocyanin biosynthetic genes in different fruit color phenotype litchis</title>
<p>To elucidate the molecular mechanisms for red coloration in the pericarp of litchi, the transcripts of anthocyanin structural genes were examined in non-red, unevenly red and evenly red cultivars of litchi at maturity. Primers for real-time PCR analysis and product size were shown in <xref ref-type="table" rid="pone-0019455-t004">Table 4</xref>
. Basically, in non-red varieties, ie. ‘Kuixingqingpitian’, Xingqiumili’, ‘Yamulong’ and ‘Yongxing No. 2′, the expression of six structural genes, especially the late structural genes from F3H to UFGT was much lower than in the red cultivars (<xref ref-type="fig" rid="pone-0019455-g004">Fig. 4 A</xref>
). The expression patterns of the early genes, ie. <italic>LcCHS, LcCHI</italic>
, <italic>LcF3H</italic>
, <italic>LcDFR</italic>
and <italic>LcANS</italic>
, displayed striking difference between two unevenly red cultivars, ‘Feizixiao’ and ‘Sanyuehong’. The former showed much lower expression levels than the later, though they contained comparable anthocyanins. However, they had comparable <italic>LcUFGT</italic>
expression level.</p>
<fig id="pone-0019455-g004" position="float"><object-id pub-id-type="doi">10.1371/journal.pone.0019455.g004</object-id>
<label>Figure 4</label>
<caption><title>Expression analysis of anthocyanin biosynthetic genes (A) and their correlationship with anthocyanin concentration (B) in the pericarp of twelve litchi cultivars.</title>
<p><italic>Lcactin</italic>
gene was used to normalize expression of the genes under identical conditions. The vertical bars represent standard error of three replicates. C1 to C12 are different cultivars explained in <xref ref-type="fig" rid="pone-0019455-g001">Figure 1</xref>
. Relative coefficient r with ‘*’ indicated significantly correlated at the level of P<0.05. Results of ANOVA test are presented in <xref ref-type="supplementary-material" rid="pone.0019455.s003">Table S2</xref>
.</p>
</caption>
<graphic xlink:href="pone.0019455.g004"></graphic>
</fig>
<table-wrap id="pone-0019455-t004" position="float"><object-id pub-id-type="doi">10.1371/journal.pone.0019455.t004</object-id>
<label>Table 4</label>
<caption><title>Primers for real-time PCR analysis.</title>
</caption>
<alternatives><graphic id="pone-0019455-t004-4" xlink:href="pone.0019455.t004"></graphic>
<table frame="hsides" rules="groups"><colgroup span="1"><col align="left" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead><tr><td align="left" rowspan="1" colspan="1">Gene</td>
<td align="left" rowspan="1" colspan="1">Forward primer (5′ to 3′)</td>
<td align="left" rowspan="1" colspan="1">Reverse primer (5′ to 3′)</td>
<td align="left" rowspan="1" colspan="1">Product (bp)</td>
</tr>
</thead>
<tbody><tr><td align="left" rowspan="1" colspan="1"><italic>LcCHS</italic>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">GACATTGTGGTGGTGGAGGT</named-content>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">TATTTAGCGAGACGGAGGAC</named-content>
</td>
<td align="left" rowspan="1" colspan="1">242</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><italic>LcCHI</italic>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">CGGAGTTTACTTGGAGGATGT</named-content>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">CAGTGACCTTCTCAGAGTATTG</named-content>
</td>
<td align="left" rowspan="1" colspan="1">185</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><italic>LcF3H</italic>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">GGTGGATAGATGTGACAAAGGAGT</named-content>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">GGTTGTGGGCATTTTGGATAGTA</named-content>
</td>
<td align="left" rowspan="1" colspan="1">169</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><italic>LcDFR</italic>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">ATAAAGCCAACTATCAATGGGAT</named-content>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">AGCCCATATCACTCCAGCAAGT</named-content>
</td>
<td align="left" rowspan="1" colspan="1">160</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><italic>LcANs</italic>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">AGGAAGTTGGTGGTCTGGAAG</named-content>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">CCGTTGCTGAGGATTTCAATGGTG</named-content>
</td>
<td align="left" rowspan="1" colspan="1">274</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><italic>LcUFGT</italic>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">GCCACCAGCGGTTCCTAATA</named-content>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">ATGCCTCTGCTACTGCTACAATCT</named-content>
</td>
<td align="left" rowspan="1" colspan="1">134</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><italic>Lcactin</italic>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">GTGGTTCTACTATGTTCCCTG</named-content>
</td>
<td align="left" rowspan="1" colspan="1"><named-content content-type="gene">CTCGTCGTACTCATCCTTTG</named-content>
</td>
<td align="left" rowspan="1" colspan="1">191</td>
</tr>
</tbody>
</table>
</alternatives>
<table-wrap-foot><fn id="nt104"><label></label>
<p>Detail information about cloning of <italic>LcCHS</italic>
, <italic>LcCHI</italic>
, <italic>LcF3H</italic>
, <italic>LcDFR</italic>
, <italic>LcANS</italic>
, <italic>LcUFGT</italic>
and <italic>Lcactin</italic>
is presented in <xref ref-type="supplementary-material" rid="pone.0019455.s006">Table S5</xref>
and <xref ref-type="supplementary-material" rid="pone.0019455.s007">Table S6</xref>
.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<p>To clarify the relationship between the expression of anthocyanin biosynthetic genes and anthocyanin accumulation, their correlations were calculated among the 12 tested cultivars (<xref ref-type="fig" rid="pone-0019455-g004">Figure 4 B</xref>
). The expression levels of these genes especially the late structural genes from <italic>LcF3H</italic>
to <italic>LcUFGT</italic>
and anthocyanin concentration in the pericarp displayed positive correlations. Significant relations were observed between the expression of <italic>LcDFR</italic>
(r = 0.73) and <italic>LcUFGT</italic>
(r = 0.59) and anthocyanin concentration.</p>
</sec>
<sec id="s2f"><title>Effects of ABA and CPPU on coloration and anthocyanin biosynthetic gene expression</title>
<p>Fruit color, concentrations of anthocyanins and the expression of anthocyanin biosynthetic genes in response to ABA and CPPU treatments were showed in <xref ref-type="fig" rid="pone-0019455-g005">Figure 5 A–C</xref>
. ABA improved while CPPU delayed coloration of litchi cv. Feizixiao (<xref ref-type="fig" rid="pone-0019455-g005">Fig. 5 A</xref>
), suggesting the biosynthesis of anthocyanins in the pericarp of ‘Feizixiao’ was accelerated by ABA while retarded by CPPU. In the pericarp of the control fruit, no anthcocyanin accumulation occurred before 14 days after treatment (DAT), but it was notably induced at 21 DAT, resulting in a 3.6-fold increase from 21 to 28 DAT (13.4 to 47.7 mg m<sup>−2</sup>
). In the pericarp of ABA treatment, no significant accumulation of anthocyanins was detectable at 7 DAT; thereafter, a rapid accumulation from 7 to 28 DAT occurred, resulting in a 2.5-fold higher level of anthocyanins (119.5 mg m<sup>−2</sup>
) than the control at harvest. In the pericarp of CPPU treatment, however, no notable anthocyanin accumulation occurred until 28 DAT, resulting a concentration which was less than one tenth of the control.</p>
<fig id="pone-0019455-g005" position="float"><object-id pub-id-type="doi">10.1371/journal.pone.0019455.g005</object-id>
<label>Figure 5</label>
<caption><title>Effects of ABA and CPPU on pigmentation and expression of anthocyanin biosynthetic genes.</title>
<p>A) difference in fruit color and anthocyanin concentration in pericarp of ‘Feizixiao’ treated with ABA and CPPU; B) effects of ABA and CPPU on the expression of anthocyanin biosynthetic genes in the pericarp cv. Feizixiao; C) correlations between anthocyanin concentration and expression of anthocyanin biosynthetic genes in pericarp of ‘Feizixiao’. <italic>Lcactin</italic>
gene was used to normalize expression of the genes under identical conditions. The vertical bars represent standard error of three replicates. Relative coefficient r with ‘*’ indicated significantly correlated at the level of P<0.05. Results of ANOVA test are presented in <xref ref-type="supplementary-material" rid="pone.0019455.s004">Table S3</xref>
.</p>
</caption>
<graphic xlink:href="pone.0019455.g005"></graphic>
</fig>
<p>The expression patterns of the six tested genes were similar in the pericarp of ‘Feizixiao’ from 0 to 28 DAT with the exception of <italic>LcUFGT</italic>
(<xref ref-type="fig" rid="pone-0019455-g005">Fig. 5C</xref>
). The expression of <italic>LcCHS, LcCHI, LcF3H, LcDFR</italic>
and <italic>LcANS</italic>
was low in the pericarp of the control throughout experimental period. The expression of all these five genes was up-regulated during 0 to 14 DAT in CPPU treatment and 0 to 3 DAT in ABA treatment. The expression pattern of <italic>LcUFGT</italic>
was found paralleling with anthocyanin accumulation among treatments. Expression of <italic>LcUFGT</italic>
was detected in all of the red pericarps, but not in any of the non-red pericarps. Its expression was not detectable before 14 DAT, after which there was a notable expression in the control. In the pericarp with CPPU treatment, the expression of <italic>LcUFGT</italic>
was hardly detectable during the whole experiment period, while a steady increase of <italic>LcUFGT</italic>
expression was observed in ABA treatment.</p>
<p>We correlated the expression of six anthocyanin biosynthetic genes to anthocyanin concentrations in different pericarp parts with different color in ‘Feizixiao’. Regression curves and correlation coefficients are shown in <xref ref-type="fig" rid="pone-0019455-g005">Fig. 5 C</xref>
. Only the expression of <italic>LcUFGT</italic>
was found significantly correlated with anthocyanin concentration (r = 0.84).</p>
</sec>
<sec id="s2g"><title>Effects of bagging and debagging on anthocyanin accumulation and anthocyanin biosynthetic gene expression</title>
<p>Bagging and bag removal were employed to study the effects of illumination on anthocyanin accumulation and the expression of anthocyanin biosynthetic genes (<xref ref-type="fig" rid="pone-0019455-g006">Fig. 6</xref>
). Both color development and anthocyanin accumulation were greatly inhibited by bagged in the pericarp of ‘Feizixiao’, with an anthocyanin concentration being less than 10% of that of non-bagged fruit (<xref ref-type="fig" rid="pone-0019455-g006">Fig 6A</xref>
). But significant anthocyanin accumulation occurred after bag removal. The concentration of anthocyanins increased by 70 times in bagged fruit at 7 days after bag removal, which was about 50% higher than that in the control. This result is consistent with previous studies on apple, pear, and peach, which indicated that sunlight exposure enhanced anthocyanin accumulation <xref ref-type="bibr" rid="pone.0019455-Takos2">[22]</xref>
, <xref ref-type="bibr" rid="pone.0019455-Feng1">[23]</xref>
, <xref ref-type="bibr" rid="pone.0019455-Jia1">[24]</xref>
.</p>
<fig id="pone-0019455-g006" position="float"><object-id pub-id-type="doi">10.1371/journal.pone.0019455.g006</object-id>
<label>Figure 6</label>
<caption><title>Effects of bagging and bag removal on pigmentation and expression of anthocyanin biosynthetic genes.</title>
<p>A) difference in fruit color and anthocyanin concentration in fruit of ‘Feizixiao’ after bagging and bag removal; B) expression analysis of anthocyanin biosynthetic genes in the pericarp of ‘Feizixiao’ after bagging and bag removal. The vertical bars represent standard error of three replicates.</p>
</caption>
<graphic xlink:href="pone.0019455.g006"></graphic>
</fig>
<p>The expression of all anthocyanin biosynthetic genes was possibly inhibited by the bagging treatment and stimulated by bag removal, indicating that sufficient light was essential for expression of the anthocyanin biosynthetic genes. In a study of ‘Cripps’ Red' apples, exposure of bagged fruit to sunlight induced anthocyanin synthesis and the synthesis of anthocyanins correlated with an increase in transcript levels of flavonoid pathway genes <xref ref-type="bibr" rid="pone.0019455-Takos2">[22]</xref>
. In the present study, the six genes tested were all up-regulated after exposure to sunlight (<xref ref-type="fig" rid="pone-0019455-g006">Fig. 6 B</xref>
). Among them, <italic>LcUFGT</italic>
was most concurrent with anthocyanin accumulation, where low expression level was found particularly in bagged fruit at color break stage and a sharp increase after debagging.</p>
</sec>
</sec>
<sec id="s3"><title>Discussion</title>
<p>In this study, we demonstrated that a wide range of variability among litchi cultivars in their concentrations of anthocyanins and chlorophylls and chromatic parameters at fruit maturity (<xref ref-type="table" rid="pone-0019455-t001">Table 1</xref>
, <xref ref-type="fig" rid="pone-0019455-g002">Fig. 2</xref>
). Anthocyanins imparted litchi fruit red hues, while green fruit owed their color to chlorophylls. Hue angle correlated negatively with the total anthocyanin concentration (r = −0.78), but positively with chlorophyll concentration (r = 0.86) in the pericarp of litchis (<xref ref-type="fig" rid="pone-0019455-g002">Fig. 2</xref>
). Generally, the same anthocyanins were present in the red cultivars with similar relative levels (<xref ref-type="fig" rid="pone-0019455-g003">Fig. 3A</xref>
). The dominant anthoycanin in litchi pericarp was putatively identified as cyanidin-3-rutinoside (>93%), as previously reported by Zhang et al.in cv. Huaizhi <xref ref-type="bibr" rid="pone.0019455-Zhang1">[6]</xref>
.</p>
<p>Six genes encoding the anthocyanin biosynthesis enzymes namely <italic>LcCHS, LcCHI, LcF3H, LcDFR, LcANS</italic>
and <italic>LcUFGT</italic>
were isolated from the pericarp of ‘Nuomici’. These genes were highly homologous, based on BLAST matches, to those from citrus, grape and longan (<xref ref-type="table" rid="pone-0019455-t003">Table 3</xref>
). Anthocyanin accumulation was positively correlated with the expression of four anthocyanin biosynthetic genes (<italic>LcF3H, LcDFR, LcANS</italic>
and <italic>LcUFGT</italic>
) in pericarp of litchi (<xref ref-type="fig" rid="pone-0019455-g004">Fig. 4</xref>
). The expression of these genes in non-red cultivars, ‘Kuixingqingpitian’, ‘Xingqiumili’, ‘Yamulong’ and ‘Yongxing No. 2′, was weak, whereas in the red one, ‘Feizixiao’, ‘Sanyuehong’, ‘Meiguili’, ‘Baila’, ‘Guiwei’, ‘Nuomici’ and ‘Guinuo’, it was notable. This result suggests that late anthocyanin biosynthetic pathway genes were coordinately expressed in red colored pericarp of litchi, which indicates that alterations of regulating genes may have occurred in these cultivars resulting in decreased synthesis of certain enzymes of the pathway, preventing the accumulation of anthocyanins.</p>
<p>In the present study, we found that the expression of the late genes in anthocyanin synthesis pathway, <italic>LcDFR</italic>
and <italic>LcUFGT</italic>
in particular, were consistent with the degree of anthocyanin concentration in different color genotypes of litchi. Similar results were also reported in apples <xref ref-type="bibr" rid="pone.0019455-Honda1">[10]</xref>
, <xref ref-type="bibr" rid="pone.0019455-Takos1">[12]</xref>
, <xref ref-type="bibr" rid="pone.0019455-Espley1">[13]</xref>
and Chinese bayberry <xref ref-type="bibr" rid="pone.0019455-Niu1">[15]</xref>
, indicating that the multiple late genes determined the differential anthocyanin accumulation among different genetypes. The results differed from those reported in grapes where <italic>UFGT</italic>
was found the only gene that made the difference in coloration between white type and its red sport <xref ref-type="bibr" rid="pone.0019455-Boss1">[8]</xref>
, <xref ref-type="bibr" rid="pone.0019455-Kobayashi1">[9]</xref>
. Hence, the different results might be related to the difference in genetic background of the materials studied.</p>
<p>Some enzymes involved in the anthocyanin biosynthetic pathway were studied during development or exogenous stimulus. Lister et al. reported that the activities of CHI and UGFalT in ‘Splendour’ apple were correlated with anthocyanin accumulation during fruit ripening <xref ref-type="bibr" rid="pone.0019455-Lister1">[25]</xref>
. In ‘Delicious’ and ‘Ralls’ apples exposed to light, CHS activity was not positively correlated with anthocyanin accumulation, whereas UFGalT was positively correlated with anthocyanin accumulation <xref ref-type="bibr" rid="pone.0019455-Ju1">[26]</xref>
. Moreover, they found that the rapid accumulation of anthocyanins was correlated with an increase in DFR activity in ‘Delicious’ apple <xref ref-type="bibr" rid="pone.0019455-Ju2">[27]</xref>
. These physiological studies show modification of anthocyanin accumulation by factors beyond the genetic background. In the present study, we investigated developmental changes in the expression of anthocyanin pathway genes and examined their response to growth regulators and illumination conditions (<xref ref-type="fig" rid="pone-0019455-g005">Fig 5</xref>
, <xref ref-type="fig" rid="pone-0019455-g006">6</xref>
). Expression of <italic>LcUFGT</italic>
was not detected in any of the green pericarp either before color break or after CPPU application. Hence it appears to be independent of the expression of the other flavonoid synthetic genes in the pericarp of red litchi cv. Feizixiao.</p>
<p>The encoded enzyme UFGT catalyzes the glycosylation of the unstable anthocyanidin aglycones into stable anthocyanins. Only the expression of UFGT was significantly positively correlated with anthocyanin concentration in the pericarp of ‘Feizixiao’ (<xref ref-type="fig" rid="pone-0019455-g005">Fig. 5 C</xref>
). Our previous studies on the activities of enzymes in anthocyanin biosynthesis including PAL, CHI, DFR and UFGT in the pericarp of ‘Feizixiao’ during fruit development and in response to bagging and growth regulator dipping treatments revealed that only the activity of UFGT was in parallel with the changes in anthocyanin concentration <xref ref-type="bibr" rid="pone.0019455-Wang2">[28]</xref>
. In the present study, ABA treatment at about one month before commercial harvest enhanced, whereas CPPU treatment at the same date inhibited the expression of <italic>LcUFGT</italic>
as well as anthocyanin synthesis (<xref ref-type="fig" rid="pone-0019455-g005">Fig. 5</xref>
). Accumulation of anthocyanin was also induced and the structural genes in flavonoid pathways were up-regulated in berry skin of the Cabernet Sauvignon grape by ABA application <xref ref-type="bibr" rid="pone.0019455-Koyama1">[29]</xref>
. Cluster bagging inhibited, while bag removal increased both the expression of UFGT and anthocyanin accumulation (<xref ref-type="fig" rid="pone-0019455-g006">Fig. 6</xref>
). All these results suggest that UFGT was the limiting factor to anthocyanin biosynthesis in the pericarp of ‘Feizixiao’.</p>
<p>The predominant role of UFGT in the coloration of a given red litchi cultivar suggest that <italic>LcUFGT</italic>
expression was under a different regulatory regime from the other flavonoid synthetic genes. UFGT could be expressed either synchronously with or independent from other flavonoid synthetic genes.</p>
</sec>
<sec sec-type="materials|methods" id="s4"><title>Materials and Methods</title>
<sec id="s4a"><title>Plant material and treatments</title>
<p>Fruit samples of selected twelve litchi cultivars based on their fruit color phenotypes, including four non-red skin cultivars ‘Kuixingqingpitian’, ‘Xinqiumili’, ‘Yamulong’, and ‘Yongxing No. 2′, two unevenly red cultivars ‘Feizixiao’ and ‘Sanyuehong’ and six evenly red cultivars ‘Meiguili’, ‘Baila’,‘Baitangying’, ‘Guiwei’, ‘Nuomici’ and ‘Guinuo’, were taken from Haikou, Hainan province, China and experimental orchard of South China Agricultural University in Guangzhou, Guangdong, China (as shown in <xref ref-type="fig" rid="pone-0019455-g001">Fig. 1</xref>
). Thirty exposed fruit for each cultivar were picked randomly at commercial maturity. The sampling date, average fruit weight, aril total soluble solid and titratable acid of twelve litchi cultivars are listed in <xref ref-type="supplementary-material" rid="pone.0019455.s005">Table S4</xref>
. After color parameter measurements, pericarp discs were sampled between 10∶00 to 11∶00 am, frozen in liquid N<sub>2</sub>
, and stored at −80°C for RNA extraction and other analyses.</p>
<p>The growth regulator applications were carried out 4 weeks before harvest. Triplicate lots from 3 trees of cv. Feizixiao grown in the experimental orchard of South China Agricultural University were sprayed with abscisic acid (ABA, 25 mg l<sup>−1</sup>
), forchlorofenron (CPPU, 4 mg l<sup>−1</sup>
) and tap water (Control), respectively. After color measurement, pericarp discs were sampled on the day of growth regulator spraying (day 0) and 1, 3, 7, 14, 21 and 28 days after treatments.</p>
<p>In the bagging experiments, three trees of cv. Feizixiao were allotted. Ten clusters existing in different parts of the canopy of each tree were bagged with double-layer kraft paper bags at one month after full bloom. Bags were removed at color break. Clusters in similar development stage grown near the treated ones were served as the control. After color measurements, pericarp discs were sampled on the day of bag removal and on the 7th day after bag removal. All samples were frozen in liquid nitrogen, and stored at −80°C until use.</p>
</sec>
<sec id="s4b"><title>Color analyses</title>
<p>The pericarp color variables were measured on 15 fruit samples immediately after picking. L*, a*, and b* values was measured randomly with a Konica Minolta CR-10 Chroma Meter (Minolta, Japan) on the site opposite to the fruit suture. The lightness coefficient ‘L*’, represents brightness and darkness, ‘a*’ value represents greenish and redness as the value increases from negative to positive, and ‘b*’ represents bluish and yellowish. Hue angle (h*) were calculated according to the following equations <xref ref-type="bibr" rid="pone.0019455-McGuire1">[30]</xref>
, <xref ref-type="bibr" rid="pone.0019455-Voss1">[31]</xref>
:</p>
<p>h* = ATAN(b/a)/6.2823*360 when a*≥0 and b*≥0 and h* = ATAN(b/a)/6.2823*360+180 when a*<0 and b*>0.</p>
</sec>
<sec id="s4c"><title>Determination of pigments</title>
<p>Total anthocyanins were determined according to the method developed by Fuleki and Francis <xref ref-type="bibr" rid="pone.0019455-Fuleki1">[32]</xref>
which involves the measurement of the absorbance at 520 nm on samples diluted with pH 1.0 and 4.5 buffers. Four peel discs (2 cm<sup>2</sup>
) were extracted with methanol/water/HCl (3 ml, 85∶12∶3, v/v) for four hours at room temperature at dark. Peel chlorophylls and caroteniods were measured according to Arnon <xref ref-type="bibr" rid="pone.0019455-Arnon1">[33]</xref>
.</p>
</sec>
<sec id="s4d"><title>HPLC analysis of anthocyanins</title>
<p>Anthocyanins were extracted as above mentioned in anthocyanin determination using a solvent containing methanol : water : HCl (85 ∶ 12 ∶ 3, v/v). The supernatants were filtered through a 0.45 µm Millipore™ filter before used. Anthocyanins in the samples were analyzed using a HP1200-DAD system (Agilent Technologies, Waldbronn, Germany). Detection was performed at 510 nm. A NUCLEODUR<sup>®</sup>
C18 column (250 mm×4.6×mm) (Pretech Instruments, Sollentuna, Sweden) was used for separation at 35°C and eluted using a mobile phase consisting of solvent A (1.6% formic acid in methanol) and solvent B (1.6% formic acid in water) at a flow rate of 1.0 ml min<sup>−1</sup>
. The elution program was followed the procedure described by Wu and Prior <xref ref-type="bibr" rid="pone.0019455-Wu1">[34]</xref>
with some modifications. Solvent A was 15% initially and increased linearly in steps to 20% at 5 min, 28% at 10 min, 40% at 28 min to 40 min.</p>
</sec>
<sec id="s4e"><title>RNA extraction and cDNA synthesis</title>
<p>Total RNA was extracted from pericarp tissues using the RNA<sub>OUT</sub>
kit (Tiandz, Beijing). DNase I (TaKaRa, Japan) was added to remove genomic DNA <xref ref-type="bibr" rid="pone.0019455-Huang1">[35]</xref>
and RNase-free columns (Tiandz, Beijing) were used for purifying total RNA. The concentration of total RNA was measured by absorbance at 260 nm using BioPhotometer Plus (Eppendorf, Germany), and the integrity and quality of the RNA was checked using agarose gel electrophoresis and A<sub>260/280</sub>
ratio. Subsequently, first-strand cDNA was synthesized from total RNA (2 µg) using oligo(dT) primers following the manufacturer's instructions of PrimeScript™ RT-PCR Kit (TaKaRa, Japan).</p>
</sec>
<sec id="s4f"><title>Cloning of anthocyanin biosynthetic genes</title>
<p>Degenerate primers were designed based on the highly conserved peptide regions of CHS, CHI, F3H, DFR, ANS and UFGT (<xref ref-type="table" rid="pone-0019455-t002">Table 2</xref>
). The cDNAs encoding these proteins were amplified by PCR using these degenerate primers. cDNAs synthesized from mature pericarp of cv. Nuomici were used as PCR templates. Amplified PCR products of appropriate length were cloned into T/A cloning vector pMD<sup>®</sup>
20-T (TaKaRa, Japan) and then transformed into <italic>E.coli</italic>
DH5α Max Efficiency chemically competent cells (TaKaRa, Japan). Plasmid DNA isolated from positive <italic>E.coli</italic>
cells was digested with <italic>Eco</italic>
R I, and the inserted DNA was sent to Beijing Genomics Institute for sequencing.</p>
<p>Rapid amplification of cDNA ends (RACE) was performed to obtain the 3′and 5′ ends of these six genes in anthocyanin biosynthetic pathway from mature pericarp cv. Nuomici using 3′ -Full RACE Core Set Ver.2.0 and 5′ RACE Kit (TaKaRa, Japan). Full-length or partial-length cDNA sequences encoding CHS, CHI, F3H, DFR, ANS and UFGT enzymes are available in the GenBank nucleotide database.</p>
</sec>
<sec id="s4g"><title>Sequence analysis</title>
<p>Analysis of CHS, CHI, F3H, DFR, ANS, and UFGT sequences and comparing them with known sequences was carried out using NCBI Blast server <xref ref-type="bibr" rid="pone.0019455-Altschul1">[36]</xref>
. Multiple sequence alignment was performed using ClustalX 1.83 (<ext-link ext-link-type="uri" xlink:href="http://www.ebi.ac.uk">http://www.ebi.ac.uk</ext-link>
) <xref ref-type="bibr" rid="pone.0019455-Thompson1">[37]</xref>
.</p>
</sec>
<sec id="s4h"><title>Quantitative real-time PCR analysis</title>
<p>Isolation of total RNA from the pericarp of litchis and synthesis first strand cDNA were performed as described above. The transcript levels of <italic>LcCHS</italic>
, <italic>LcCHI</italic>
, <italic>LcF3H</italic>
, <italic>LcDFR</italic>
, <italic>LcANS</italic>
, and <italic>LcUFGT</italic>
were analysed using quantitative real-time PCR (RT-qPCR) with THUNDERBIRD qPCR Mix (TOYOBO, Japan) and ABI 7500 Real-Time PCR Systems (Applied Biosystems, USA), according to the manufacturers' instructions. Each reaction (final volume, 20 µl) contained 10 µl 2×SYBR® qPCR Mix (TOYOBO), 0.04 µl 50×ROX reference dye, 1 µl of each the forward and reverse primers (0.25 µM), 2 µl of the cDNA template (corresponding to 50 ng of total RNA), and 7 µl of RNase-free water. The reaction mixtures were heated to 95°C for 30 s, followed by 35 cycles at 95°C for 10 s, 55°C for 15 s, and 72°C for 30 s. A melting curve was generated for each sample at the end of each run to ensure the purity of the amplified products.</p>
<p>All gene-specific primers from the identified genes for real-time PCR were designed using a Primer 5.0 program (PREMIER Biosoft International, Canada) (<xref ref-type="table" rid="pone-0019455-t004">Table 4</xref>
). Each assay using the gene-specific primers amplified a single product of correct size with high PCR efficiency (90%–110%) <xref ref-type="bibr" rid="pone.0019455-Lefever1">[38]</xref>
. Among seven frequently used candidate reference genes, actin gene (GenBank accession number:HQ615689) was stably expressed in varieties and fruit developmental stage according to a study on selection of reliable reference genes for expression study by qRT-PCR in litchi <xref ref-type="bibr" rid="pone.0019455-Zhong1">[39]</xref>
. Actin gene also exhibited expression stability in ABA and CPPU treatments (See <xref ref-type="supplementary-material" rid="pone.0019455.s008">Table S7</xref>
). All qRT-PCR reactions were normalized using Ct value corresponding to the actin gene. The relative expression levels of target genes were calculated with formula 2<sup>−▵▵CT</sup>
<xref ref-type="bibr" rid="pone.0019455-Livak1">[40]</xref>
. Values reported represent the average of three biological replicate.</p>
</sec>
<sec id="s4i"><title>Statistical analysis</title>
<p>Statistical analyses were performed using the statistical package DPS v3.0 (Hangzhou, China). Duncan multiple range test was used to determine significance of color parameter differences at the 5% level. Pearson correlation coefficients were calculated and a two-tailed test was used to determine significance at the 5% level.</p>
</sec>
</sec>
<sec sec-type="supplementary-material" id="s5"><title>Supporting Information</title>
<supplementary-material content-type="local-data" id="pone.0019455.s001"><label>Figure S1</label>
<caption><p>HPLC elution profile of anthocyanins from pericarp of full red litchi cultivars.</p>
<p>(DOC)</p>
</caption>
<media xlink:href="pone.0019455.s001.doc" mimetype="application" mime-subtype="msword"><caption><p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="pone.0019455.s002"><label>Table S1</label>
<caption><p>Results of ANOVA test for L*, a*, b*and h* among twelve cultivars.</p>
<p>(XLS)</p>
</caption>
<media xlink:href="pone.0019455.s002.xls" mimetype="application" mime-subtype="vnd.ms-excel"><caption><p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="pone.0019455.s003"><label>Table S2</label>
<caption><p>Results of ANOVA test on relative coefficients between anthocyanin concentration and gene expression level in the pericarp of twelve cultivars.</p>
<p>(DOC)</p>
</caption>
<media xlink:href="pone.0019455.s003.doc" mimetype="application" mime-subtype="msword"><caption><p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="pone.0019455.s004"><label>Table S3</label>
<caption><p>Results of ANOVA test on relative coefficients between anthocyanin concentration and gene expression level in the pericarp of different pigmentation pericarp of ‘Feizixiao’.</p>
<p>(DOC)</p>
</caption>
<media xlink:href="pone.0019455.s004.doc" mimetype="application" mime-subtype="msword"><caption><p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="pone.0019455.s005"><label>Table S4</label>
<caption><p>Sampling date, fruit weight, total soluble solid and titratable acid of litchis at maturity.</p>
<p>(DOC)</p>
</caption>
<media xlink:href="pone.0019455.s005.doc" mimetype="application" mime-subtype="msword"><caption><p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="pone.0019455.s006"><label>Table S5</label>
<caption><p>Cloning of <italic>LcCHS</italic>
, <italic>LcCHI</italic>
, <italic>LcF3H</italic>
, <italic>LcDFR</italic>
, <italic>LcANS</italic>
and <italic>LcUFGT</italic>
.</p>
<p>(DOC)</p>
</caption>
<media xlink:href="pone.0019455.s006.doc" mimetype="application" mime-subtype="msword"><caption><p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="pone.0019455.s007"><label>Table S6</label>
<caption><p>Cloning and identification of <italic>LcActin.</italic>
</p>
<p>(DOC)</p>
</caption>
<media xlink:href="pone.0019455.s007.doc" mimetype="application" mime-subtype="msword"><caption><p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="pone.0019455.s008"><label>Table S7</label>
<caption><p>Evaluating the expression stability of reference genes.</p>
<p>(DOC)</p>
</caption>
<media xlink:href="pone.0019455.s008.doc" mimetype="application" mime-subtype="msword"><caption><p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
</sec>
</body>
<back><ack><p>We thank Drs. Yong-Hua Qin, Jian-Guo Li and Hou-Bin Chen for technical assistance and reading of the manuscript.</p>
</ack>
<fn-group><fn fn-type="conflict"><p><bold>Competing Interests: </bold>
The authors have declared that no competing interests exist.</p>
</fn>
<fn fn-type="financial-disclosure"><p><bold>Funding: </bold>
The project was supported by National Natural Science Fund of China (Project No. 30971985), Special Fund for Agro-scientific Research in the Public Interest (Project No. nyhyzx07-31) and China Litchi Industry Technology Research System (Project No. nycytx-32), Ministry of Agriculture, China. The funders had no role in study design, data colletion and analysis, decision to publish, or preparation of the manuscript.</p>
</fn>
</fn-group>
<ref-list><title>References</title>
<ref id="pone.0019455-Macheix1"><label>1</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Macheix</surname>
</name>
<name><surname>JJ</surname>
</name>
<name><surname>Fluriet</surname>
<given-names>A</given-names>
</name>
<name><surname>Billot</surname>
<given-names>J</given-names>
</name>
</person-group>
<year>1990</year>
<article-title>Fruit Phenolics.</article-title>
<source>CRC Press, Boca Raton</source>
<volume>378</volume>
</element-citation>
</ref>
<ref id="pone.0019455-Holton1"><label>2</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Holton</surname>
<given-names>TA</given-names>
</name>
<name><surname>Cornish</surname>
<given-names>EC</given-names>
</name>
</person-group>
<year>1995</year>
<article-title>Genetics and biochemistry of anthocyanin biosynthesis.</article-title>
<source>Plant Cell</source>
<volume>7</volume>
<fpage>1071</fpage>
<lpage>1083</lpage>
<pub-id pub-id-type="pmid">12242398</pub-id>
</element-citation>
</ref>
<ref id="pone.0019455-Deroles1"><label>3</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Deroles</surname>
<given-names>S</given-names>
</name>
</person-group>
<year>2009</year>
<article-title>Anthocyanin biosynthesis in plant cell cultures: A potential source of natural colourants. In: Kevin G, Kevin D, Chris W (eds) Anthocyanins: Biosynthesis, functions and applications. 107-117.</article-title>
<source>Springer Science+Business Media, LLC., New York, USA</source>
<volume>329</volume>
</element-citation>
</ref>
<ref id="pone.0019455-Lee1"><label>4</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Lee</surname>
<given-names>HS</given-names>
</name>
<name><surname>Wicker</surname>
<given-names>L</given-names>
</name>
</person-group>
<year>1991</year>
<article-title>Anthocyanin pigments in the skin of lychee fruit.</article-title>
<source>J Food Sci</source>
<volume>56</volume>
<fpage>446</fpage>
<lpage>468</lpage>
</element-citation>
</ref>
<ref id="pone.0019455-RiveraLpez1"><label>5</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Rivera-López</surname>
<given-names>J</given-names>
</name>
<name><surname>Ordorrica-Falomir</surname>
<given-names>C</given-names>
</name>
<name><surname>Wesche-Ebeling</surname>
<given-names>P</given-names>
</name>
</person-group>
<year>1999</year>
<article-title>Changes in anthocyanin concentration in Lychee (<italic>Litchi chinensis</italic>
Sonn.) pericarp during maturation.</article-title>
<source>Food Chem</source>
<volume>65</volume>
<fpage>195</fpage>
<lpage>200</lpage>
</element-citation>
</ref>
<ref id="pone.0019455-Zhang1"><label>6</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Zhang</surname>
<given-names>Z</given-names>
</name>
<name><surname>Pang</surname>
<given-names>X</given-names>
</name>
<name><surname>Yang</surname>
<given-names>C</given-names>
</name>
<name><surname>Ji</surname>
<given-names>Z</given-names>
</name>
<name><surname>Jiang</surname>
<given-names>Y</given-names>
</name>
</person-group>
<year>2004</year>
<article-title>Purification and structural analysis of anthocyanins from litchi pericarp.</article-title>
<source>Food Chem</source>
<volume>84</volume>
<fpage>601</fpage>
<lpage>604</lpage>
</element-citation>
</ref>
<ref id="pone.0019455-Wheelwright1"><label>7</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Wheelwright</surname>
<given-names>NT</given-names>
</name>
<name><surname>Janson</surname>
<given-names>CH</given-names>
</name>
</person-group>
<year>1985</year>
<article-title>Colors of fruit displays of bird-dispersed plants in two tropical forests. Am.</article-title>
<source>Nat</source>
<volume>126</volume>
<fpage>777</fpage>
<lpage>799</lpage>
</element-citation>
</ref>
<ref id="pone.0019455-Boss1"><label>8</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Boss</surname>
<given-names>PK</given-names>
</name>
<name><surname>Davies</surname>
<given-names>C</given-names>
</name>
<name><surname>Robinson</surname>
<given-names>SP</given-names>
</name>
</person-group>
<year>1996</year>
<article-title>Expression of anthocyanin biosynthesis pathway genes in red and white grape.</article-title>
<source>Plant Mol Bio</source>
<volume>32</volume>
<fpage>565</fpage>
<lpage>569</lpage>
<pub-id pub-id-type="pmid">8980508</pub-id>
</element-citation>
</ref>
<ref id="pone.0019455-Kobayashi1"><label>9</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Kobayashi</surname>
<given-names>S</given-names>
</name>
<name><surname>Ishimaru</surname>
<given-names>M</given-names>
</name>
<name><surname>Ding</surname>
<given-names>CK</given-names>
</name>
<name><surname>Yakushiji</surname>
<given-names>H</given-names>
</name>
<name><surname>Goto</surname>
<given-names>N</given-names>
</name>
</person-group>
<year>2001</year>
<article-title>Comparison of UDP-glucose: flavonoid 3-<italic>O</italic>
-glucosyltransferase (UFGT) gene sequences between white grapes (<italic>Vitis vinifera</italic>
) and their sports with red skin.</article-title>
<source>Plant Sci</source>
<volume>160</volume>
<fpage>543</fpage>
<lpage>550</lpage>
<pub-id pub-id-type="pmid">11166442</pub-id>
</element-citation>
</ref>
<ref id="pone.0019455-Honda1"><label>10</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Honda</surname>
<given-names>C</given-names>
</name>
<name><surname>Kotoda</surname>
<given-names>N</given-names>
</name>
<name><surname>Wada</surname>
<given-names>M</given-names>
</name>
<name><surname>Kondo</surname>
<given-names>S</given-names>
</name>
<name><surname>Kobayashi</surname>
<given-names>S</given-names>
</name>
<etal></etal>
</person-group>
<year>2002</year>
<article-title>Anthocyanin biosynthetic genes are coordinately expressed during red coloration in apple skin.</article-title>
<source>Plant Physiol Biochem</source>
<volume>40</volume>
<fpage>955</fpage>
<lpage>962</lpage>
</element-citation>
</ref>
<ref id="pone.0019455-Kobayashi2"><label>11</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Kobayashi</surname>
<given-names>S</given-names>
</name>
<name><surname>Ishimaru</surname>
<given-names>M</given-names>
</name>
<name><surname>Hiraoka</surname>
<given-names>K</given-names>
</name>
<name><surname>Honda</surname>
<given-names>C</given-names>
</name>
</person-group>
<year>2002</year>
<article-title>Myb-related genes of the Kyoho grape (<italic>Vitis labruscana</italic>
) regulate anthocyanin biosynthesis.</article-title>
<source>Planta</source>
<volume>215</volume>
<fpage>924</fpage>
<lpage>933</lpage>
<pub-id pub-id-type="pmid">12355152</pub-id>
</element-citation>
</ref>
<ref id="pone.0019455-Takos1"><label>12</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Takos</surname>
<given-names>AM</given-names>
</name>
<name><surname>Jaffé ´</surname>
<given-names>FW</given-names>
</name>
<name><surname>Jacob</surname>
<given-names>SR</given-names>
</name>
<name><surname>Bogs</surname>
<given-names>J</given-names>
</name>
<name><surname>Robinson</surname>
<given-names>SP</given-names>
</name>
<etal></etal>
</person-group>
<year>2006</year>
<article-title>Light-induced expression of a MYB gene regulates anthocyanin biosynthesis in red apples.</article-title>
<source>Plant Physiol</source>
<volume>142</volume>
<fpage>1216</fpage>
<lpage>1232</lpage>
<pub-id pub-id-type="pmid">17012405</pub-id>
</element-citation>
</ref>
<ref id="pone.0019455-Espley1"><label>13</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Espley</surname>
<given-names>RV</given-names>
</name>
<name><surname>Hellens</surname>
<given-names>RP</given-names>
</name>
<name><surname>Putterill</surname>
<given-names>J</given-names>
</name>
<name><surname>Stevenson</surname>
<given-names>DE</given-names>
</name>
<name><surname>Kutty-Amma</surname>
<given-names>S</given-names>
</name>
<etal></etal>
</person-group>
<year>2007</year>
<article-title>Red colouration in apple fruit is due to the activity of the MYB transcription factor, MdMYB10.</article-title>
<source>Plant J</source>
<volume>49</volume>
<fpage>414</fpage>
<lpage>427</lpage>
<pub-id pub-id-type="pmid">17181777</pub-id>
</element-citation>
</ref>
<ref id="pone.0019455-Palapol1"><label>14</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Palapol</surname>
<given-names>Y</given-names>
</name>
<name><surname>Ketsa</surname>
<given-names>S</given-names>
</name>
<name><surname>Lin-Wang</surname>
<given-names>K</given-names>
</name>
<name><surname>Ferguson</surname>
<given-names>IB</given-names>
</name>
<name><surname>Allan</surname>
<given-names>AC</given-names>
</name>
</person-group>
<year>2009</year>
<article-title>A MYB transcription factor regulates anthocyanin biosynthesis in mangosteen (<italic>Garcinia mangostana</italic>
L.) fruit during ripening.</article-title>
<source>Planta</source>
<volume>229</volume>
<fpage>1323</fpage>
<lpage>1334</lpage>
<pub-id pub-id-type="pmid">19306102</pub-id>
</element-citation>
</ref>
<ref id="pone.0019455-Niu1"><label>15</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Niu</surname>
<given-names>SS</given-names>
</name>
<name><surname>Xu</surname>
<given-names>CJ</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>WS</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>B</given-names>
</name>
<name><surname>Li</surname>
<given-names>X</given-names>
</name>
<etal></etal>
</person-group>
<year>2010</year>
<article-title>Coordinated regulation of anthocyanin biosynthesis in Chinese bayberry (<italic>Myrica rubra</italic>
) fruit by a R2R3MYB transpription factor.</article-title>
<source>Planta</source>
<volume>231</volume>
<fpage>887</fpage>
<lpage>899</lpage>
<pub-id pub-id-type="pmid">20183921</pub-id>
</element-citation>
</ref>
<ref id="pone.0019455-Zhang2"><label>16</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Zhang</surname>
<given-names>X</given-names>
</name>
<name><surname>Allan</surname>
<given-names>AC</given-names>
</name>
<name><surname>Yi</surname>
<given-names>Q</given-names>
</name>
<name><surname>Chen</surname>
<given-names>L</given-names>
</name>
<name><surname>Li</surname>
<given-names>K</given-names>
</name>
<etal></etal>
</person-group>
<year>2010</year>
<article-title>Differential gene expression analysis of Yunan red pear, <italic>Pyrus Pyrifolia</italic>
, during fruit skin coloration.</article-title>
<source>Plant Mol Biol Rep</source>
<comment>DOI 10.1007/s11105-010-0231-z</comment>
</element-citation>
</ref>
<ref id="pone.0019455-Chen1"><label>17</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Chen</surname>
<given-names>D</given-names>
</name>
<name><surname>Li</surname>
<given-names>P</given-names>
</name>
<name><surname>Hu</surname>
<given-names>G</given-names>
</name>
<name><surname>Ouyang</surname>
<given-names>R</given-names>
</name>
<name><surname>Gao</surname>
<given-names>F</given-names>
</name>
<etal></etal>
</person-group>
<year>1999</year>
<article-title>Effect of bagging on fruit coloration of litchi (<italic>litchi chinensis</italic>
Sonn. cv. Feizixiao).</article-title>
<source>J South China Agricultural University</source>
<volume>20</volume>
<fpage>65</fpage>
<lpage>69</lpage>
</element-citation>
</ref>
<ref id="pone.0019455-Wang1"><label>18</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Wang</surname>
<given-names>H</given-names>
</name>
<name><surname>Huang</surname>
<given-names>H</given-names>
</name>
<name><surname>Huang</surname>
<given-names>X</given-names>
</name>
</person-group>
<year>2007</year>
<article-title>Differential effects of abscisic acid and ethylene on the fruit maturation of <italic>Litchi chinensis</italic>
Sonn.</article-title>
<source>Plant Growth Regul</source>
<volume>52</volume>
<fpage>189</fpage>
<lpage>198</lpage>
</element-citation>
</ref>
<ref id="pone.0019455-Underhill1"><label>19</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Underhill</surname>
<given-names>S</given-names>
</name>
<name><surname>Critchley</surname>
<given-names>C</given-names>
</name>
</person-group>
<year>1994</year>
<article-title>Anthocyanin decolorisation and its role in lychee pericap browning.</article-title>
<source>Aust J Experi Agric</source>
<volume>34</volume>
<fpage>115</fpage>
<lpage>122</lpage>
</element-citation>
</ref>
<ref id="pone.0019455-Gonalves1"><label>20</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Gonçalves</surname>
<given-names>B</given-names>
</name>
<name><surname>Silva</surname>
<given-names>AP</given-names>
</name>
<name><surname>Moutinho-Pereira</surname>
<given-names>J</given-names>
</name>
<name><surname>Bacelar</surname>
<given-names>E</given-names>
</name>
<name><surname>Rosa</surname>
<given-names>E</given-names>
</name>
<etal></etal>
</person-group>
<year>2007</year>
<article-title>Effect of ripeness and postharvest storage on the evolution of colour and anthocyanins in cherries (<italic>Prunus avium</italic>
L.).</article-title>
<source>Food Chem,</source>
<volume>103</volume>
<fpage>976</fpage>
<lpage>984</lpage>
</element-citation>
</ref>
<ref id="pone.0019455-Kim1"><label>21</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Kim</surname>
<given-names>SH</given-names>
</name>
<name><surname>Lee</surname>
<given-names>JR</given-names>
</name>
<name><surname>Hong</surname>
<given-names>ST</given-names>
</name>
<name><surname>Yoo</surname>
<given-names>YK</given-names>
</name>
<name><surname>An</surname>
<given-names>G</given-names>
</name>
<etal></etal>
</person-group>
<year>2003</year>
<article-title>Molecular cloning and analysis of anthocyanin biosynthesis genes preferentially expressed in apple skin.</article-title>
<source>Plant Sci</source>
<volume>165</volume>
<fpage>403</fpage>
<lpage>413</lpage>
</element-citation>
</ref>
<ref id="pone.0019455-Takos2"><label>22</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Takos</surname>
<given-names>AM</given-names>
</name>
<name><surname>Robinson</surname>
<given-names>SP</given-names>
</name>
<name><surname>Walker</surname>
<given-names>AR</given-names>
</name>
</person-group>
<year>2006</year>
<article-title>Transcriptional regulation of the flavonoid pathway in the skin of dark-grown ‘Cripps’ Red’ apples in response to sunlight.</article-title>
<source>J Hortic Sci Biotech,</source>
<volume>81</volume>
<fpage>735</fpage>
<lpage>744</lpage>
</element-citation>
</ref>
<ref id="pone.0019455-Feng1"><label>23</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Feng</surname>
<given-names>SQ</given-names>
</name>
<name><surname>Wang</surname>
<given-names>YL</given-names>
</name>
<name><surname>Yang</surname>
<given-names>S</given-names>
</name>
<name><surname>Xu</surname>
<given-names>YT</given-names>
</name>
<name><surname>Chen</surname>
<given-names>XS</given-names>
</name>
</person-group>
<year>2010</year>
<article-title>Anthocyanin biosynthesis in pears is regulated by a R2R3-MyB transcription factor PyMYB10.</article-title>
<source>Planta,</source>
<volume>232</volume>
<fpage>245</fpage>
<lpage>255</lpage>
<pub-id pub-id-type="pmid">20422209</pub-id>
</element-citation>
</ref>
<ref id="pone.0019455-Jia1"><label>24</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Jia</surname>
<given-names>HJ</given-names>
</name>
<name><surname>Araki</surname>
<given-names>A</given-names>
</name>
<name><surname>Okamoto</surname>
<given-names>G</given-names>
</name>
</person-group>
<year>2005</year>
<article-title>Influence of fruit bagging on aroma volatiles and skin coloration of ‘Hakuho’ peach (<italic>Prunus persica</italic>
Batsch).</article-title>
<source>Post Harvest Biol Technol</source>
<volume>35</volume>
<fpage>61</fpage>
<lpage>68</lpage>
</element-citation>
</ref>
<ref id="pone.0019455-Lister1"><label>25</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Lister</surname>
<given-names>CE</given-names>
</name>
<name><surname>Lancaster</surname>
<given-names>JE</given-names>
</name>
<name><surname>Walker</surname>
<given-names>JRL</given-names>
</name>
</person-group>
<year>1996</year>
<article-title>Developmental changes in enzymes of flavonoid biosynthesis in the skins of red and green apple cultivars.</article-title>
<source>J Sci Food Agric</source>
<volume>71</volume>
<fpage>313</fpage>
<lpage>320</lpage>
</element-citation>
</ref>
<ref id="pone.0019455-Ju1"><label>26</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Ju</surname>
<given-names>Z</given-names>
</name>
<name><surname>Liu</surname>
<given-names>C</given-names>
</name>
<name><surname>Yuan</surname>
<given-names>Y</given-names>
</name>
</person-group>
<year>1995</year>
<article-title>Acitivties of chalcone synthase and UDPGal: flavonoid-3-o-glycosyltransferase in relation to anthocyanin synthesis in apple.</article-title>
<source>Sci Hortic</source>
<volume>63</volume>
<fpage>175</fpage>
<lpage>185</lpage>
</element-citation>
</ref>
<ref id="pone.0019455-Ju2"><label>27</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Ju</surname>
<given-names>Z</given-names>
</name>
<name><surname>Yuan</surname>
<given-names>Y</given-names>
</name>
<name><surname>Liu</surname>
<given-names>C</given-names>
</name>
<name><surname>Wang</surname>
<given-names>Y</given-names>
</name>
<name><surname>Tian</surname>
<given-names>X</given-names>
</name>
</person-group>
<year>1997</year>
<article-title>Dihydroflavonol reductase activity and anthocyanin accumulation in ‘Delicious’, ‘Golden Delicious’ and ‘Indo’ apples.</article-title>
<source>Sci Hortic</source>
<volume>70</volume>
<fpage>31</fpage>
<lpage>43</lpage>
</element-citation>
</ref>
<ref id="pone.0019455-Wang2"><label>28</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Wang</surname>
<given-names>H</given-names>
</name>
<name><surname>Huang</surname>
<given-names>X</given-names>
</name>
<name><surname>Hu</surname>
<given-names>G</given-names>
</name>
<name><surname>Huang</surname>
<given-names>H</given-names>
</name>
</person-group>
<year>2004</year>
<article-title>Studies on the relationship between anthocyanin biosynthesis and related enzymes in litchi pericarp.</article-title>
<source>Sci Agric Sinica</source>
<volume>37</volume>
<fpage>2028</fpage>
<lpage>2032</lpage>
</element-citation>
</ref>
<ref id="pone.0019455-Koyama1"><label>29</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Koyama</surname>
<given-names>K</given-names>
</name>
<name><surname>Sadamatsu</surname>
<given-names>K</given-names>
</name>
<name><surname>Goto-Yamamoto</surname>
<given-names>N</given-names>
</name>
</person-group>
<year>2010</year>
<article-title>Abscisic acid stimulated ripening and gene expression in berry skins of the Cabernet Sauvignon grape.</article-title>
<source>Funct Integr Genomic</source>
<volume>10</volume>
<fpage>367</fpage>
<lpage>381</lpage>
</element-citation>
</ref>
<ref id="pone.0019455-McGuire1"><label>30</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>McGuire</surname>
<given-names>RG</given-names>
</name>
</person-group>
<year>1992</year>
<article-title>Reporting of objective colour measurements.</article-title>
<source>HortSci</source>
<volume>27</volume>
<fpage>1254</fpage>
<lpage>1255</lpage>
</element-citation>
</ref>
<ref id="pone.0019455-Voss1"><label>31</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Voss</surname>
<given-names>DH</given-names>
</name>
</person-group>
<year>1992</year>
<article-title>Relating colorimeter measurement of plant colour to the Royal Horticultural society colour chart.</article-title>
<source>HortSci</source>
<volume>27</volume>
<fpage>1256</fpage>
<lpage>1260</lpage>
</element-citation>
</ref>
<ref id="pone.0019455-Fuleki1"><label>32</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Fuleki</surname>
<given-names>T</given-names>
</name>
<name><surname>Francis</surname>
<given-names>FJ</given-names>
</name>
</person-group>
<year>1968</year>
<article-title>Quantitative methods for anthocyanins. 2. Determination of total anthocyanin and degradation index for cranberry juice.</article-title>
<source>J Food Sci</source>
<volume>33</volume>
<fpage>78</fpage>
<lpage>83</lpage>
</element-citation>
</ref>
<ref id="pone.0019455-Arnon1"><label>33</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Arnon</surname>
<given-names>DI</given-names>
</name>
</person-group>
<year>1949</year>
<article-title>Copper enzymes in isolated chlroplasts. Polyphenoxidase in <italic>Beta vulgaris</italic>
.</article-title>
<source>Plant Physiol</source>
<volume>24</volume>
<fpage>1</fpage>
<lpage>5</lpage>
<pub-id pub-id-type="pmid">16654194</pub-id>
</element-citation>
</ref>
<ref id="pone.0019455-Wu1"><label>34</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Wu</surname>
<given-names>X</given-names>
</name>
<name><surname>Prior</surname>
<given-names>RL</given-names>
</name>
</person-group>
<year>2005</year>
<article-title>Identification and characterization of anthocyanins by high-performance liquid chromatography-electrospray ionization-tandem mass spectrometry in common foods in the United States: Vegetables, nuts, and grains.</article-title>
<source>J Agric Food Chem</source>
<volume>53</volume>
<fpage>3101</fpage>
<lpage>3113</lpage>
<pub-id pub-id-type="pmid">15826066</pub-id>
</element-citation>
</ref>
<ref id="pone.0019455-Huang1"><label>35</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Huang</surname>
<given-names>Z</given-names>
</name>
<name><surname>Fasco</surname>
<given-names>MJ</given-names>
</name>
<name><surname>Kaminsky</surname>
<given-names>LS</given-names>
</name>
</person-group>
<year>1996</year>
<article-title>Optimization of Dnase I removal of contaminating DNA from RNA for use in quantitative RNA-PCR.</article-title>
<source>Biotechniques</source>
<volume>20</volume>
<fpage>1012</fpage>
<lpage>1020</lpage>
<pub-id pub-id-type="pmid">8780872</pub-id>
</element-citation>
</ref>
<ref id="pone.0019455-Altschul1"><label>36</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Altschul</surname>
<given-names>SF</given-names>
</name>
<name><surname>Madden</surname>
<given-names>TL</given-names>
</name>
<name><surname>Schäffer</surname>
<given-names>AA</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>J</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>Z</given-names>
</name>
<etal></etal>
</person-group>
<year>1997</year>
<article-title>Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.</article-title>
<source>Nucleic Acids Res</source>
<volume>25</volume>
<fpage>3389</fpage>
<lpage>3402</lpage>
<pub-id pub-id-type="pmid">9254694</pub-id>
</element-citation>
</ref>
<ref id="pone.0019455-Thompson1"><label>37</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Thompson</surname>
<given-names>JD</given-names>
</name>
<name><surname>Gibson</surname>
<given-names>TJ</given-names>
</name>
<name><surname>Plewniak</surname>
<given-names>F</given-names>
</name>
<name><surname>Jeanmougin</surname>
<given-names>F</given-names>
</name>
<name><surname>Higgins</surname>
<given-names>DG</given-names>
</name>
</person-group>
<year>1997</year>
<article-title>The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.</article-title>
<source>Nucleic Acids Res</source>
<volume>25</volume>
<fpage>4876</fpage>
<lpage>4882</lpage>
<pub-id pub-id-type="pmid">9396791</pub-id>
</element-citation>
</ref>
<ref id="pone.0019455-Lefever1"><label>38</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Lefever</surname>
<given-names>S</given-names>
</name>
<name><surname>Hellemans</surname>
<given-names>J</given-names>
</name>
<name><surname>Pattyn</surname>
<given-names>F</given-names>
</name>
<name><surname>Przybylski</surname>
<given-names>DR</given-names>
</name>
<name><surname>Tayor</surname>
<given-names>C</given-names>
</name>
<etal></etal>
</person-group>
<year>2009</year>
<article-title>RDML: Structured language and reporting guidelines for real-time quantitative PCR data.</article-title>
<source>Nucleic Acids Res</source>
<volume>37</volume>
<fpage>2065</fpage>
<lpage>2069</lpage>
<pub-id pub-id-type="pmid">19223324</pub-id>
</element-citation>
</ref>
<ref id="pone.0019455-Zhong1"><label>39</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Zhong</surname>
<given-names>HY</given-names>
</name>
<name><surname>Chen</surname>
<given-names>JW</given-names>
</name>
<name><surname>Li</surname>
<given-names>CQ</given-names>
</name>
<name><surname>Chen</surname>
<given-names>L</given-names>
</name>
<name><surname>Wu</surname>
<given-names>JY</given-names>
</name>
<etal></etal>
</person-group>
<year>2010</year>
<article-title>Selection of reliable reference genes for expression studies by reverse transcription quantitative real-time PCR in litchi under different experimental conditions.</article-title>
<source>Plant Cell report</source>
<comment>DOI 10.1007/s00299-010-0992-8</comment>
</element-citation>
</ref>
<ref id="pone.0019455-Livak1"><label>40</label>
<element-citation publication-type="journal"> <person-group person-group-type="author"><name><surname>Livak</surname>
<given-names>KJ</given-names>
</name>
<name><surname>Schmittgen</surname>
<given-names>TD</given-names>
</name>
</person-group>
<year>2001</year>
<article-title>Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method.</article-title>
<source>Methods 25,</source>
<volume>402-408</volume>
</element-citation>
</ref>
</ref-list>
</back>
</pmc>
</record>
Pour manipuler ce document sous Unix (Dilib)
EXPLOR_STEP=$WICRI_ROOT/Wicri/Bois/explor/OrangerV1/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 001218 | SxmlIndent | more
Ou
HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 001218 | SxmlIndent | more
Pour mettre un lien sur cette page dans le réseau Wicri
{{Explor lien |wiki= Wicri/Bois |area= OrangerV1 |flux= Pmc |étape= Corpus |type= RBID |clé= PMC:3084873 |texte= Differential Expression of Anthocyanin Biosynthetic Genes in Relation to Anthocyanin Accumulation in the Pericarp of Litchi Chinensis Sonn }}
Pour générer des pages wiki
HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/RBID.i -Sk "pubmed:21559331" \ | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd \ | NlmPubMed2Wicri -a OrangerV1
This area was generated with Dilib version V0.6.25. |