Serveur d'exploration sur l'oranger

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.
***** Acces problem to record *****\

Identifieur interne : 000F841 ( Pmc/Corpus ); précédent : 000F840; suivant : 000F842 ***** probable Xml problem with record *****

Links to Exploration step


Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Development of Microsatellite Markers in
<italic>Pungtungia herzi</italic>
Using Next-Generation Sequencing and Cross-Species Amplification in the Genus
<italic>Pseudopungtungia</italic>
</title>
<author>
<name sortKey="Yun, Young Eun" sort="Yun, Young Eun" uniqKey="Yun Y" first="Young-Eun" last="Yun">Young-Eun Yun</name>
<affiliation>
<nlm:aff id="af1-ijms-14-19923">National Institute of Biological Resources, Incheon 404-708, Korea; E-Mails:
<email>woo0711@korea.kr</email>
(Y.-E.Y.);
<email>susia000@korea.kr</email>
(J.-N.Y.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Yu, Jeong Nam" sort="Yu, Jeong Nam" uniqKey="Yu J" first="Jeong-Nam" last="Yu">Jeong-Nam Yu</name>
<affiliation>
<nlm:aff id="af1-ijms-14-19923">National Institute of Biological Resources, Incheon 404-708, Korea; E-Mails:
<email>woo0711@korea.kr</email>
(Y.-E.Y.);
<email>susia000@korea.kr</email>
(J.-N.Y.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Kim, Sang Ki" sort="Kim, Sang Ki" uniqKey="Kim S" first="Sang Ki" last="Kim">Sang Ki Kim</name>
<affiliation>
<nlm:aff id="af2-ijms-14-19923">School of Life Science, Kyungpook National University, Daegu 702-701, Korea; E-Mails:
<email>ivoice@hanmail.net</email>
(S.K.K.);
<email>uwhwang@knu.ac.kr</email>
(U.W.H.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Hwang, Ui Wook" sort="Hwang, Ui Wook" uniqKey="Hwang U" first="Ui Wook" last="Hwang">Ui Wook Hwang</name>
<affiliation>
<nlm:aff id="af2-ijms-14-19923">School of Life Science, Kyungpook National University, Daegu 702-701, Korea; E-Mails:
<email>ivoice@hanmail.net</email>
(S.K.K.);
<email>uwhwang@knu.ac.kr</email>
(U.W.H.)</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af3-ijms-14-19923">Department of Biology, Teachers College & Institute for Phylogenomics and Evolution, Kyungpook National University, Daegu 702-701, Korea</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Kwak, Myounghai" sort="Kwak, Myounghai" uniqKey="Kwak M" first="Myounghai" last="Kwak">Myounghai Kwak</name>
<affiliation>
<nlm:aff id="af1-ijms-14-19923">National Institute of Biological Resources, Incheon 404-708, Korea; E-Mails:
<email>woo0711@korea.kr</email>
(Y.-E.Y.);
<email>susia000@korea.kr</email>
(J.-N.Y.)</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">24084733</idno>
<idno type="pmc">3821594</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3821594</idno>
<idno type="RBID">PMC:3821594</idno>
<idno type="doi">10.3390/ijms141019923</idno>
<date when="2013">2013</date>
<idno type="wicri:Area/Pmc/Corpus">000F84</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Development of Microsatellite Markers in
<italic>Pungtungia herzi</italic>
Using Next-Generation Sequencing and Cross-Species Amplification in the Genus
<italic>Pseudopungtungia</italic>
</title>
<author>
<name sortKey="Yun, Young Eun" sort="Yun, Young Eun" uniqKey="Yun Y" first="Young-Eun" last="Yun">Young-Eun Yun</name>
<affiliation>
<nlm:aff id="af1-ijms-14-19923">National Institute of Biological Resources, Incheon 404-708, Korea; E-Mails:
<email>woo0711@korea.kr</email>
(Y.-E.Y.);
<email>susia000@korea.kr</email>
(J.-N.Y.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Yu, Jeong Nam" sort="Yu, Jeong Nam" uniqKey="Yu J" first="Jeong-Nam" last="Yu">Jeong-Nam Yu</name>
<affiliation>
<nlm:aff id="af1-ijms-14-19923">National Institute of Biological Resources, Incheon 404-708, Korea; E-Mails:
<email>woo0711@korea.kr</email>
(Y.-E.Y.);
<email>susia000@korea.kr</email>
(J.-N.Y.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Kim, Sang Ki" sort="Kim, Sang Ki" uniqKey="Kim S" first="Sang Ki" last="Kim">Sang Ki Kim</name>
<affiliation>
<nlm:aff id="af2-ijms-14-19923">School of Life Science, Kyungpook National University, Daegu 702-701, Korea; E-Mails:
<email>ivoice@hanmail.net</email>
(S.K.K.);
<email>uwhwang@knu.ac.kr</email>
(U.W.H.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Hwang, Ui Wook" sort="Hwang, Ui Wook" uniqKey="Hwang U" first="Ui Wook" last="Hwang">Ui Wook Hwang</name>
<affiliation>
<nlm:aff id="af2-ijms-14-19923">School of Life Science, Kyungpook National University, Daegu 702-701, Korea; E-Mails:
<email>ivoice@hanmail.net</email>
(S.K.K.);
<email>uwhwang@knu.ac.kr</email>
(U.W.H.)</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af3-ijms-14-19923">Department of Biology, Teachers College & Institute for Phylogenomics and Evolution, Kyungpook National University, Daegu 702-701, Korea</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Kwak, Myounghai" sort="Kwak, Myounghai" uniqKey="Kwak M" first="Myounghai" last="Kwak">Myounghai Kwak</name>
<affiliation>
<nlm:aff id="af1-ijms-14-19923">National Institute of Biological Resources, Incheon 404-708, Korea; E-Mails:
<email>woo0711@korea.kr</email>
(Y.-E.Y.);
<email>susia000@korea.kr</email>
(J.-N.Y.)</nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">International Journal of Molecular Sciences</title>
<idno type="eISSN">1422-0067</idno>
<imprint>
<date when="2013">2013</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<p>Nuclear microsatellite markers for
<italic>Pungtungia herzi</italic>
were developed using a combination of next-generation sequencing and Sanger sequencing. One hundred primer sets in the flanking region of dinucleotide and trinucleotide repeat motifs were designed and tested for efficiency in polymerase chain reaction amplification. Of these primer sets, 16 new markers (16%) were successfully amplified with unambiguous polymorphic alleles in 16 individuals of
<italic>Pungtungia herzi</italic>
. Cross-species amplification with these markers was then examined in two related species,
<italic>Pseudopungtungia nigra</italic>
and
<italic>Pseudopungtungia tenuicorpa</italic>
. Fifteen and 11 primer pairs resulted in successful amplification in
<italic>Pseudopungtungia nigra</italic>
and
<italic>Pseudopungtungia tenuicorpa</italic>
, respectively, with various polymorphisms, ranging from one allele (monomorphic) to 11 alleles per marker. These results indicated that developing microsatellite markers for cross-amplification from a species that is abundant and phylogenetically close to the species of interest is a good alternative when tissue samples of an endangered species are insufficient to develop microsatellites.</p>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Kim, I S" uniqKey="Kim I">I.-S. Kim</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lim, M S" uniqKey="Lim M">M.S. Lim</name>
</author>
<author>
<name sortKey="Lee, B H" uniqKey="Lee B">B.H. Lee</name>
</author>
<author>
<name sortKey="Lee, S J" uniqKey="Lee S">S.J. Lee</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kim, I S" uniqKey="Kim I">I.-S. Kim</name>
</author>
<author>
<name sortKey="Choi, S H" uniqKey="Choi S">S.-H. Choi</name>
</author>
<author>
<name sortKey="Lee, H H" uniqKey="Lee H">H.-H. Lee</name>
</author>
<author>
<name sortKey="Han, K H" uniqKey="Han K">K.-H. Han</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kim, K S" uniqKey="Kim K">K.-S. Kim</name>
</author>
<author>
<name sortKey="Yun, Y E" uniqKey="Yun Y">Y.-E. Yun</name>
</author>
<author>
<name sortKey="Kang, E J" uniqKey="Kang E">E.-J. Kang</name>
</author>
<author>
<name sortKey="Yang, S G" uniqKey="Yang S">S.-G. Yang</name>
</author>
<author>
<name sortKey="Bang, I C" uniqKey="Bang I">I.-C. Bang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ko, M H" uniqKey="Ko M">M.-H. Ko</name>
</author>
<author>
<name sortKey="Park, S Y" uniqKey="Park S">S.-Y. Park</name>
</author>
<author>
<name sortKey="Bang, I C" uniqKey="Bang I">I.-C. Bang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mills, L S" uniqKey="Mills L">L.S. Mills</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kim, S G" uniqKey="Kim S">S.G. Kim</name>
</author>
<author>
<name sortKey="Morishima, K" uniqKey="Morishima K">K. Morishima</name>
</author>
<author>
<name sortKey="Arai, K" uniqKey="Arai K">K Arai</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shikano, T" uniqKey="Shikano T">T. Shikano</name>
</author>
<author>
<name sortKey="Ramadevi, J" uniqKey="Ramadevi J">J. Ramadevi</name>
</author>
<author>
<name sortKey="Shimada, Y" uniqKey="Shimada Y">Y. Shimada</name>
</author>
<author>
<name sortKey="Meril, J" uniqKey="Meril J">J Merilä</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Morin, P A" uniqKey="Morin P">P.A. Morin</name>
</author>
<author>
<name sortKey="Mahboubi, P" uniqKey="Mahboubi P">P. Mahboubi</name>
</author>
<author>
<name sortKey="Wedel, S" uniqKey="Wedel S">S. Wedel</name>
</author>
<author>
<name sortKey="Rogers, J" uniqKey="Rogers J">J Rogers</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jarne, P" uniqKey="Jarne P">P. Jarne</name>
</author>
<author>
<name sortKey="Lagoda, P J L" uniqKey="Lagoda P">P.J.L. Lagoda</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kim, K S" uniqKey="Kim K">K.-S. Kim</name>
</author>
<author>
<name sortKey="Min, M S" uniqKey="Min M">M.-S. Min</name>
</author>
<author>
<name sortKey="An, J H" uniqKey="An J">J.-H. An</name>
</author>
<author>
<name sortKey="Lee, H" uniqKey="Lee H">H Lee</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bezault, E" uniqKey="Bezault E">E. Bezault</name>
</author>
<author>
<name sortKey="Rognon, X" uniqKey="Rognon X">X. Rognon</name>
</author>
<author>
<name sortKey="Gharbi, K" uniqKey="Gharbi K">K. Gharbi</name>
</author>
<author>
<name sortKey="Baroiller, J" uniqKey="Baroiller J">J. Baroiller</name>
</author>
<author>
<name sortKey="Chevassus, B" uniqKey="Chevassus B">B Chevassus</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pimmer, C R" uniqKey="Pimmer C">C.R. Pimmer</name>
</author>
<author>
<name sortKey="Moller, A P" uniqKey="Moller A">A.P. Moller</name>
</author>
<author>
<name sortKey="Ellegren, H" uniqKey="Ellegren H">H Ellegren</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Scribner, K T" uniqKey="Scribner K">K.T. Scribner</name>
</author>
<author>
<name sortKey="Pearce, J M" uniqKey="Pearce J">J.M. Pearce</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kim, I S" uniqKey="Kim I">I.-S. Kim</name>
</author>
<author>
<name sortKey="Choi, Y" uniqKey="Choi Y">Y. Choi</name>
</author>
<author>
<name sortKey="Shim, J H" uniqKey="Shim J">J.-H. Shim</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Baba, R" uniqKey="Baba R">R. Baba</name>
</author>
<author>
<name sortKey="Karino, K" uniqKey="Karino K">K Karino</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Nagata, Y" uniqKey="Nagata Y">Y. Nagata</name>
</author>
<author>
<name sortKey="Maehata, M" uniqKey="Maehata M">M Maehata</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yamane, H" uniqKey="Yamane H">H. Yamane</name>
</author>
<author>
<name sortKey="Yokoyama, T" uniqKey="Yokoyama T">T. Yokoyama</name>
</author>
<author>
<name sortKey="Nagata, Y" uniqKey="Nagata Y">Y. Nagata</name>
</author>
<author>
<name sortKey="Yamada, T" uniqKey="Yamada T">T Yamada</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yamane, H" uniqKey="Yamane H">H. Yamane</name>
</author>
<author>
<name sortKey="Watanabe, K" uniqKey="Watanabe K">K. Watanabe</name>
</author>
<author>
<name sortKey="Nagata, Y" uniqKey="Nagata Y">Y Nagata</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tang, K L" uniqKey="Tang K">K.L. Tang</name>
</author>
<author>
<name sortKey="Agnew, M K" uniqKey="Agnew M">M.K. Agnew</name>
</author>
<author>
<name sortKey="Chen, W J" uniqKey="Chen W">W.-J. Chen</name>
</author>
<author>
<name sortKey="Hirt, M V" uniqKey="Hirt M">M.V. Hirt</name>
</author>
<author>
<name sortKey="Raley, M E" uniqKey="Raley M">M.E. Raley</name>
</author>
<author>
<name sortKey="Sado, T" uniqKey="Sado T">T. Sado</name>
</author>
<author>
<name sortKey="Schneider, L M" uniqKey="Schneider L">L.M. Schneider</name>
</author>
<author>
<name sortKey="Yang, L" uniqKey="Yang L">L. Yang</name>
</author>
<author>
<name sortKey="Bart, H L" uniqKey="Bart H">H.L. Bart</name>
</author>
<author>
<name sortKey="He, S P" uniqKey="He S">S.P. He</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gardner, M G" uniqKey="Gardner M">M.G. Gardner</name>
</author>
<author>
<name sortKey="Fitch, A J" uniqKey="Fitch A">A.J. Fitch</name>
</author>
<author>
<name sortKey="Bertozzi, T" uniqKey="Bertozzi T">T. Bertozzi</name>
</author>
<author>
<name sortKey="Lowe, A J" uniqKey="Lowe A">A.J. Lowe</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yu, J N" uniqKey="Yu J">J.-N. Yu</name>
</author>
<author>
<name sortKey="Won, C" uniqKey="Won C">C. Won</name>
</author>
<author>
<name sortKey="Jun, J" uniqKey="Jun J">J. Jun</name>
</author>
<author>
<name sortKey="Lim, Y W" uniqKey="Lim Y">Y.W. Lim</name>
</author>
<author>
<name sortKey="Kwak, M" uniqKey="Kwak M">M Kwak</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="T Th, G" uniqKey="T Th G">G. Tóth</name>
</author>
<author>
<name sortKey="Gaspari, Z" uniqKey="Gaspari Z">Z. Gáspári</name>
</author>
<author>
<name sortKey="Jurka, J" uniqKey="Jurka J">J Jurka</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shanker, A" uniqKey="Shanker A">A. Shanker</name>
</author>
<author>
<name sortKey="Bhargava, A" uniqKey="Bhargava A">A. Bhargava</name>
</author>
<author>
<name sortKey="Bajpai, R" uniqKey="Bajpai R">R. Bajpai</name>
</author>
<author>
<name sortKey="Singh, S" uniqKey="Singh S">S. Singh</name>
</author>
<author>
<name sortKey="Srivastava, S" uniqKey="Srivastava S">S. Srivastava</name>
</author>
<author>
<name sortKey="Sharma, V" uniqKey="Sharma V">V. Sharma</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rozen, S" uniqKey="Rozen S">S. Rozen</name>
</author>
<author>
<name sortKey="Skaletsky, H J" uniqKey="Skaletsky H">H.J. Skaletsky</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Schuelke, M" uniqKey="Schuelke M">M Schuelke</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Excoffier, L" uniqKey="Excoffier L">L. Excoffier</name>
</author>
<author>
<name sortKey="Laval, G" uniqKey="Laval G">G. Laval</name>
</author>
<author>
<name sortKey="Schneider, S" uniqKey="Schneider S">S Schneider</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Van Oosterhout, C" uniqKey="Van Oosterhout C">C. Van Oosterhout</name>
</author>
<author>
<name sortKey="Hutchinson, W F" uniqKey="Hutchinson W">W.F. Hutchinson</name>
</author>
<author>
<name sortKey="Wills, D P M" uniqKey="Wills D">D.P.M. Wills</name>
</author>
<author>
<name sortKey="Shipley, P" uniqKey="Shipley P">P Shipley</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Int J Mol Sci</journal-id>
<journal-id journal-id-type="iso-abbrev">Int J Mol Sci</journal-id>
<journal-id journal-id-type="publisher-id">ijms</journal-id>
<journal-title-group>
<journal-title>International Journal of Molecular Sciences</journal-title>
</journal-title-group>
<issn pub-type="epub">1422-0067</issn>
<publisher>
<publisher-name>Molecular Diversity Preservation International (MDPI)</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">24084733</article-id>
<article-id pub-id-type="pmc">3821594</article-id>
<article-id pub-id-type="doi">10.3390/ijms141019923</article-id>
<article-id pub-id-type="publisher-id">ijms-14-19923</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Article</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Development of Microsatellite Markers in
<italic>Pungtungia herzi</italic>
Using Next-Generation Sequencing and Cross-Species Amplification in the Genus
<italic>Pseudopungtungia</italic>
</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Yun</surname>
<given-names>Young-Eun</given-names>
</name>
<xref ref-type="aff" rid="af1-ijms-14-19923">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Yu</surname>
<given-names>Jeong-Nam</given-names>
</name>
<xref ref-type="aff" rid="af1-ijms-14-19923">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Kim</surname>
<given-names>Sang Ki</given-names>
</name>
<xref ref-type="aff" rid="af2-ijms-14-19923">2</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Hwang</surname>
<given-names>Ui Wook</given-names>
</name>
<xref ref-type="aff" rid="af2-ijms-14-19923">2</xref>
<xref ref-type="aff" rid="af3-ijms-14-19923">3</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Kwak</surname>
<given-names>Myounghai</given-names>
</name>
<xref ref-type="aff" rid="af1-ijms-14-19923">1</xref>
<xref rid="c1-ijms-14-19923" ref-type="corresp">*</xref>
</contrib>
</contrib-group>
<aff id="af1-ijms-14-19923">
<label>1</label>
National Institute of Biological Resources, Incheon 404-708, Korea; E-Mails:
<email>woo0711@korea.kr</email>
(Y.-E.Y.);
<email>susia000@korea.kr</email>
(J.-N.Y.)</aff>
<aff id="af2-ijms-14-19923">
<label>2</label>
School of Life Science, Kyungpook National University, Daegu 702-701, Korea; E-Mails:
<email>ivoice@hanmail.net</email>
(S.K.K.);
<email>uwhwang@knu.ac.kr</email>
(U.W.H.)</aff>
<aff id="af3-ijms-14-19923">
<label>3</label>
Department of Biology, Teachers College & Institute for Phylogenomics and Evolution, Kyungpook National University, Daegu 702-701, Korea</aff>
<author-notes>
<corresp id="c1-ijms-14-19923">
<label>*</label>
Author to whom correspondence should be addressed; E-Mail:
<email>mhkwak1@korea.kr</email>
; Tel.: +82-32-590-7186; Fax: +82-32-590-7230.</corresp>
</author-notes>
<pub-date pub-type="collection">
<month>10</month>
<year>2013</year>
</pub-date>
<pub-date pub-type="epub">
<day>01</day>
<month>10</month>
<year>2013</year>
</pub-date>
<volume>14</volume>
<issue>10</issue>
<fpage>19923</fpage>
<lpage>19931</lpage>
<history>
<date date-type="received">
<day>01</day>
<month>6</month>
<year>2013</year>
</date>
<date date-type="rev-recd">
<day>10</day>
<month>7</month>
<year>2013</year>
</date>
<date date-type="accepted">
<day>18</day>
<month>9</month>
<year>2013</year>
</date>
</history>
<permissions>
<copyright-statement>© 2013 by the authors; licensee MDPI, Basel, Switzerland</copyright-statement>
<copyright-year>2013</copyright-year>
<license license-type="open-access" xlink:href="http://creativecommons.org/licenses/by/3.0/">
<license-p>
<pmc-comment>CREATIVE COMMONS</pmc-comment>
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/3.0/">http://creativecommons.org/licenses/by/3.0/</ext-link>
).</license-p>
</license>
</permissions>
<abstract>
<p>Nuclear microsatellite markers for
<italic>Pungtungia herzi</italic>
were developed using a combination of next-generation sequencing and Sanger sequencing. One hundred primer sets in the flanking region of dinucleotide and trinucleotide repeat motifs were designed and tested for efficiency in polymerase chain reaction amplification. Of these primer sets, 16 new markers (16%) were successfully amplified with unambiguous polymorphic alleles in 16 individuals of
<italic>Pungtungia herzi</italic>
. Cross-species amplification with these markers was then examined in two related species,
<italic>Pseudopungtungia nigra</italic>
and
<italic>Pseudopungtungia tenuicorpa</italic>
. Fifteen and 11 primer pairs resulted in successful amplification in
<italic>Pseudopungtungia nigra</italic>
and
<italic>Pseudopungtungia tenuicorpa</italic>
, respectively, with various polymorphisms, ranging from one allele (monomorphic) to 11 alleles per marker. These results indicated that developing microsatellite markers for cross-amplification from a species that is abundant and phylogenetically close to the species of interest is a good alternative when tissue samples of an endangered species are insufficient to develop microsatellites.</p>
</abstract>
<kwd-group>
<kwd>microsatellite</kwd>
<kwd>
<italic>Pungtungia herzi</italic>
</kwd>
<kwd>
<italic>Pseudopungtungia</italic>
</kwd>
<kwd>cross-species amplification</kwd>
<kwd>next-generation sequencing</kwd>
</kwd-group>
</article-meta>
</front>
<body>
<sec>
<label>1.</label>
<title>Introduction</title>
<p>The Korean endemic genus
<italic>Pseudopungtungia</italic>
includes two endangered species, the black shinner (
<italic>Pseudopungtungia nigra</italic>
) and the slender shinner (
<italic>Pseudopungtungia tenuicorpa</italic>
), that have suffered drastic population decreases [
<xref rid="b1-ijms-14-19923" ref-type="bibr">1</xref>
,
<xref rid="b2-ijms-14-19923" ref-type="bibr">2</xref>
].
<italic>Pseudopungtungia</italic>
is restricted to the Geum, Mankyung, Ungcheon, and Han Rivers in South Korea [
<xref rid="b1-ijms-14-19923" ref-type="bibr">1</xref>
,
<xref rid="b2-ijms-14-19923" ref-type="bibr">2</xref>
]. The population declines are attributed to habitat destruction, including dam construction, and to a population decrease of the host species,
<italic>Coreoperca herzi</italic>
(Perciformes: Centropomidae) for brood parasites [
<xref rid="b3-ijms-14-19923" ref-type="bibr">3</xref>
<xref rid="b5-ijms-14-19923" ref-type="bibr">5</xref>
].</p>
<p>A good understanding of the genetics of endangered species can assist in developing strategies for their conservation [
<xref rid="b6-ijms-14-19923" ref-type="bibr">6</xref>
]; however, to date, no population genetic studies of these species have been performed and no high-resolution molecular markers have been developed for them. Insufficient genomic DNA and the lack of an appropriate number of individuals to screen polymorphic markers hinder further research progress. To overcome this difficulty, we used transferable microsatellite markers from a phylogenetically close species. Recent studies have demonstrated the value of the cross-species microsatellite amplification approach in population studies of species for which microsatellites have not yet been developed [
<xref rid="b7-ijms-14-19923" ref-type="bibr">7</xref>
,
<xref rid="b8-ijms-14-19923" ref-type="bibr">8</xref>
]. The limitations of cross-species microsatellite amplification are reduced levels of diversity in the target species [
<xref rid="b9-ijms-14-19923" ref-type="bibr">9</xref>
], increased frequency of null alleles and homoplasy [
<xref rid="b10-ijms-14-19923" ref-type="bibr">10</xref>
<xref rid="b12-ijms-14-19923" ref-type="bibr">12</xref>
], and limited applicability to very closely related species belonging to the same genus or to recently separated genera [
<xref rid="b13-ijms-14-19923" ref-type="bibr">13</xref>
,
<xref rid="b14-ijms-14-19923" ref-type="bibr">14</xref>
].</p>
<p>The striped shiner (
<italic>Pungtungia herzi</italic>
) is widely distributed in most rivers and lakes in South Korea, northern China, and southern Japan [
<xref rid="b1-ijms-14-19923" ref-type="bibr">1</xref>
,
<xref rid="b15-ijms-14-19923" ref-type="bibr">15</xref>
]. It reaches lengths of 10–15 cm and feeds on attached algae and aquatic insect larvae.
<italic>Pungtungia herzi</italic>
uses two reproductive strategies, nonparasitic crevice spawning and brood parasitism with multiple host species, including
<italic>Coreoperca herzi</italic>
,
<italic>C. kawamebari</italic>
,
<italic>Pseudobagrus nudicepts</italic>
, and
<italic>Odontobutis obscura</italic>
(Perciformes: Odontobutidae) [
<xref rid="b16-ijms-14-19923" ref-type="bibr">16</xref>
<xref rid="b19-ijms-14-19923" ref-type="bibr">19</xref>
].
<italic>Pungtungia herzi</italic>
and
<italic>Pseudopungtungia nigra</italic>
appear to be closely related phylogenetically, due to their morphological similarities and rather distinct zoogeographic distributions [
<xref rid="b20-ijms-14-19923" ref-type="bibr">20</xref>
]. In fact, a probable natural hybrid of
<italic>Pungtungia herzi</italic>
and
<italic>Pseudopungtungia nigra</italic>
was reported in the Ungcheon River [
<xref rid="b15-ijms-14-19923" ref-type="bibr">15</xref>
].</p>
<p>Next-generation sequencing (NGS) methods are revolutionizing molecular ecology by simplifying the development of molecular genetic markers, including microsatellites [
<xref rid="b21-ijms-14-19923" ref-type="bibr">21</xref>
]. In this study, we developed a set of microsatellite markers from
<italic>Pungtungia herzi</italic>
using a NGS protocol [
<xref rid="b22-ijms-14-19923" ref-type="bibr">22</xref>
]. We then examined the polymorphic markers from
<italic>Pungtungia herzi</italic>
in the two related endemic species,
<italic>Pseudopungtungia nigra</italic>
and
<italic>Pseudopungtungia tenuicorpa</italic>
.</p>
</sec>
<sec>
<label>2.</label>
<title>Results and Discussion</title>
<sec>
<label>2.1.</label>
<title>Results of DNA Sequencing with A Roche 454 GS-FLX Titanium Run</title>
<p>We obtained 243,749 total reads (91.87 Mb) for
<italic>Pungtungia herzi</italic>
. The total number of contigs was 9708 and the number of singletons was 146,093. A total of 1981 regions containing perfect dinucleotide/trinucleotide repeats were identified. The most frequent dinucleotide type in the
<italic>Pungtungia herzi</italic>
genome was CA repeats (51.66%), followed by AT (25.10%), CT (21.77%), and GC (1.47%). These results are consistent with previous findings that the CA repeat is the most frequent in 353 species of vertebrata genomes and is generally 2.3-fold more frequent than the second most common microsatellite, AT [
<xref rid="b23-ijms-14-19923" ref-type="bibr">23</xref>
]. Of the trinucleotide repeats, the AAT/ATA/TAA motif was the most frequent (59.87%), and the CGG/GCG/GGC repeat motif was the least common. Among the isolated dinucleotide microsatellites, the highest number of repeat-unit iterations was 27 (54 bp); among the trinucleotide microsatellites, the highest number of repeat-unit iterations was 19 (57 bp).</p>
</sec>
<sec>
<label>2.2.</label>
<title>Microsatellite Marker Development</title>
<p>We chose 100 microsatellites with the largest number of repeat motifs to test amplification efficiency and assess polymorphism. Of these, 16 new markers (16%) produced strongly amplified polymerase chain reaction (PCR) products in all specimens with unambiguous alleles in
<italic>Pungtungia herzi</italic>
. The nucleotide sequences of the 16 new microsatellite markers were deposited in the GenBank database under accession numbers JQ889798–JX915813 (
<xref rid="t1-ijms-14-19923" ref-type="table">Table 1</xref>
).</p>
<p>Among three populations of
<italic>Pungtungia herzi</italic>
, these 16 markers were polymorphic (
<xref rid="t2-ijms-14-19923" ref-type="table">Table 2</xref>
). The Gyeongho River population yielded 5–15 alleles, and the
<italic>H</italic>
<sub>O</sub>
and
<italic>H</italic>
<sub>E</sub>
ranged from 0.469 to 0.969 and from 0.580 to 0.913, respectively. The Imjin River population produced 3–15 alleles, and the Geum River population yielded 1–10 alleles.</p>
<p>Hardy–Weinberg equilibrium (HWE) was tested in the Gyeongho River population. In this population, PH_CA36, PH_CA38, PH_ATC01 (
<italic>p</italic>
< 0.01), and PH_CT03, PH_CA37, PH_ACT01 (
<italic>p</italic>
< 0.05) departed from HWE (
<xref rid="t2-ijms-14-19923" ref-type="table">Table 2</xref>
). Of the markers, PH_CA38 and PH_ATC01 departed significantly from HWE and showed homozygote excess by analysis with MICRO-CHECKER. In general, the presence of null alleles or large allele dropout can explain observed deviation from HWE [
<xref rid="b9-ijms-14-19923" ref-type="bibr">9</xref>
]. Finally, 10 new markers satisfied all the criteria (
<italic>i.e</italic>
., moderate to high polymorphism, no evidence of null alleles) and are recommended for use in future population genetics studies of
<italic>Pungtungia herzi</italic>
(
<xref rid="t3-ijms-14-19923" ref-type="table">Table 3</xref>
).</p>
</sec>
<sec>
<label>2.3.</label>
<title>Cross-Species Amplification</title>
<p>Cross-species amplification was further examined in
<italic>Pseudopungtungia nigra</italic>
and
<italic>Pseudopungtungia tenuicorpa</italic>
. Of the 16 new makers, the 10 markers that were strongly amplified in both
<italic>Pseudopungtungia nigra</italic>
and
<italic>Pseudopungtungia tenuicorpa</italic>
, 5 markers were amplified only in
<italic>Pseudopungtungia nigra</italic>
, while 1 marker (PH_ATC01) was amplified only in
<italic>Pseudopungtungia tenuicorpa</italic>
. The number of alleles for the 15 markers amplified in
<italic>Pseudopungtungia nigra</italic>
ranged from 1 to 11. The number of alleles on the 11 markers from
<italic>Pseudopungtungia tenuicorpa</italic>
ranged from 1 to 6 (
<xref rid="t3-ijms-14-19923" ref-type="table">Table 3</xref>
). PH_CA41 was monomorphic in
<italic>Pseudopungtungia nigra</italic>
, whereas PH_CA52 and PH_TCA01 were monomorphic in
<italic>Pseudopungtungia tenuicorpa</italic>
. Consequently, 14 markers for
<italic>Pseudopungtungia nigra</italic>
and 9 markers for
<italic>Pseudopungtungia tenuicorpa</italic>
were considered to be good choices for future research in this area.</p>
</sec>
</sec>
<sec>
<label>3.</label>
<title>Experimental Section</title>
<sec>
<label>3.1.</label>
<title>Roche 454 GS-FLX Titanium Sequencing</title>
<p>Genomic DNA was extracted from muscle tissue using a DNeasy Blood and Tissue kit (QIAGEN, Hilden, Germany) following the manufacturer’s protocol and stored at −20 °C. The quality of genomic DNA was checked on 1% agarose gels with a spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). The NGS libraries were generated with aliquots of approximately 10 μg of genomic DNA from a single
<italic>Pungtungia herzi</italic>
individual and then sequenced using a 1/4 plate on the Roche 454 GS-FLX titanium platform at the National Instrumentation Center for Environmental Management of Seoul National University.</p>
</sec>
<sec>
<label>3.2.</label>
<title>Microsatellite Marker Development</title>
<p>The sequence reads from the 454 GS-FLX were assembled using Newbler 2.6 (Roche Diagnostics, 454 Life Science, Mannheim, Germany) with a 96% minimum overlap identity. The dinucleotide and trinucleotide repeats of more than four iterations were searched using the perl program “ssr_finder.pl” [
<xref rid="b22-ijms-14-19923" ref-type="bibr">22</xref>
,
<xref rid="b24-ijms-14-19923" ref-type="bibr">24</xref>
]. These repeats were sorted and a pair of primers flanking each repeat was designed using Primer3 [
<xref rid="b25-ijms-14-19923" ref-type="bibr">25</xref>
]. The optimal primer size was set to a range of 18–26 bases and the optimal melting temperature was set to 55–59 °C. The optimal product size was set to 130–270 bp and the remaining parameters were left at the default settings. For each primer pair, a 5′-M13 tail (5′-TGTAAAACGACGGCCAGT-3′) was added to the forward primer to allow fluorescent labeling during the amplification reactions [
<xref rid="b26-ijms-14-19923" ref-type="bibr">26</xref>
].</p>
</sec>
<sec>
<label>3.3.</label>
<title>PCR and Genotyping</title>
<p>The PCR mix contained 10 ng of genomic DNA, 8 pmol each of the reverse primer and fluorescent labeled (6-FAM, NED, PET, and VIC) M13 primer, and 4 pmol of the forward primer, Premix Taq (TaKaRa Ex Taq
<sup>®</sup>
version 2.0; TaKaRa Bio, Otsu, Japan) in a final reaction volume of 20 μL. The PCR amplification protocol was 94 °C for 5 min, followed by 30 cycles of 94 °C for 30 s, 56 °C for 45 s, and 72 °C for 45 s, then 12 cycles of 94 °C for 30 s, 53 °C for 45 s, and 72 °C for 45 s, and a final extension at 72 °C for 10 min. Subsequently, the PCR product was added to Hi-Di™ formamide with 500 LIZ
<sup>®</sup>
size standard (Applied Biosystems, Foster City, CA, USA) and run on an ABI 3730xl automatic sequencer (Applied Biosystems, Foster City, CA, USA). The microsatellite profiles were examined using GeneMarker ver. 1.85 (Softgenetics, State College, PA, USA). To verify the flanking sequences of the microsatellite repeats and to confirm whether target fragments of interest were amplified, PCR was performed with 8 pmol of forward and reverse primers without fluorescent-labeled M13 primer. The amplified products were sequenced using an ABI 3730XL and the targeted sequences were checked for correct amplification.</p>
</sec>
<sec>
<label>3.4.</label>
<title>Statistical Analysis</title>
<p>We estimated the proportion of polymorphic markers and the average number of alleles per marker and calculated
<italic>H</italic>
<sub>O</sub>
and
<italic>H</italic>
<sub>E</sub>
using Arlequin ver. 3.11 [
<xref rid="b27-ijms-14-19923" ref-type="bibr">27</xref>
]. Hardy-Weinberg equilibrium (HWE) in the Gyeongho River population of
<italic>Pungtungia herzi</italic>
was analyzed and the program MICRO-CHECKER ver. 2.2.3 [
<xref rid="b28-ijms-14-19923" ref-type="bibr">28</xref>
] was used to check for null alleles and scoring errors due to stuttering or large allele dropout.</p>
</sec>
</sec>
<sec sec-type="conclusions">
<label>4.</label>
<title>Conclusions</title>
<p>We developed 16 new microsatellite markers in
<italic>Pungtungia herzi</italic>
. Of these, 15 and 11 markers were applied successfully in the endangered species
<italic>Pseudopungtungia nigra</italic>
and
<italic>Pseudopungtungia tenuicorpa</italic>
, respectively. This achievement demonstrates that the microsatellite markers developed using the NGS method from a related species can be applied effectively to an endangered species. Developing these microsatellite primers will assist work to determine genetic relationships among the species, as well as improving our understanding of the population genetic structure within each species.</p>
</sec>
</body>
<back>
<ack>
<title>Acknowledgments</title>
<p>This project was supported by a grant from the National Institute of Biological Resources (NIBR), funded by the Ministry of Environment (MOE) of the Republic of Korea (NIBR No. 2012-01-025). The authors appreciate Keun-Sik Kim for his contribution on collecting samples.</p>
</ack>
<notes>
<title>Conflicts of Interest</title>
<p>The authors declare no conflict of interest.</p>
</notes>
<ref-list>
<title>References</title>
<ref id="b1-ijms-14-19923">
<label>1</label>
<element-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Kim</surname>
<given-names>I.-S.</given-names>
</name>
</person-group>
<article-title>Freshwater fishes</article-title>
<source>Illustrated Encyclopedia of Fauna and Flora of Korea (in Korean)</source>
<publisher-name>Ministry of Education</publisher-name>
<publisher-loc>Seoul, Korea</publisher-loc>
<year>1997</year>
<volume>37</volume>
<fpage>194</fpage>
<lpage>200</lpage>
</element-citation>
</ref>
<ref id="b2-ijms-14-19923">
<label>2</label>
<element-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Lim</surname>
<given-names>M.S.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>B.H.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>S.J.</given-names>
</name>
</person-group>
<source>Endemic Species of Korea</source>
<publisher-name>National Institute of Biological Resources</publisher-name>
<publisher-loc>Incheon, Korea</publisher-loc>
<year>2012</year>
<fpage>19</fpage>
</element-citation>
</ref>
<ref id="b3-ijms-14-19923">
<label>3</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname>
<given-names>I.-S.</given-names>
</name>
<name>
<surname>Choi</surname>
<given-names>S.-H.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>H.-H.</given-names>
</name>
<name>
<surname>Han</surname>
<given-names>K.-H.</given-names>
</name>
</person-group>
<article-title>Brood parasite of Korean Shiner,
<italic>Pseudopungtungia nigra</italic>
, in the Keum River, Korea</article-title>
<source>Korean J. Ichthyol</source>
<year>2004</year>
<volume>16</volume>
<fpage>75</fpage>
<lpage>79</lpage>
</element-citation>
</ref>
<ref id="b4-ijms-14-19923">
<label>4</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname>
<given-names>K.-S.</given-names>
</name>
<name>
<surname>Yun</surname>
<given-names>Y.-E.</given-names>
</name>
<name>
<surname>Kang</surname>
<given-names>E.-J.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>S.-G.</given-names>
</name>
<name>
<surname>Bang</surname>
<given-names>I.-C.</given-names>
</name>
</person-group>
<article-title>Genetic diversity and population structure of endangered fish
<italic>Pseudopungtungia nigra</italic>
(Cyprinidae) from the Geum and Mankyung Rivers assessed by amplified fragment length polymorphism</article-title>
<source>Korean J. Ichthyol</source>
<year>2009</year>
<volume>21</volume>
<fpage>76</fpage>
<lpage>80</lpage>
</element-citation>
</ref>
<ref id="b5-ijms-14-19923">
<label>5</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ko</surname>
<given-names>M.-H.</given-names>
</name>
<name>
<surname>Park</surname>
<given-names>S.-Y.</given-names>
</name>
<name>
<surname>Bang</surname>
<given-names>I.-C.</given-names>
</name>
</person-group>
<article-title>Egg development early life history of the Slender,
<italic>Pseudopungtungia tenuicorpa</italic>
(Pisces: Cyprinidae)</article-title>
<source>Korean J. Ichthyol</source>
<year>2012</year>
<volume>24</volume>
<fpage>48</fpage>
<lpage>55</lpage>
</element-citation>
</ref>
<ref id="b6-ijms-14-19923">
<label>6</label>
<element-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Mills</surname>
<given-names>L.S.</given-names>
</name>
</person-group>
<source>Conservation of Wildlife Populations: Demography, Genetics and Management</source>
<publisher-name>Willey-Blackwell</publisher-name>
<publisher-loc>Malden, MA, USA</publisher-loc>
<year>2006</year>
<fpage>38</fpage>
<lpage>58</lpage>
</element-citation>
</ref>
<ref id="b7-ijms-14-19923">
<label>7</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname>
<given-names>S.G.</given-names>
</name>
<name>
<surname>Morishima</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Arai</surname>
<given-names>K</given-names>
</name>
</person-group>
<article-title>Cross-species amplification of microsatellite markers for the brown sole in the family Pleuronectidae</article-title>
<source>Fish Sci</source>
<year>2009</year>
<volume>75</volume>
<fpage>1103</fpage>
<lpage>1107</lpage>
</element-citation>
</ref>
<ref id="b8-ijms-14-19923">
<label>8</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shikano</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Ramadevi</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Shimada</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Merilä</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>Utility of sequenced genomes for microsatellite marker development in non-model organisms: a case study of functionally important genes in nine-spined stickleback (
<italic>Pungitius pungitius</italic>
)</article-title>
<source>BMC Genomics</source>
<year>2010</year>
<volume>11</volume>
<fpage>334</fpage>
<pub-id pub-id-type="pmid">20507571</pub-id>
</element-citation>
</ref>
<ref id="b9-ijms-14-19923">
<label>9</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Morin</surname>
<given-names>P.A.</given-names>
</name>
<name>
<surname>Mahboubi</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Wedel</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Rogers</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>Rapid screening and comparison of human microsatellite markers in baboon: allele size is conserved, but allele number is not</article-title>
<source>Genomics</source>
<year>1998</year>
<volume>53</volume>
<fpage>12</fpage>
<lpage>20</lpage>
<pub-id pub-id-type="pmid">9787073</pub-id>
</element-citation>
</ref>
<ref id="b10-ijms-14-19923">
<label>10</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jarne</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Lagoda</surname>
<given-names>P.J.L.</given-names>
</name>
</person-group>
<article-title>Microsatellites, from molecules to populations and back</article-title>
<source>Trends Ecol. Evol</source>
<year>1996</year>
<volume>11</volume>
<fpage>424</fpage>
<lpage>429</lpage>
<pub-id pub-id-type="pmid">21237902</pub-id>
</element-citation>
</ref>
<ref id="b11-ijms-14-19923">
<label>11</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname>
<given-names>K.-S.</given-names>
</name>
<name>
<surname>Min</surname>
<given-names>M.-S.</given-names>
</name>
<name>
<surname>An</surname>
<given-names>J.-H.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>H</given-names>
</name>
</person-group>
<article-title>Cross-species amplification of Bovidae microsatellites and low diversity of the endangered Korean goral</article-title>
<source>J. Hered</source>
<year>2004</year>
<volume>95</volume>
<fpage>521</fpage>
<lpage>525</lpage>
<pub-id pub-id-type="pmid">15475399</pub-id>
</element-citation>
</ref>
<ref id="b12-ijms-14-19923">
<label>12</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bezault</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Rognon</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Gharbi</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Baroiller</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Chevassus</surname>
<given-names>B</given-names>
</name>
</person-group>
<article-title>Microsatellites cross-species amplification across some African cichlids</article-title>
<source>Int. J. Evol. Biol</source>
<year>2012</year>
<fpage>870935:1</fpage>
<lpage>870935:7</lpage>
<pub-id pub-id-type="pmid">22701809</pub-id>
</element-citation>
</ref>
<ref id="b13-ijms-14-19923">
<label>13</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pimmer</surname>
<given-names>C.R.</given-names>
</name>
<name>
<surname>Moller</surname>
<given-names>A.P.</given-names>
</name>
<name>
<surname>Ellegren</surname>
<given-names>H</given-names>
</name>
</person-group>
<article-title>A wide-range survey of cross-species microsatellite amplification in birds</article-title>
<source>Mol. Ecol</source>
<year>1996</year>
<volume>5</volume>
<fpage>365</fpage>
<lpage>378</lpage>
<pub-id pub-id-type="pmid">8688957</pub-id>
</element-citation>
</ref>
<ref id="b14-ijms-14-19923">
<label>14</label>
<element-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Scribner</surname>
<given-names>K.T.</given-names>
</name>
<name>
<surname>Pearce</surname>
<given-names>J.M.</given-names>
</name>
</person-group>
<article-title>Microsatellites: evolutionary and methodological background and empirical applications at individual, population and phylogenetic level</article-title>
<source>Molecular Methods in Ecology</source>
<person-group person-group-type="editor">
<name>
<surname>Baker</surname>
<given-names>A.</given-names>
</name>
</person-group>
<publisher-name>Blackwell Science Limited</publisher-name>
<publisher-loc>London, UK</publisher-loc>
<year>2000</year>
<fpage>235</fpage>
<lpage>273</lpage>
</element-citation>
</ref>
<ref id="b15-ijms-14-19923">
<label>15</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname>
<given-names>I.-S.</given-names>
</name>
<name>
<surname>Choi</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Shim</surname>
<given-names>J.-H.</given-names>
</name>
</person-group>
<article-title>An occurrence of intergeneric hybrid cross,
<italic>Pungtungia herzi</italic>
×
<italic>Pseudopungtungia nigra</italic>
from the Ungcheon River, Korea</article-title>
<source>Korean J. Ichthyol</source>
<year>1991</year>
<volume>3</volume>
<fpage>42</fpage>
<lpage>47</lpage>
</element-citation>
</ref>
<ref id="b16-ijms-14-19923">
<label>16</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Baba</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Karino</surname>
<given-names>K</given-names>
</name>
</person-group>
<article-title>Countertactics of the Japanese aucha perch
<italic>Siniperca. kawamebari</italic>
against brood parasitism by the Japanese minnow
<italic>Pungtungia herzi</italic>
</article-title>
<source>J. Ethol</source>
<year>1998</year>
<volume>16</volume>
<fpage>67</fpage>
<lpage>72</lpage>
</element-citation>
</ref>
<ref id="b17-ijms-14-19923">
<label>17</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nagata</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Maehata</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>Utilization of nests of eleotrid goby,
<italic>Odontobutis. obscura</italic>
by minnow
<italic>Pungtungia herzi</italic>
</article-title>
<source>Annu. Rep. Biwako Bunkakan</source>
<year>1991</year>
<volume>9</volume>
<fpage>17</fpage>
<lpage>20</lpage>
</element-citation>
</ref>
<ref id="b18-ijms-14-19923">
<label>18</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yamane</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Yokoyama</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Nagata</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yamada</surname>
<given-names>T</given-names>
</name>
</person-group>
<article-title>Reproductive ecology and early life history of the bagrid catfish
<italic>Pseudobagrus nudiceps</italic>
</article-title>
<source>Jpn. J. Ichthyol</source>
<year>2004</year>
<volume>51</volume>
<fpage>131</fpage>
<lpage>147</lpage>
</element-citation>
</ref>
<ref id="b19-ijms-14-19923">
<label>19</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yamane</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Watanabe</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Nagata</surname>
<given-names>Y</given-names>
</name>
</person-group>
<article-title>Flexibility of reproductive tactics and their consequences in the brood parasitic fish
<italic>Pungtungia herzi</italic>
(Teleostei: Cyprinidae)</article-title>
<source>J. Fish Biol</source>
<year>2009</year>
<volume>75</volume>
<fpage>563</fpage>
<lpage>574</lpage>
<pub-id pub-id-type="pmid">20738557</pub-id>
</element-citation>
</ref>
<ref id="b20-ijms-14-19923">
<label>20</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tang</surname>
<given-names>K.L.</given-names>
</name>
<name>
<surname>Agnew</surname>
<given-names>M.K.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>W.-J.</given-names>
</name>
<name>
<surname>Hirt</surname>
<given-names>M.V.</given-names>
</name>
<name>
<surname>Raley</surname>
<given-names>M.E.</given-names>
</name>
<name>
<surname>Sado</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Schneider</surname>
<given-names>L.M.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Bart</surname>
<given-names>H.L.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>S.P.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Phylogeny of the gudgeons (Teleostei: Cyprinidae: Gobioninae)</article-title>
<source>Mol. Phylogenet. Evol</source>
<year>2011</year>
<volume>61</volume>
<fpage>103</fpage>
<lpage>124</lpage>
<pub-id pub-id-type="pmid">21672635</pub-id>
</element-citation>
</ref>
<ref id="b21-ijms-14-19923">
<label>21</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gardner</surname>
<given-names>M.G.</given-names>
</name>
<name>
<surname>Fitch</surname>
<given-names>A.J.</given-names>
</name>
<name>
<surname>Bertozzi</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Lowe</surname>
<given-names>A.J.</given-names>
</name>
</person-group>
<article-title>Rise of the machines—Recommendations for ecologists when using next generation sequencing for microsatellite development</article-title>
<source>Mol. Ecol. Resour</source>
<year>2011</year>
<volume>11</volume>
<fpage>1093</fpage>
<lpage>1101</lpage>
<pub-id pub-id-type="pmid">21679314</pub-id>
</element-citation>
</ref>
<ref id="b22-ijms-14-19923">
<label>22</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yu</surname>
<given-names>J.-N.</given-names>
</name>
<name>
<surname>Won</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Jun</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Lim</surname>
<given-names>Y.W.</given-names>
</name>
<name>
<surname>Kwak</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>Fast and cost-effective mining of microsatellite markers using NGS technology: An example of a Korean water deer
<italic>Hydropotes inermis argyropus</italic>
</article-title>
<source>PLoS One</source>
<year>2011</year>
<volume>6</volume>
<fpage>e26933</fpage>
<pub-id pub-id-type="pmid">22069476</pub-id>
</element-citation>
</ref>
<ref id="b23-ijms-14-19923">
<label>23</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tóth</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Gáspári</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Jurka</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>Microsatellites in different eukaryotic genomes: Survey and analysis</article-title>
<source>Genome Res</source>
<year>2000</year>
<volume>10</volume>
<fpage>967</fpage>
<lpage>981</lpage>
<pub-id pub-id-type="pmid">10899146</pub-id>
</element-citation>
</ref>
<ref id="b24-ijms-14-19923">
<label>24</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shanker</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Bhargava</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Bajpai</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Singh</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Srivastava</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Sharma</surname>
<given-names>V.</given-names>
</name>
</person-group>
<article-title>Bioinformatically mined simple sequence repeats in UniGene of
<italic>Citrus sinensis</italic>
</article-title>
<source>Sci. Hortic</source>
<year>2007</year>
<volume>113</volume>
<fpage>353</fpage>
<lpage>361</lpage>
</element-citation>
</ref>
<ref id="b25-ijms-14-19923">
<label>25</label>
<element-citation publication-type="webpage">
<person-group person-group-type="author">
<name>
<surname>Rozen</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Skaletsky</surname>
<given-names>H.J.</given-names>
</name>
</person-group>
<source>Primer3</source>
<comment>Available online:
<ext-link ext-link-type="uri" xlink:href="http://www.genome.wi.mit.edu/genome_software/other/primer3.html">http://www.genome.wi.mit.edu/genome_software/other/primer3.html</ext-link>
</comment>
<date-in-citation>(accessed on 16 July 2012)</date-in-citation>
</element-citation>
</ref>
<ref id="b26-ijms-14-19923">
<label>26</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schuelke</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>An economic method for the fluorescent labeling of PCR fragments</article-title>
<source>Nat. Biotechnol</source>
<year>2000</year>
<volume>18</volume>
<fpage>233</fpage>
<lpage>234</lpage>
<pub-id pub-id-type="pmid">10657137</pub-id>
</element-citation>
</ref>
<ref id="b27-ijms-14-19923">
<label>27</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Excoffier</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Laval</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Schneider</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>Arlequin (version 3.0): An integrated software package for population genetics data analysis</article-title>
<source>Evol. Bioinform. Online</source>
<year>2005</year>
<volume>1</volume>
<fpage>47</fpage>
<lpage>50</lpage>
<pub-id pub-id-type="pmid">19325852</pub-id>
</element-citation>
</ref>
<ref id="b28-ijms-14-19923">
<label>28</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Van Oosterhout</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Hutchinson</surname>
<given-names>W.F.</given-names>
</name>
<name>
<surname>Wills</surname>
<given-names>D.P.M.</given-names>
</name>
<name>
<surname>Shipley</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite</article-title>
<source>Mol. Ecol. Notes</source>
<year>2004</year>
<volume>4</volume>
<fpage>535</fpage>
<lpage>538</lpage>
</element-citation>
</ref>
</ref-list>
</back>
<floats-group>
<table-wrap id="t1-ijms-14-19923" position="float">
<label>Table 1</label>
<caption>
<p>The set of 16 microsatellite markers developed in
<italic>Pungtungia herzi</italic>
.</p>
</caption>
<table frame="hsides" rules="rows">
<thead>
<tr>
<th align="center" valign="middle" rowspan="1" colspan="1">Marker name</th>
<th align="center" valign="middle" rowspan="1" colspan="1">Repeat motifs</th>
<th align="center" valign="middle" rowspan="1" colspan="1">Primer sequence (5′-3′)</th>
<th align="center" valign="middle" rowspan="1" colspan="1">Annealing (°C)</th>
<th align="center" valign="middle" rowspan="1" colspan="1">Expected Size (bp)</th>
<th align="center" valign="middle" rowspan="1" colspan="1">GenBank accession No.</th>
</tr>
</thead>
<tbody>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">PH_CT03</td>
<td align="center" valign="middle" rowspan="1" colspan="1">GA
<sub>(14)</sub>
</td>
<td align="left" valign="middle" rowspan="1" colspan="1">F: M13-CAGAGCGTGAAAATGTCACTTA
<break></break>
R: TAGTATCCCTCAAAGGTCAACG</td>
<td align="center" valign="middle" rowspan="1" colspan="1">56</td>
<td align="center" valign="middle" rowspan="1" colspan="1">153</td>
<td align="center" valign="middle" rowspan="1" colspan="1">JQ889798</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">PH_CT04</td>
<td align="center" valign="middle" rowspan="1" colspan="1">CT
<sub>(13)</sub>
</td>
<td align="left" valign="middle" rowspan="1" colspan="1">F: M13-GTATTCCAGGGAAAGTAGGAGG
<break></break>
R: ACAGATTCACTCATAAGGGAGG</td>
<td align="center" valign="middle" rowspan="1" colspan="1">56</td>
<td align="center" valign="middle" rowspan="1" colspan="1">174</td>
<td align="center" valign="middle" rowspan="1" colspan="1">JQ889799</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">PH_CA12</td>
<td align="center" valign="middle" rowspan="1" colspan="1">TG
<sub>(17)</sub>
</td>
<td align="left" valign="middle" rowspan="1" colspan="1">F: M13-CAAGATGTGTGCTGGTTCTTTA
<break></break>
R: ATCAGCAGTGCTAAGCTGAAGT</td>
<td align="center" valign="middle" rowspan="1" colspan="1">56</td>
<td align="center" valign="middle" rowspan="1" colspan="1">169</td>
<td align="center" valign="middle" rowspan="1" colspan="1">JQ889802</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">PH_CA28</td>
<td align="center" valign="middle" rowspan="1" colspan="1">CA
<sub>(16)</sub>
</td>
<td align="left" valign="middle" rowspan="1" colspan="1">F: M13-GACAGAGCTTGGTGACAGTTTT
<break></break>
R: AAACATTACGTCTATGGCGAGT</td>
<td align="center" valign="middle" rowspan="1" colspan="1">56</td>
<td align="center" valign="middle" rowspan="1" colspan="1">172</td>
<td align="center" valign="middle" rowspan="1" colspan="1">JQ889804</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">PH_CA34</td>
<td align="center" valign="middle" rowspan="1" colspan="1">TG
<sub>(13)</sub>
</td>
<td align="left" valign="middle" rowspan="1" colspan="1">F: M13-CACCCTCTTCCCTTCAAGATA
<break></break>
R: AGAAAGATTACGTCTGCCTCAG</td>
<td align="center" valign="middle" rowspan="1" colspan="1">56</td>
<td align="center" valign="middle" rowspan="1" colspan="1">166</td>
<td align="center" valign="middle" rowspan="1" colspan="1">JQ889805</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">PH_CA36</td>
<td align="center" valign="middle" rowspan="1" colspan="1">CA
<sub>(13)</sub>
</td>
<td align="left" valign="middle" rowspan="1" colspan="1">F: M13-CACCACTCCATGTACGGTATAG
<break></break>
R: GTTTATGTCAGAGCCCAAATTC</td>
<td align="center" valign="middle" rowspan="1" colspan="1">56</td>
<td align="center" valign="middle" rowspan="1" colspan="1">171</td>
<td align="center" valign="middle" rowspan="1" colspan="1">JQ889806</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">PH_CA37</td>
<td align="center" valign="middle" rowspan="1" colspan="1">CA
<sub>(13)</sub>
</td>
<td align="left" valign="middle" rowspan="1" colspan="1">F: M13-GCGTTATCCATGAGAAGAACAT
<break></break>
R: CTTACAGAACAGTGGGATTTGG</td>
<td align="center" valign="middle" rowspan="1" colspan="1">56</td>
<td align="center" valign="middle" rowspan="1" colspan="1">178</td>
<td align="center" valign="middle" rowspan="1" colspan="1">JQ889807</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">PH_CA38</td>
<td align="center" valign="middle" rowspan="1" colspan="1">CA
<sub>(13)</sub>
</td>
<td align="left" valign="middle" rowspan="1" colspan="1">F: M13-ACACTTTAAAAACCGACAGACG
<break></break>
R: AAAATACCAATTAAAGGAGACGC</td>
<td align="center" valign="middle" rowspan="1" colspan="1">56</td>
<td align="center" valign="middle" rowspan="1" colspan="1">169</td>
<td align="center" valign="middle" rowspan="1" colspan="1">JQ889808</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">PH_CA41</td>
<td align="center" valign="middle" rowspan="1" colspan="1">CA
<sub>(12)</sub>
</td>
<td align="left" valign="middle" rowspan="1" colspan="1">F: M13-AGGTCCCAATTTGAGTTAAAAA
<break></break>
R: ATCACTGTCTGATAAGTGTGCC</td>
<td align="center" valign="middle" rowspan="1" colspan="1">56</td>
<td align="center" valign="middle" rowspan="1" colspan="1">176</td>
<td align="center" valign="middle" rowspan="1" colspan="1">JX915806</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">PH_CA43</td>
<td align="center" valign="middle" rowspan="1" colspan="1">TG
<sub>(12)</sub>
</td>
<td align="left" valign="middle" rowspan="1" colspan="1">F: M13-CCTCACTGGCAATGAAGTCT
<break></break>
R: TTTCTTTATTTCTCTCCCCCTC</td>
<td align="center" valign="middle" rowspan="1" colspan="1">56</td>
<td align="center" valign="middle" rowspan="1" colspan="1">146</td>
<td align="center" valign="middle" rowspan="1" colspan="1">JX915807</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">PH_CA46</td>
<td align="center" valign="middle" rowspan="1" colspan="1">TG
<sub>(12)</sub>
</td>
<td align="left" valign="middle" rowspan="1" colspan="1">F: M13-GGTTTGATTCAGTGTTGCACTA
<break></break>
R: GTTATTTGTGGAGTGTTGGGAT</td>
<td align="center" valign="middle" rowspan="1" colspan="1">56</td>
<td align="center" valign="middle" rowspan="1" colspan="1">177</td>
<td align="center" valign="middle" rowspan="1" colspan="1">JX915808</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">PH_CA52</td>
<td align="center" valign="middle" rowspan="1" colspan="1">CA
<sub>(12)</sub>
</td>
<td align="left" valign="middle" rowspan="1" colspan="1">F: M13-AGAGATTTTCCCACCTACTGCT
<break></break>
R: AGTGTGTACACCTCCTTGTGTG</td>
<td align="center" valign="middle" rowspan="1" colspan="1">56</td>
<td align="center" valign="middle" rowspan="1" colspan="1">148</td>
<td align="center" valign="middle" rowspan="1" colspan="1">JX915809</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">PH_CA54</td>
<td align="center" valign="middle" rowspan="1" colspan="1">CA
<sub>(12)</sub>
</td>
<td align="left" valign="middle" rowspan="1" colspan="1">F: M13-TATTTTTAACTGGCGCTAGGAC
<break></break>
R: CATTTGACTGACTTGCAACAAT</td>
<td align="center" valign="middle" rowspan="1" colspan="1">56</td>
<td align="center" valign="middle" rowspan="1" colspan="1">145</td>
<td align="center" valign="middle" rowspan="1" colspan="1">JX915810</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">PH_TCA01</td>
<td align="center" valign="middle" rowspan="1" colspan="1">TCA
<sub>(13)</sub>
</td>
<td align="left" valign="middle" rowspan="1" colspan="1">F: M13-TAAGGCCCTACACCTGGTATTA
<break></break>
R: TGTTTACACCTGAGACAAGTGG</td>
<td align="center" valign="middle" rowspan="1" colspan="1">56</td>
<td align="center" valign="middle" rowspan="1" colspan="1">174</td>
<td align="center" valign="middle" rowspan="1" colspan="1">JX915811</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">PH_ACT01</td>
<td align="center" valign="middle" rowspan="1" colspan="1">ACT
<sub>(15)</sub>
</td>
<td align="left" valign="middle" rowspan="1" colspan="1">F: M13-GTACAAGTGAGCTAAAGTGACAA
<break></break>
R: AAACCAGATAGGGTCAAACATC</td>
<td align="center" valign="middle" rowspan="1" colspan="1">56</td>
<td align="center" valign="middle" rowspan="1" colspan="1">183</td>
<td align="center" valign="middle" rowspan="1" colspan="1">JX915812</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">PH_ATC01</td>
<td align="center" valign="middle" rowspan="1" colspan="1">ATC
<sub>(19)</sub>
</td>
<td align="left" valign="middle" rowspan="1" colspan="1">F: M13-CAGTGTCCAGTACTGTTCGTGT
<break></break>
R: ATGGGGAGCTAAATTTGTAAT</td>
<td align="center" valign="middle" rowspan="1" colspan="1">56</td>
<td align="center" valign="middle" rowspan="1" colspan="1">193</td>
<td align="center" valign="middle" rowspan="1" colspan="1">JX915813</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="tfn1-ijms-14-19923">
<p>The “expected size” included 18 bp of the M13 tail.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="t2-ijms-14-19923" position="float">
<label>Table 2</label>
<caption>
<p>Polymorphisms of 16 microsatellite markers developed in
<italic>Pungtungia herzi</italic>
.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="left" valign="middle" rowspan="3" colspan="1">Marker name</th>
<th colspan="4" align="center" valign="middle" rowspan="1">Gyeongho river (
<italic>n</italic>
= 32)</th>
<th colspan="4" align="center" valign="middle" rowspan="1">Imjin river (
<italic>n</italic>
= 8)</th>
<th colspan="4" align="center" valign="middle" rowspan="1">Geum river (
<italic>n</italic>
= 8)</th>
</tr>
<tr>
<th colspan="12" align="left" valign="middle" rowspan="1">
<hr></hr>
</th>
</tr>
<tr>
<th align="center" valign="middle" rowspan="1" colspan="1">Size range</th>
<th align="center" valign="middle" rowspan="1" colspan="1">
<italic>N</italic>
<sub>a</sub>
</th>
<th align="center" valign="middle" rowspan="1" colspan="1">
<italic>H</italic>
<sub>O</sub>
</th>
<th align="center" valign="middle" rowspan="1" colspan="1">
<italic>H</italic>
<sub>E</sub>
</th>
<th align="center" valign="middle" rowspan="1" colspan="1">Size range</th>
<th align="center" valign="middle" rowspan="1" colspan="1">
<italic>N</italic>
<sub>a</sub>
</th>
<th align="center" valign="middle" rowspan="1" colspan="1">
<italic>H</italic>
<sub>O</sub>
</th>
<th align="center" valign="middle" rowspan="1" colspan="1">
<italic>H</italic>
<sub>E</sub>
</th>
<th align="center" valign="middle" rowspan="1" colspan="1">Size range</th>
<th align="center" valign="middle" rowspan="1" colspan="1">
<italic>N</italic>
<sub>a</sub>
</th>
<th align="center" valign="middle" rowspan="1" colspan="1">
<italic>H</italic>
<sub>O</sub>
</th>
<th align="center" valign="middle" rowspan="1" colspan="1">
<italic>H</italic>
<sub>E</sub>
</th>
</tr>
</thead>
<tbody>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CT03</td>
<td align="center" valign="top" rowspan="1" colspan="1">143–179</td>
<td align="center" valign="top" rowspan="1" colspan="1">10</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.938</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.858
<sup>*</sup>
</td>
<td align="center" valign="top" rowspan="1" colspan="1">145–149</td>
<td align="center" valign="top" rowspan="1" colspan="1">3</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.750</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.692</td>
<td align="center" valign="top" rowspan="1" colspan="1">145–147</td>
<td align="center" valign="top" rowspan="1" colspan="1">2</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.375</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.325</td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CT04</td>
<td align="center" valign="top" rowspan="1" colspan="1">163–201</td>
<td align="center" valign="top" rowspan="1" colspan="1">14</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.875</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.872</td>
<td align="center" valign="top" rowspan="1" colspan="1">163–193</td>
<td align="center" valign="top" rowspan="1" colspan="1">11</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.875</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.950</td>
<td align="center" valign="top" rowspan="1" colspan="1">163–167</td>
<td align="center" valign="top" rowspan="1" colspan="1">3</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.875</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.575</td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CA12</td>
<td align="center" valign="top" rowspan="1" colspan="1">167–187</td>
<td align="center" valign="top" rowspan="1" colspan="1">12</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.875</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.852</td>
<td align="center" valign="top" rowspan="1" colspan="1">160–187</td>
<td align="center" valign="top" rowspan="1" colspan="1">10</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.750</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.933</td>
<td align="center" valign="top" rowspan="1" colspan="1">158–230</td>
<td align="center" valign="top" rowspan="1" colspan="1">10</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.625</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.892</td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CA28</td>
<td align="center" valign="top" rowspan="1" colspan="1">164–189</td>
<td align="center" valign="top" rowspan="1" colspan="1">10</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.969</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.857</td>
<td align="center" valign="top" rowspan="1" colspan="1">162–226</td>
<td align="center" valign="top" rowspan="1" colspan="1">8</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.875</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.933</td>
<td align="center" valign="top" rowspan="1" colspan="1">177–214</td>
<td align="center" valign="top" rowspan="1" colspan="1">10</td>
<td align="center" valign="top" rowspan="1" colspan="1">1.000</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.942</td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CA34</td>
<td align="center" valign="top" rowspan="1" colspan="1">161–225</td>
<td align="center" valign="top" rowspan="1" colspan="1">12</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.844</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.813</td>
<td align="center" valign="top" rowspan="1" colspan="1">163–184</td>
<td align="center" valign="top" rowspan="1" colspan="1">9</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.500</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.908</td>
<td align="center" valign="top" rowspan="1" colspan="1">163–190</td>
<td align="center" valign="top" rowspan="1" colspan="1">8</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.750</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.900</td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CA36</td>
<td align="center" valign="top" rowspan="1" colspan="1">156–170</td>
<td align="center" valign="top" rowspan="1" colspan="1">10</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.563</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.721
<sup>**</sup>
</td>
<td align="center" valign="top" rowspan="1" colspan="1">152–176</td>
<td align="center" valign="top" rowspan="1" colspan="1">7</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.625</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.850</td>
<td align="center" valign="top" rowspan="1" colspan="1">162–174</td>
<td align="center" valign="top" rowspan="1" colspan="1">6</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.625</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.850</td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CA37</td>
<td align="center" valign="top" rowspan="1" colspan="1">169–187</td>
<td align="center" valign="top" rowspan="1" colspan="1">8</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.656</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.747
<sup>*</sup>
</td>
<td align="center" valign="top" rowspan="1" colspan="1">169–200</td>
<td align="center" valign="top" rowspan="1" colspan="1">7</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.750</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.825</td>
<td align="center" valign="top" rowspan="1" colspan="1">179–196</td>
<td align="center" valign="top" rowspan="1" colspan="1">7</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.875</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.850</td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CA38</td>
<td align="center" valign="top" rowspan="1" colspan="1">161–171</td>
<td align="center" valign="top" rowspan="1" colspan="1">5</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.594</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.799
<sup>**</sup>
</td>
<td align="center" valign="top" rowspan="1" colspan="1">156–173</td>
<td align="center" valign="top" rowspan="1" colspan="1">9</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.750</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.892</td>
<td align="center" valign="top" rowspan="1" colspan="1">156–160</td>
<td align="center" valign="top" rowspan="1" colspan="1">3</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.500</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.492</td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CA41</td>
<td align="center" valign="top" rowspan="1" colspan="1">167–187</td>
<td align="center" valign="top" rowspan="1" colspan="1">10</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.688</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.691</td>
<td align="center" valign="top" rowspan="1" colspan="1">184–209</td>
<td align="center" valign="top" rowspan="1" colspan="1">9</td>
<td align="center" valign="top" rowspan="1" colspan="1">1.000</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.925</td>
<td align="center" valign="top" rowspan="1" colspan="1">184–206</td>
<td align="center" valign="top" rowspan="1" colspan="1">10</td>
<td align="center" valign="top" rowspan="1" colspan="1">1.000</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.933</td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CA43</td>
<td align="center" valign="top" rowspan="1" colspan="1">135–153</td>
<td align="center" valign="top" rowspan="1" colspan="1">8</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.750</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.751</td>
<td align="center" valign="top" rowspan="1" colspan="1">132–143</td>
<td align="center" valign="top" rowspan="1" colspan="1">5</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.375</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.850</td>
<td align="center" valign="top" rowspan="1" colspan="1">136–145</td>
<td align="center" valign="top" rowspan="1" colspan="1">4</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.750</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.725</td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CA46</td>
<td align="center" valign="top" rowspan="1" colspan="1">187–232</td>
<td align="center" valign="top" rowspan="1" colspan="1">15</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.938</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.913</td>
<td align="center" valign="top" rowspan="1" colspan="1">180–259</td>
<td align="center" valign="top" rowspan="1" colspan="1">15</td>
<td align="center" valign="top" rowspan="1" colspan="1">1.000</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.992</td>
<td align="center" valign="top" rowspan="1" colspan="1">197–248</td>
<td align="center" valign="top" rowspan="1" colspan="1">10</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.750</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.925</td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CA52</td>
<td align="center" valign="top" rowspan="1" colspan="1">139–177</td>
<td align="center" valign="top" rowspan="1" colspan="1">13</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.844</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.832</td>
<td align="center" valign="top" rowspan="1" colspan="1">151–178</td>
<td align="center" valign="top" rowspan="1" colspan="1">11</td>
<td align="center" valign="top" rowspan="1" colspan="1">1.000</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.950</td>
<td align="center" valign="top" rowspan="1" colspan="1">164–170</td>
<td align="center" valign="top" rowspan="1" colspan="1">3</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.750</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.700</td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CA54</td>
<td align="center" valign="top" rowspan="1" colspan="1">139–147</td>
<td align="center" valign="top" rowspan="1" colspan="1">5</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.469</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.580</td>
<td align="center" valign="top" rowspan="1" colspan="1">143–157</td>
<td align="center" valign="top" rowspan="1" colspan="1">8</td>
<td align="center" valign="top" rowspan="1" colspan="1">1.000</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.900</td>
<td align="center" valign="top" rowspan="1" colspan="1">139–149</td>
<td align="center" valign="top" rowspan="1" colspan="1">6</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.875</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.833</td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_TCA01</td>
<td align="center" valign="top" rowspan="1" colspan="1">149–193</td>
<td align="center" valign="top" rowspan="1" colspan="1">9</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.781</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.776</td>
<td align="center" valign="top" rowspan="1" colspan="1">155–190</td>
<td align="center" valign="top" rowspan="1" colspan="1">6</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.875</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.842</td>
<td align="center" valign="top" rowspan="1" colspan="1">166–172</td>
<td align="center" valign="top" rowspan="1" colspan="1">2</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.250</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.533</td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_ACT01</td>
<td align="center" valign="top" rowspan="1" colspan="1">161–218</td>
<td align="center" valign="top" rowspan="1" colspan="1">13</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.781</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.871
<sup>*</sup>
</td>
<td align="center" valign="top" rowspan="1" colspan="1">161–206</td>
<td align="center" valign="top" rowspan="1" colspan="1">7</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.875</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.867</td>
<td align="center" valign="top" rowspan="1" colspan="1">164–173</td>
<td align="center" valign="top" rowspan="1" colspan="1">4</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.250</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.517</td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_ATC01</td>
<td align="center" valign="top" rowspan="1" colspan="1">161–188</td>
<td align="center" valign="top" rowspan="1" colspan="1">11</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.594</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.862
<sup>**</sup>
</td>
<td align="center" valign="top" rowspan="1" colspan="1">163–181</td>
<td align="center" valign="top" rowspan="1" colspan="1">4</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.250</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.733</td>
<td align="center" valign="top" rowspan="1" colspan="1">157–181</td>
<td align="center" valign="top" rowspan="1" colspan="1">5</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.625</td>
<td align="center" valign="top" rowspan="1" colspan="1">0.667</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="tfn2-ijms-14-19923">
<p>
<italic>n</italic>
, number of samples;
<italic>N</italic>
<sub>a</sub>
, number of alleles;
<italic>H</italic>
<sub>O</sub>
, observed heterozygosity;
<italic>H</italic>
<sub>E</sub>
, expected heterozygosity.
<sup>*</sup>
<italic>p</italic>
< 0.05,
<sup>**</sup>
<italic>p</italic>
< 0.01: Significant departure from Hardy–Weinberg equilibrium in
<italic>Pungtungia herzi</italic>
in the Gyeongho River population. HW analysis of the Imjin and Geum Rivers were not performed because the sample size was too small. The size ranges include 18 bp of the M13 tail.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="t3-ijms-14-19923" position="float">
<label>Table 3</label>
<caption>
<p>Cross-species amplification of 16 microsatellite markers in
<italic>Pseudopungtungia nigra</italic>
(
<italic>n</italic>
= 6) and
<italic>Pseudopungtungia tenuicorpa</italic>
(
<italic>n</italic>
= 3).</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="center" valign="middle" rowspan="1" colspan="1">Marker name</th>
<th align="center" valign="middle" rowspan="1" colspan="1">
<italic>Pseudopungtungia nigra</italic>
(Size range,
<italic>N</italic>
<sub>a</sub>
)</th>
<th align="center" valign="middle" rowspan="1" colspan="1">
<italic>Pseudopungtungia tenuicorpa</italic>
(Size range,
<italic>N</italic>
<sub>a</sub>
)</th>
</tr>
</thead>
<tbody>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CT03</td>
<td align="center" valign="top" rowspan="1" colspan="1">+(153–175, 7)</td>
<td align="center" valign="top" rowspan="1" colspan="1">+(150–160, 4)</td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CT04</td>
<td align="center" valign="top" rowspan="1" colspan="1">+(165–171, 4)</td>
<td align="center" valign="top" rowspan="1" colspan="1">+(173–175, 2)</td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CA12</td>
<td align="center" valign="top" rowspan="1" colspan="1">+(162–212, 8)</td>
<td align="center" valign="top" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CA28</td>
<td align="center" valign="top" rowspan="1" colspan="1">+(198–252, 10)</td>
<td align="center" valign="top" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CA34</td>
<td align="center" valign="top" rowspan="1" colspan="1">+(157–174, 7)</td>
<td align="center" valign="top" rowspan="1" colspan="1">+(150–176, 5)</td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CA36</td>
<td align="center" valign="top" rowspan="1" colspan="1">+(150–156, 4)</td>
<td align="center" valign="top" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CA37</td>
<td align="center" valign="top" rowspan="1" colspan="1">+(166–190, 3)</td>
<td align="center" valign="top" rowspan="1" colspan="1">+(173–175, 2)</td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CA38</td>
<td align="center" valign="top" rowspan="1" colspan="1">+(160–168, 4)</td>
<td align="center" valign="top" rowspan="1" colspan="1">+(154–168, 5)</td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CA41</td>
<td align="center" valign="top" rowspan="1" colspan="1">+(169, 1)</td>
<td align="center" valign="top" rowspan="1" colspan="1">+(172–192, 6)</td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CA43</td>
<td align="center" valign="top" rowspan="1" colspan="1">+(136–140, 2)</td>
<td align="center" valign="top" rowspan="1" colspan="1">+(132, 1)</td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CA46</td>
<td align="center" valign="top" rowspan="1" colspan="1">+(194–258, 11)</td>
<td align="center" valign="top" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CA52</td>
<td align="center" valign="top" rowspan="1" colspan="1">+(147–163, 5)</td>
<td align="center" valign="top" rowspan="1" colspan="1">+(128, 1)</td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_CA54</td>
<td align="center" valign="top" rowspan="1" colspan="1">+(147–161, 6)</td>
<td align="center" valign="top" rowspan="1" colspan="1">+(155–191, 5)</td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_TCA01</td>
<td align="center" valign="top" rowspan="1" colspan="1">+(155–158, 2)</td>
<td align="center" valign="top" rowspan="1" colspan="1">+(163, 1)</td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_ACT01</td>
<td align="center" valign="top" rowspan="1" colspan="1">+(169–181, 4)</td>
<td align="center" valign="top" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="center" valign="top" rowspan="1" colspan="1">PH_ATC01</td>
<td align="center" valign="top" rowspan="1" colspan="1"></td>
<td align="center" valign="top" rowspan="1" colspan="1">+(191, 1)</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="tfn3-ijms-14-19923">
<p>
<italic>N</italic>
<sub>a</sub>
, number of alleles; +, successful amplification; −, no amplification.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</floats-group>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Wicri/Bois/explor/OrangerV1/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000F841 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 000F841 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Wicri/Bois
   |area=    OrangerV1
   |flux=    Pmc
   |étape=   Corpus
   |type=    RBID
   |clé=     
   |texte=   
}}

Wicri

This area was generated with Dilib version V0.6.25.
Data generation: Sat Dec 3 17:11:04 2016. Site generation: Wed Mar 6 18:18:32 2024